Gene GmPMT for regulating soybean root nodule symbiotic nitrogen fixation and application thereof

Abstract

The invention relates to a gene GmPMT for regulating and controlling soybean root nodule symbiotic nitrogen fixation and application of the gene GmPMT. Specifically, the invention relates to a separated gene for regulating and controlling soybean root nodule symbiotic nitrogen fixation or nodulation number, a coding region sequence of the gene is shown as SEQ ID NO: 1, or a homologous sequence of the gene has substitution, deletion and / or insertion of one or more nucleotides compared with the sequence shown as SEQ ID NO: 1. The invention also provides application of the gene in cultivation of soybean with increased yield or changed nodulation number, optionally, the nodulation number change shows that the nodulation number, the nodulation number per root and / or the nodulation number per unit root length are increased, and optionally, the nodulation number change shows that the nodulation number per unit root length is increased. The change of the number of nodules is manifested as the number of nodules, the number of nodules per root and / or the number of nodules per unit root length is reduced. The invention has great theoretical and application values for adjusting the symbiotic nitrogen fixation or nodule number of soybean root nodules and related application research.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and botany, and specifically relates to a gene GmPMT for regulating soybean nodule symbiotic nitrogen fixation and an application thereof. Background Art

[0002] Nodulation is one of the most mysterious evolutionary events, and its process requires high energy input. Within the nodule, there is a symbiotic relationship between plants and rhizobia, and plants need to provide carbon sources (such as glucose) to rhizobia in exchange for nitrogen sources produced by nitrogen fixation. Glucose is one of the main energy sources for plants. Through glucose transmembrane transport, plants can transport energy from source leaves (such as leaves) to sink organs (such as roots) to support the energy consumption required for nodulation and nitrogen fixation. Therefore, transmembrane transport of glucose is essential for maintaining this symbiotic relationship. PMT genes encode a class of broad-spectrum polyol and sugar-H+ cotransporters that can effectively transport sugar substances such as glucose from high concentration areas to low concentration areas, which is critical for energy allocation and utilization. Although the role of PMT genes in other plants has been reported, their specific functions in soybean nodulation have not yet been reported. Through the study of PMT genes in soybean nodulation, we can not only gain a deeper understanding of the energy and carbon resource regulation mechanism of the nodulation process, explore its potential in improving soybean nitrogen fixation efficiency and stress resistance, but also provide new ideas for soybean genetic improvement. Summary of the invention

[0003] The number of nodules has a significant impact on the yield and quality of crops, mainly by increasing the nitrogen supply, promoting root development, enhancing disease resistance and tolerance to adversity, and improving the quality by increasing the protein content, mineral content, etc. Although a high number of nodules can increase the nitrogen supply, too much nodulation may affect the growth and resource allocation of plants. Therefore, it is necessary to balance the relationship between the number of nodules and plant growth in breeding to achieve optimal yield and quality. The purpose of the present invention is to provide a gene for regulating the symbiotic nitrogen fixation or nodulation number of soybean nodules and its application.

[0004] The inventors used molecular biology and transcriptomics to clone a related gene cluster (also referred to as GmPMTs in this article) regulating the number of nodules in soybean (Glycine max) from the Chinese soybean germline Zhonghuang 13. The position of the GmPMTs encoding gene in the Gmax_ZH13_V2.0 version sequencing genome is Chr11: 4970318..5003929, including GmPMT3, GmPMT4, GmPMT5, GmPMT6, GmPMT7 and GmPMT8. According to the transcriptome data, GmPMT7 and GmPMT8 have low expression levels in nodules, GmPMT3 / 4 / 5 / 6 are specifically expressed in nodules, and GmPMT3 has the highest expression. The cloning of GmPMT3 provides theoretical basis and gene resources for subsequent molecular assisted breeding and molecular design breeding.

[0005] In a specific embodiment of the present invention, the cDNA sequence of the GmPMT3 gene is shown as SEQ ID NO: 1. In a specific embodiment of the present invention, the amino acid sequence of the GmPMT3 gene is shown as SEQ ID NO: 2.

