5 apos; uTR element, expression vector and application thereof

Abstract

The invention relates to the field of in-vitro transcription, in particular to a 5 'UTR element, an expression vector and application of the 5' UTR element. The present invention provides a 5 'UTR element having: a nucleotide sequence as shown in any of SEQ ID NO: 9 to SEQ ID NO: 12; or a nucleotide sequence which is obtained by substituting, deleting or adding one or more basic groups to the nucleotide sequence as shown in the specification, and has the same or similar function as the nucleotide sequence as shown in the specification; or a nucleotide sequence having at least 80% of identity with the nucleotide sequence shown in the description. By providing the 5 'UTR sequence, the problem that when mRNA is synthesized in vitro, the prokaryote 5' UTR sequence cannot have the functions of high mRNA expression efficiency and high mRNA capping efficiency at the same time is solved.

Description

[0001] This application claims a divisional application of the Chinese patent application filed with the China Patent Office on May 6, 2024, with application number 202410554063.5 and invention name “5'UTR element, expression vector and its application”, all contents of which are incorporated by reference in this application. Technical Field

[0002] The present invention relates to the field of in vitro transcription, in particular to a 5'UTR element, an expression vector and applications thereof. Background Art

[0003] 5'UTR refers to the region of mature mRNA located upstream of the coding region and downstream of the 5' end cap that is not translated into protein. 5'UTR starts from the transcription start site and ends at the nucleotide before the start codon. It can contain elements that control gene expression through regulatory elements. 5'UTR regulates mRNA stability, ribosome recognition, and mRNA secondary structure by interacting with RNA-binding proteins, which largely determines protein expression efficiency and translation efficiency.

[0004] m7G is a widely existing 5' cap structure in mRNA in eukaryotic cells. It connects the first nucleotide at the 5' end of mRNA through a triphosphate bond, called Cap 0 (m7GpppN, also known as Cap 0). The Cap 0 structure is crucial for the translation of mRNA. The additional methylation modification at the 2'O position of the starting nucleotide of mRNA is called Cap 1 (m7GpppNm, also known as Cap 1). Cap 1 modification can reduce the immune response caused by the in vivo application of mRNA. The mRNA 5' cap can regulate the shearing of pre-mRNA, protect mRNA from degradation by nucleases, and determine the initiation of protein translation. Therefore, in in vitro synthesized mRNA, the higher the proportion of Cap 1, the better.

[0005] In vitro synthesis of mRNA is a process that uses enzymes, templates, NTPs, reaction buffers and other components to simulate the synthesis process of mRNA in vivo. The general process is: preparation and purification of templates, in vitro transcription of mRNA, capping reaction, removal of template DNA, and purification of mRNA. Among them, the capping reaction is greatly affected by the thermodynamic free energy of 5'UTR. After a simple investigation, the lower the thermodynamic free energy of 5'UTR, the more difficult the capping reaction is. It is speculated that 5'UTR with higher thermodynamic free energy has a higher capping rate. Under the same conditions, the higher the capping efficiency of mRNA, the higher the expression efficiency. Therefore, the 5'UTR of in vitro transcribed mRNA not only directly affects the expression efficiency of mRNA, but also indirectly affects the stability and expression efficiency of mRNA by affecting the capping efficiency. Summary of the invention

[0006] In view of this, the present invention provides a 5'UTR element, an expression vector and its application. The present invention solves the problem that when synthesizing mRNA (messenger ribonucleic acid) in vitro, the 5'UTR (5' untranslated region) sequence of the mRNA expression vector cannot simultaneously have the functions of high mRNA expression efficiency and high capping efficiency.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a 5'UTR element, wherein the 5'UTR element has:

[0009] (1) a nucleotide sequence as shown in any of SEQ ID NO: 9 to SEQ ID NO: 12; or

[0010] (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or

[0011] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0012] In some embodiments of the present invention, the sequence of SEQ ID NO: 1 is: ACTCTTCTGCTCGCCACAGTCTGGAGACGAACGCACC. (A1)

[0013] In some embodiments of the present invention, the sequence of SEQ ID NO:2 is: ATTGGATTGTGACGAAGAGATTGAGAGAGAACTGACC. (A2)

[0014] In some embodiments of the present invention, the sequence of SEQ ID NO:3 is: ATAGGATTGTGACGAAGAGATTGAGAGAGAACTGACC. (A3)

[0015] In some embodiments of the present invention, the sequence of SEQ ID NO:4 is: AATATTAAGGTAAAAAGAGAGTGAGAGAGAACGCACC. (A5)

[0016] In some embodiments of the present invention, the sequence of SEQ ID NO:5 is: AATATTAAGG TAAAAAGAGAGAGGTGAATTAGAGAGTAGCCACC. (A7)

[0017] In some embodiments of the present invention, the sequence of SEQ ID NO:6 is: AATATTATTGTAAAAAGAGAGTGAGAGAGAAGGGACC. (A9)

[0018] In some embodiments of the present invention, the sequence of SEQ ID NO:7 is: AATATTAGGGTAAAAAGAGAGTGAGAGAGAAGGGACC. (A10)

[0019] In some embodiments of the present invention, the sequence of SEQ ID NO:8 is: AATATTAGAGTAAAAAGAGAGTGAGAGAGAAGGGACC. (A11)

[0020] In some embodiments of the present invention, the sequence of SEQ ID NO:9 is: ACATTTGCTTC TGACACAACTGTGTTCACTTCACGCATCAAACAGACACC. (B1)

[0021] In some embodiments of the present invention, the sequence of SEQ ID NO: 10 is: ACATTTGCTT CTGACACAACTGTGTTCACTTCACGCATCAAACGGACACC. (B2)

[0022] In some embodiments of the present invention, the sequence of SEQ ID NO: 11 is: ACATTTGCTT CTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (B8)

[0023] In some embodiments of the present invention, the sequence of SEQ ID NO: 12 is: ACATCTGCTT CTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (B9)

[0024] In some embodiments of the present invention, in the above-mentioned 5'UTR element, the 5' end of the nucleotide further includes: GGG base and / or AG base.

[0025] In some embodiments of the present invention, in the above 5'UTR element, the 5'UTR element has:

[0026] (4) a nucleotide sequence as shown in any of SEQ ID NO:29 to SEQ ID NO:36; or

[0027] (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or

[0028] (6) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5).

[0029] In some embodiments of the present invention, the sequence of SEQ ID NO: 13 is: GGGACTCTTCTGCTCGCCACAGTCTGGAGACGAACGCACC. (GGG+A1)

[0030] In some embodiments of the present invention, the sequence of SEQ ID NO: 14 is: AGACTCTTCTGCTCGCCACAGTCTGGAGACGAACGCACC. (AG+A1)

[0031] In some embodiments of the present invention, the sequence of SEQ ID NO: 15 is: GGGATTGGATTGTGACGAAGAGATTGAGAGAGAACTGACC. (GGG+A2)

[0032] In some embodiments of the present invention, the sequence of SEQ ID NO: 16 is: AGATTGGATTGTGACGAAGAGATTGAGAGAGAACTGACC. (AG+A2)

[0033] In some embodiments of the invention, the sequence of SEQ ID NO: 17 is: GGGATAGGATTGTGACGAAGAGATTGAGAGAGAACTGACC (GGG+A3)

[0034] In some embodiments of the present invention, the sequence of SEQ ID NO: 18 is: AGATAGGATTGTGACGAAGAGATTGAGAGAGAACTGACC (AG+A3)

[0035] In some embodiments of the present invention, the sequence of SEQ ID NO: 19 is: GGGAATATTAAGGTAAAAAGAGAGTGAGAGAGAACGCACC. (GGG+A5)

[0036] In some embodiments of the present invention, the sequence of SEQ ID NO:20 is: AGAATATTAAGGTAAAAAGAGAGTGAGAGAGAACGCACC. (AG+A5)

[0037] In some embodiments of the present invention, the sequence of SEQ ID NO:21 is: GGGAATATT AAGGTAAAAAGAGAGAGGTGAATTAGAGAGTAGCCACC. (GGG+A7)

[0038] In some embodiments of the present invention, the sequence of SEQ ID NO:22 is: AGAATATTA AGGTAAAAAGAGAGAGGTGAATTAGAGAGTAGCCACC. (AG+A7)

[0039] In some embodiments of the present invention, the sequence of SEQ ID NO:23 is: GGGAATATTATTGTAAAAAGAGAGTGAGAGAGAAGGGACC. (GGG+A9)

[0040] In some embodiments of the present invention, the sequence of SEQ ID NO:24 is: AGAATATTATTGTAAAAAGAGAGTGAGAGAGAAGGGACC. (AG+A9)

[0041] In some embodiments of the present invention, the sequence of SEQ ID NO:25 is: GGGAATATTAGGGTAAAAAGAGAGTGAGAGAGAAGGGACC. (GGG+A10)

[0042] In some embodiments of the present invention, the sequence of SEQ ID NO:26 is: AGAATATTTAGGGTAAAAAGAGAGTGAGAGAGAAGGGACC. (AG+A10)

[0043] In some embodiments of the present invention, the sequence of SEQ ID NO:27 is: GGGAATATTAGAGTAAAAAGAGAGTGAGAGAGAAGGGACC. (GGG+A11)

[0044] In some embodiments of the present invention, the sequence of SEQ ID NO:28 is: AGAATATTAGAGTAAAAAGAGAGTGAGAGAGAAGGGACC. (AG+A11)

[0045] In some embodiments of the present invention, the sequence of SEQ ID NO:29 is: GGGACATTT GCTTCTGACACAACTGTGTTCACTTCACGCATCAAACAGACACC. (GG G+B1)

[0046] In some embodiments of the present invention, the sequence of SEQ ID NO:30 is: AGACATTTGC TTCTGACACAACTGTGTTCACTTCACGCATCAAACAGACACC. (AG+B1)

[0047] In some embodiments of the present invention, the sequence of SEQ ID NO:31 is: GGGACATTT GCTTCTGACACAACTGTGTTCACTTCACGCATCAAACGGACACC. (GG G+B2)

[0048] In some embodiments of the present invention, the sequence of SEQ ID NO:32 is: AGACATTTGC TTCTGACACAACTGTGTTCACTTCACGCATCAAACGGACACC. (AG+B2)

[0049] In some embodiments of the present invention, the sequence of SEQ ID NO:33 is: GGGACATTT GCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (GG G+B8)

[0050] In some embodiments of the present invention, the sequence of SEQ ID NO:34 is: AGACATTTGC TTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (AG+B8)

[0051] In some embodiments of the present invention, the sequence of SEQ ID NO:35 is: GGGACATCT GCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (GG G+B9)

[0052] In some embodiments of the present invention, the sequence of SEQ ID NO:36 is: AGACATCTGC TTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (AG+B9)

[0053] The present invention also provides an expression cassette, comprising: the above 5'UTR element.

[0054] The present invention also provides an expression vector, comprising: the above 5'UTR element and / or the above expression cassette and an acceptable gene element.

[0055] In some embodiments of the present invention, in the above expression vector, the gene element comprises: one or more of a promoter, a Kozak sequence, a luciferase gene, a 3'UTR element and a polyadenosine tail.

[0056] In some embodiments of the present invention, in the above expression vector, the promoter includes: T7 promoter.

[0057] In some embodiments of the present invention, in the above expression vector, the luciferase gene includes: Gaussia luciferase gene or firefly luciferase gene.

[0058] In some embodiments of the present invention, the above expression vector further comprises a backbone plasmid: pmRVac.

[0059] The present invention also provides a host for transforming and / or transfecting the above expression vector.

[0060] The present invention also provides the use of the above 5'UTR element, the above expression cassette, the above expression vector and / or the above host in in vitro transcription of mRNA.

[0061] The present invention also provides the above 5'UTR element, the above expression cassette, the above expression vector and / or the above host for improving the expression efficiency and / or capping efficiency of in vitro transcribed mRNA.

[0062] The present invention also provides a method for in vitro transcription of mRNA, which comprises linearizing the above expression vector, transcribing mRNA in vitro, and performing capping reaction to obtain the mRNA.

[0063] The present invention provides a 5'UTR element, wherein the 5'UTR element has:

[0064] (1) a nucleotide sequence as shown in any of SEQ ID NO: 9 to SEQ ID NO: 12; or

[0065] (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or

[0066] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0067] The beneficial effects of the present invention include:

[0068] (1) The capping efficiency of the 5'UTR sequence in the present invention is very high in in vitro synthesized mRNA.

[0069] (2) The capping efficiency of the 5'UTR sequence in the present invention is as high as over 80%.

[0070] (3) The expression efficiency of the 5'UTR sequence of the present invention in in vitro synthesized mRNA is higher than that of the existing modified 5'UTR sequence.

[0071] (4) Therefore, the expression efficiency and capping efficiency of the 5'UTR sequence in the present invention are extremely high among the known 5'UTR sequences in in vitro synthesized mRNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0073] Figure 1 Shows the map of mRNA expression vector;

[0074] Figure 2 The intensity diagram of cell expression effect of each designed 5'UTR AG version is shown;

[0075] Figure 3 The intensity diagram of expression effect of each designed 5'UTR GGG version in cell experiment is shown;

[0076] Figure 4 The following are data diagrams comparing the expression effect intensity of some embodiments and comparative examples in cell experiments;

[0077] Figure 5 The fluorescence intensity diagram of the first group of GGG version mRNA in vivo imaging of mice is shown;

[0078] Figure 6 The second group of GGG version mRNA fluorescence intensity images of mice in vivo imaging are shown;

[0079] Figure 7 The fluorescence intensity diagram of the first group of AG version mRNA in vivo imaging of mice is shown;

[0080] Figure 8 The second group of AG version mRNA fluorescence intensity images of mice in vivo are shown;

[0081] Fig. 9 The comparison of luminescence intensity of GGG version mRNA mice in vivo imaging is shown;

[0082] Fig.10 Shown is a comparison of the luminescence intensity of AG version mRNA mice in vivo imaging. DETAILED DESCRIPTION

[0083] The invention discloses a 5'UTR element, an expression vector and applications thereof.

[0084] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0085] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0086] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0087] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0088] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0089] The detection of expression effect mentioned in the present invention: mRNA will translate into corresponding protein in the cell, and Gaussia luciferase expression vector can translate Gaussia luciferase protein in the cell, which reacts with substrate coelenterazine to emit fluorescence. The intensity of chemiluminescence can be detected and converted into numerical values ​​by using a microplate chemiluminescence detection instrument. According to the size of the numerical value, the strength of the expression amount of Gaussia luciferase mRNA expression vectors containing different 5'UTRs in the cell, that is, the strength of the expression effect, can be compared.

[0090] The detection of capping efficiency mentioned in the present invention: the capping process during in vitro synthesis of mRNA will form a variety of intermediate products, the molecular weights of all intermediate products and final products are calculated, and substances with corresponding molecular weights can be detected by liquid chromatography-mass spectrometry. The total value of all intermediate products and final products can be counted, and the proportion of capping products to all intermediate products and final products in the capping process can be calculated, and the capping efficiency can be obtained.

[0091] There are many types of 5' caps for mRNA, the most important of which is Cap 1. The description of improving the capping efficiency in the present invention refers to increasing the Cap 1 ratio.

[0092] The sequence involved in the present invention is as follows:

[0093] GGG+A4: GGGACTCTTCTGCTCGCCACAGTCTCGAGACGAACGCAC C. (as shown in SEQ ID NO: 37)

[0094] GGG+A6: GGGAATATTAAGGTAAAAAGAGAGTGAGAGAGAAGCCAC. (as shown in SEQ ID NO:38)

[0095] GGG+A8: GGGAATATTAAGGTAAGTTAGAGAGAGGTGAATTAGAG AGTAGCCACC. (As shown in SEQ IDNO:39)

[0096] GGG+B3:GGGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGC TCAAACAGACACC. (As shown in SEQID NO:40)

[0097] GGG+B4:GGGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTGAAACAGACACC. (As shown in SEQID NO:41)

[0098] GGG+B5: GGGACATTTGCTTCTGACACAACTAAATAAACTTCACAA ATCAAACGGACACC. (as shown in SEQ ID NO: 42)

[0099] GGG+B6:GGGACATTTGCTTCTGACACAACTAAATAAACTTCACAA ATCATACGGCCACC. (As shown in SEQID NO:43)

[0100] GGG+B7: GGGACATTTGCTTCTGACACAACTAAATAAACTTCACTA ATCATACGGCCACC. (as shown in SEQ ID NO:44)

[0101] GGG+B10: GGGACATCTGCTTCTGACACAACTACATCAACTTCACT AATTTTACGGCCACC. (as shown in SEQ ID NO:45)

[0102] AG+A4: AGACTCTTCTGCTCGCCACAGTCTCGAGACGAACGCACC. (as shown in SEQ ID NO:46)

[0103] AG+A6: AGAATATTAAGGTAAAAAGAGAGTGAGAGAGAAGCCAC C. (as shown in SEQ ID NO:47)

[0104] AG+A8: AGAATATTAAGGTAAGTTAGAGAGAGGTGAATTAGAGAG TAGCCACC. (as shown in SEQ ID NO:48)

[0105] AG+B3: AGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTC AAACAGACACC. (as shown in SEQ IDNO:49)

[0106] AG+B4: AGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTG AAACAGACACC. (as shown in SEQ IDNO:50)

[0107] AG+B5: AGACATTTGCTTCTGACACAACTAAATAAACTTCACAAAT CAAACGGACACC. (as shown in SEQ IDNO:51)

[0108] AG+B6: AGACATTTGCTTCTGACACAACTAAATAAACTTCACAAAT CATACGGCCACC. (as shown in SEQ IDNO:52)

[0109] AG+B7: AGACATTTGCTTCTGACACAACTAAATAAACTTCACTAAT CATACGGCCACC. (as shown in SEQ IDNO:53)

[0110] AG+B10: AGACATCTGCTTCTGACACAACTACATCAACTTCACTAAT TTTACGGCCACC. (as shown in SEQ ID NO:54)

[0111] C1: ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC. (as shown in SEQ ID NO:55)

[0112] GGG+C1: GGGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCA CC. (as shown in SEQ ID NO:56)

[0113] GGG+C2: GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATAT AAGACCCCGGCGCC. (as shown in SEQ IDNO:57)

[0114] C3: AGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCCAAC CGCGGTTCGCGGCCGCT. (as shown in SEQ ID NO:58)

[0115] C4: AGGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAA GA. (as shown in SEQ ID NO:59)

[0116] C5: AGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCCCCC GGCGCC. (as shown in SEQ ID NO:60)

[0117] C6: AGGGCAGTAATAGAATGCTTTCAGGAAGATGACAGAATCAGG AGAAAGATGCTGTTTTGCACTATCTTGATTTGTTACAGCAGCCAACTTA TTGGCATGATGGAGTGACAGGAAAAACAGCTGGC. (as shown in SEQ ID NO:61)

[0118] C7: AGGGGCAAAAATCAAAATCAATCATCATCACAACATCAACAATCAATCATCAACACATCATCAAGACACCACC. (as shown in SEQ ID NO:62)

[0119] The sequence of AG+C1 is: AGACTCTTCTGGTCCCCACAGACTCAGAGAGAAC CCACC. (as shown in SEQ ID NO:63)

[0120] In the examples and comparative examples of the present invention, all the raw materials and reagents used can be purchased from the market.

[0121] The present invention will be further described below in conjunction with embodiments:

[0122] Example 1

[0123] 1. When the inventor used the GGG version of the 5'UTR sequence of the alpha globulin of human hemoglobin, he found that its intracellular expression effect was very poor. The capping rate of its mRNA was detected and it was found that its Cap 1 ratio was 0%. The 5'UTR sequence was input into the RNA structure and energy prediction website: http: / / rna.tbi.univie.ac.at / / cgi-bin / RNAWebSuite / RNAfold.cgi, and it was found that its thermodynamic free energy was low. It is speculated that it may be too low Thermodynamic free energy makes it difficult to perform capping reaction. In order to verify the relationship between the capping efficiency of mRNA 5'UTR and its thermodynamic free energy, and to obtain a 5'UTR sequence with high capping efficiency, the inventor has carried out the present invention.

[0124] 2. According to the length of the 5'UTR sequence of the alpha globulin of human hemoglobin, combined with the inventor's conjecture about the relationship between the thermodynamic free energy of the 5'UTR sequence and the capping efficiency, the inventor designed 9 5'UTR sequences (37nt) with the same length as the 5'UTR sequence of the alpha globulin of human hemoglobin, a 5'UTR sequence with a length of 44nt, and a 5'UTR sequence with a length of 45nt, a total of 11 5'UTRs, which were set as experimental group A. In addition, in order to explore whether the length of the 5'UTR has an effect on the relationship between its own thermodynamic free energy and the capping efficiency, the inventor designed 10 5'UTR sequences with a length of 50nt, which were set as experimental group B. In order to explore whether the relationship between the thermodynamic free energy of the 5'UTR sequence and the capping efficiency has the same effect in different in vitro transcription processes, GGG or AG was added to the front end of the 5'UTR sequence of group A and group B to use different transcription processes for in vitro synthesis of mRNA, and they are called GGG version or AG version.

[0125] 3. The thermodynamic free energy values ​​of the 5'UTR of the GGG version are shown in Table 1:

[0126] Table 1 Prediction of thermodynamic free energy of designed 5'UTR

[0127]

[0128]

[0129]

[0130] 4. Apply the new 5'UTR sequence to the mRNA expression vector containing the Gaussia luciferase gene. Figure 1 As shown, the mRNA expression vector includes T7 promoter, 5′UTR, Kozak sequence, Gaussia luciferase gene, 3′UTR, polyadenylation tail, pmRVac vector and other parts.

[0131] 5. Construct the corresponding mRNA expression vector by genetic engineering and transform the expression vector into E. coli. Grow the transformed E. coli on LB plates containing agar and kanamycin. Pick a single colony and inoculate it in LB liquid medium containing kanamycin and culture it overnight. Use a plasmid extraction kit to extract the plasmid. Verify the correctness of the base sequence of the target region from the T7 promoter to the polyadenylation tail in the plasmid by Sanger sequencing.

[0132] 6. Inoculate the glycerol bacteria corresponding to the plasmid with the correct sequence verified by Sanger sequencing into LB liquid culture medium containing kanamycin, culture overnight, preserve the bacterial solution with glycerol, and extract the plasmid from the remaining bacterial solution using an endotoxin-free plasmid extraction kit.

[0133] 7. Take the plasmid from step 6 and cut it with restriction endonuclease to linearize it. Purify the linearized plasmid using a DNA purification and recovery kit. After purification, perform agarose gel electrophoresis on the sample to confirm that the enzyme cutting is complete.

[0134] 8. Using the linearized DNA in step 7 as a template, synthesize mRNA by in vitro transcription and perform capping reaction to obtain mature mRNA containing a 5' end cap structure (GGG version) or synthesize mature mRNA containing a cap structure in vitro by co-transcription capping method (AG version). Purify mRNA using an mRNA purification kit. Determine the concentration of the mRNA sample and perform gel electrophoresis on the mRNA using denaturing agarose gel to identify the integrity of the mRNA.

[0135] 9. Transfect the mRNA in step 8 into HEK293T cells and culture at 37°C. At 6h, 24h, 48h, and 72h after transfection, aspirate the cell culture supernatant and mix it with the substrate and reaction buffer. The expression product Gaussia luciferase will react with its substrate coelenterazine to produce chemiluminescence. Use a microplate chemiluminescence analyzer to measure the intensity of chemiluminescence and convert it into a numerical value to show the expression effect of the product. According to the intensity of the chemiluminescence reaction of the expression product, the expression efficiency of mRNA with different 5'UTR can be corresponded.

[0136] 10. Use liquid chromatography-mass spectrometry to measure the mRNA capping efficiency.

[0137] According to the intracellular expression effect data and the capping efficiency data, a 5'UTR sequence having an intracellular expression efficiency better than the 5'UTR of comparative example C1 and a Cap 1 capping efficiency greater than 80% was screened out.

[0138] The calculation method of the capping efficiency of Cap 1 is the percentage of the peak area of ​​Cap 1 in mass spectrometry detection to the sum of the peak areas of the substrate, all intermediates, and the final product during the capping process. The ratio of Cap 1 is better when it exceeds 80%, and the higher the better.

[0139] The results of the mRNA capping efficiency test of the GGG version and the AG version are shown in Table 2, where the mRNACap 1 ratios of the designed 5′UTRs are all over 80%. From the experimental results, it can be seen that the mRNA capping efficiency of the GGG version is affected by the thermodynamic free energy of its 5'UTR sequence to a certain extent, while the mRNA capping efficiency of the AG version may not be affected by the thermodynamic free energy of its 5'UTR sequence.

[0140] Table 2 Results of mRNA capping rate detection of the designed GGG and AG versions of 5'UTR

[0141]

[0142]

[0143]

[0144] 11. Use cell experiments to detect differences in mRNA expression.

[0145] HEK293T cells were transfected with Gaussia luciferase mRNA of each version of 5'UTR using 12-well cell culture dishes with a transfection dosage of 0.3 μg / well. 20 μL of cell culture supernatant was collected at 6h, 24h, 48h, and 72h after transfection, mixed with substrate coelenterazine and reaction buffer, and placed in a microplate chemiluminescence detector for chemiluminescence intensity detection.

[0146] The results of the intracellular expression effect verification experiment are as follows Figure 2 , Figure 3 As shown in Table 3 and Table 4.

[0147] Among them, the AG version of mRNA, with AG+C1 as the positive control and untransfected HEK293T cells as the blank control, the expression efficiency of AG+A1, AG+A2, AG+A3, AG+A4, AG+A5, AG+A6, AG+A7, AG+A10, AG+B1, and AG+B2 exceeded that of AG+C1.

[0148] Since the capping rate of GGG+C1 is extremely low, the expression efficiency of its mRNA expression vector in cells is affected by the capping rate and cannot be truly reflected. Therefore, a known better 5'UTR is used as a comparison of the intracellular expression efficiency, which is C2. Among the GGG version of each modified vector, GGG+C2 is used as a positive control, and untransfected HEK293T cells are used as blank controls. The expression efficiencies of GGG+C2 are higher than those of GGG+C2: GGG+A1, GGG+A2, GGG+A3, GGG+A5, GGG+A7, GGG+A9, GGG+A10, GGG+A11, GGG+B1, GGG+B7, and GGG+B8.

[0149] Table 3 Data table of the cell expression effect strength of each designed 5'UTR AG version

[0150]

[0151]

[0152] Table 4 Data table of expression effect intensity of each designed 5'UTR GGG version in cell experiment

[0153]

[0154]

[0155]

[0156]

[0157] The difference significance analysis was performed on the two groups of data in Table 3 and Table 4 of the intracellular expression effect verification experiment results, and the single factor analysis was performed on the data at the 48h time point. The results are shown in Table 5 and Table 6.

[0158] Table 5 GGG version significant difference analysis table

[0159]

[0160]

[0161] Table 6 AG version significant difference analysis table

[0162]

[0163] According to the results of the intracellular expression effect verification experiment, the difference between the two groups of data in Table 5 and Table 6 showed significant differences. There were 8 groups of GGG with significant differences: GGG+A1, GGG+A2, GGG+A5, GGG+A7, GGG+A9, GGG+A10, GGG+B1, GGG+B8, and 11 groups of AG: AG+A1, AG+A3, AG+A4, AG+A5, AG+A6, AG+A7, AG+A10, AG+B1, AG+B2, AG+B4, AG+B10. Based on the experimental results of the two groups, we determined that the related sequences with statistically significant differences were: A1, A2, A3, A4, A5, A6, A7, A9, A10, B1, B2, B4, B8, B10. Although the differences between A11 and B9 and the control group were not significant, it can be seen from the cell experiment data that their expression effects were better than those of the control group.

[0164] Comparative Example

[0165] This comparative example selected 6 Gaussia luciferase mRNA expression vectors with good intracellular expression efficiency of 5'UTR (AG+C1, C3, C4, C5, C6, C7) and compared them with 4 5'UTRs (AG+A2, AG+A5, AG+A7, AG+A10) with high expression efficiency randomly selected from the sequence group with statistically significant differences in the embodiment of the present invention. The transfection dosage was 0.5 μg, and the experimental steps and other variables were consistent with the embodiment. Untransfected HEK293T cells were used as blank controls. The experimental results are shown in Tables 7 and Figure 4 As shown, the intracellular expression efficiency of AG+A2, AG+A5, AG+A7, and AG+A10 of the present invention is better than that of the comparative example.

[0166] Table 7 Comparison of expression effect intensity of some examples and comparative examples in cell experiments

[0167]

[0168]

[0169] The significant difference analysis was performed on Examples AG+A2, AG+A5, AG+A7, and AG+A10 respectively compared with each comparative example, and the single factor analysis was performed on the data at the 48h time point. The results are shown in Tables 8, 9, 10, and 11.

[0170] Table 8 Analysis of significant differences between AG+A2 and comparative examples

[0171]

[0172]

[0173] Table 9 Analysis of significant differences between AG+A5 and comparative examples

[0174]

[0175] Table 10 Analysis of significant differences between AG+A7 and comparative examples

[0176]

[0177] Table 11 Analysis of significant differences between AG+A10 and comparative examples

[0178]

[0179]

[0180] According to the cell experiments and significant difference analysis results of the above examples (AG+A2, AG+A5, AG+A7, AG+A10) and the comparative examples (AG+C1, C3, C4, C5, C6, C7), it can be considered that the expression effects of AG+A5 and AG+A7 are significantly higher than those of the comparative examples C1, C3, C4, C5, C6, and C7. The expression effect of AG+A10 is significantly different from that of the comparative examples. There is no significant difference in the expression effect of AG+A2 compared with that of the comparative examples.

[0181] Description of comparative examples: Comparative example C1 is the 5'UTR sequence of wild-type human hemoglobin alpha globulin. C2-C7 are 5'UTR sequences published in literature or NCBI, and their thermodynamic free energy prediction data are shown in Table 12.

[0182] Table 12 Comparative example thermodynamic free energy prediction and capping efficiency data table

[0183]

[0184] Firefly luciferase

[0185] Mouse experiments:

[0186] Since Gaussia luciferase is secreted, it will be secreted outside the cells after being expressed in mice, and spread throughout the body with the blood, which is not conducive to signal collection. Therefore, the non-secreted firefly luciferase gene was used to explore its expression in mice. 2+ In the presence of ATP and O2, it can catalyze the oxidative decarboxylation of D-luciferin and emit visible light with a wavelength of 550-580nm.

[0187] From the results of the cell experiment of Gaussia luciferase, a 5'UTR with good expression effect was selected to construct the mRNA expression vector of firefly luciferase. It is divided into AG version and GGG version. The same method was used to construct the firefly luciferase gene expression vector containing different 5'UTR to obtain mRNA. In order to make the firefly luciferase mRNA enter the mouse cells more stably, the inventors used lipid nanoparticles (LNP) to encapsulate the mRNA to form LNP-mRNA. And measure the concentration, encapsulation rate, particle size, potential, aggregation index and other parameters of LNP. The LNP quality detection data are shown in Table 13.

[0188] Table 13 LNP quality test data table

[0189]

[0190] Eight-week-old ICR mice were weighed and injected with LNP-mRNA via the tail vein at a dose of 0.25 mg / kg. The substrate solution was injected intraperitoneally 6 hours later, and in vivo imaging experiments were performed after anesthesia.

[0191] The experimental results are as follows Figures 5 to 10 As shown in Table 14:

[0192] Table 14 Luminescence intensity data of mouse in vivo imaging

[0193]

[0194]

[0195] The significance analysis was performed on the mouse in vivo imaging luminescence intensity data table. The results are shown in Table 15:

[0196] Table 15. Comparative significance difference analysis of GGG+A2 and GGG+C1

[0197]

[0198] Table 16 Comparative significance difference analysis table of AG+A2 and AG+C1

[0199]

[0200] From the above in vivo mouse experiments and significant difference analysis results, it can be seen that the expression effect of Example GGG+A2 in mice is slightly better than that of Comparative Example GGG+C2; the expression effect of Example AG+A2 is slightly better than that of Comparative Example AG+C1, and the difference is not significant.

[0201] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. 5'UTR element, characterized in that The 5'UTR element has: (1) a nucleotide sequence as shown in any of SEQ ID NO: 9 to SEQ ID NO: 12; or (2) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

2. The 5'UTR element according to claim 1, characterized in that The 5' end of the nucleotide further includes: GGG base and / or AG base.

3. The 5'UTR element according to claim 2, characterized in that The 5'UTR element has: (4) a nucleotide sequence as shown in any of SEQ ID NO:29 to SEQ ID NO:36; or (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or (6) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5).

4. An expression cassette, characterized in that include: The 5'UTR element according to any one of claims 1 to 3.

5. An expression vector, characterized in that include: The 5'UTR element according to any one of claims 1 to 3 and / or the expression cassette according to claim 4 and an acceptable genetic element.

6. The expression vector according to claim 5, characterized in that The gene elements include: one or more of a promoter, a Kozak sequence, a luciferase gene, a 3'UTR element and a polyadenosine tail.

7. A host, characterized in that Transformation and / or transfection is carried out using the expression vector according to claim 5 or 6.

8. Use of the 5'UTR element according to any one of claims 1 to 3, the expression cassette according to claim 4, the expression vector according to claim 5 or 6 and / or the host according to claim 7 in in vitro transcription of mRNA.

9. The 5'UTR element according to any one of claims 1 to 3, the expression cassette according to claim 4, the expression vector according to claim 5 or 6 and / or the host according to claim 7 improves the expression efficiency and / or capping efficiency of in vitro transcribed mRNA.

10. A method for in vitro transcription of mRNA, characterized in that: The expression vector as claimed in claim 5 or 6 is linearized, and then mRNA is transcribed in vitro and capped to obtain the mRNA.

Images