[0006] The inventors found that when the GmPMT3 protein was used for RNAi using a plant expression vector such as Agrobacterium rhizogenes, the number of nodules in the obtained plants was significantly reduced compared with the source strain. Such an effect was unexpected based on the existing technology. Therefore, the present application provides an isolated protein, which is a soybean rhizobium symbiotic nitrogen fixation-related protein, and annotates the function of its coding sequence in the soybean genome for the first time.

[0007] In the present invention, existing plant expression vectors can be used to construct recombinant vectors containing target genes. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes, antibiotic markers with resistance, or chemical agent resistance marker genes. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity. The plant expression vector can also contain enhancers to increase the expression of the inserted nucleotide fragments.

[0008] To achieve the above object, the present invention also provides a method for obtaining transgenic hairy roots, which comprises introducing the aforementioned gene or a vector or host cell containing the aforementioned gene into target soybeans to obtain soybean hairy roots showing a change in the number of nodules compared with control soybeans.

[0009] To achieve the above object, the present invention also provides a use of the above-mentioned protein or the above-mentioned gene or a vector or host cell containing the above-mentioned gene in soybean genetic engineering.

[0010] The functions of the soybean nodule number-related protein and its encoding nucleic acid provided by the present invention in regulating the soybean nodule number are the first discovery of the applicant, and the phenotypic analysis of transgenic hairy roots and empty vector hairy root plants has verified that the silencing of the soybean root nodule symbiotic nitrogen fixation or nodule number-related protein expressing the present invention can reduce the number of nodules of soybean transgenic hairy roots. The present invention will have great theoretical and application value for regulating the number of soybean root nodules symbiotic nitrogen fixation or nodules and related application research.

[0011] Specifically, the present invention provides the following technical solutions:

[0012] On the one hand, the present invention provides an isolated gene that regulates soybean root nodule symbiotic nitrogen fixation or nodulation number, wherein the coding region sequence of the gene is as shown in SEQ ID NO: 1 or its homologous sequence has one or more nucleotide substitutions, deletions and / or insertions compared with the sequence shown in SEQ ID NO: 1.

[0013] On the other hand, the present invention provides a protein that regulates soybean nodule symbiotic nitrogen fixation or nodulation number, wherein the amino acid sequence of the protein is as shown in SEQ ID NO: 2 or its homologous sequence has one or more amino acid residue substitutions, deletions and / or insertions compared to the sequence shown in SEQ ID NO: 2.

[0014] On the other hand, the present invention provides an expression vector, which comprises the gene as described above or comprises a nucleotide sequence encoding the protein as described above, or comprises a sequence that inhibits the expression of the gene or protein as described above, for example, comprises an interfering sequence of the gene or an interfering sequence of the nucleotide sequence encoding the protein.

[0015] In some embodiments, the nucleotide sequence of the interfering sequence is as shown in SEQ ID NO:3.

[0016] In some embodiments, the expression vector comprises a marker, optionally, the marker is selected from a luminescent marker, an antibiotic marker and an anti-chemical marker, optionally, the luminescent marker is selected from a red fluorescent protein and a green fluorescent protein, the antibiotic marker is selected from an ampicillin marker, a chloramphenicol marker, a kanamycin marker, a neomycin marker, a rifampicin marker, a spectinomycin marker, a hygromycin marker, a streptomycin marker and a tetracycline marker, and the anti-chemical marker is an anti-herbicide marker.

[0017] In another aspect, the present invention provides a host cell comprising the expression vector as described above.

[0018] On the other hand, the present invention provides a method for obtaining soybean hairy roots, which comprises transforming the gene as described above or the nucleotide sequence encoding the protein as described above, or the sequence inhibiting the expression of the gene or protein as described above, or the expression vector or host cell as described above into soybean cells or tissues and cultivating transgenic hairy roots, optionally, the nodulation number of the transgenic hairy roots is changed relative to that of hairy roots that have not been genetically transformed.

[0019] In some embodiments, the vector is a plant expression vector, including a binary Agrobacterium rhizogenes vector and / or a vector that can be used for plant microprojectile bombardment.

[0020] In some embodiments, the host cell is selected from Escherichia coli cells, Agrobacterium cells (eg, Agrobacterium rhizogenes cells), and plant cells.

[0021] In some embodiments, the Agrobacterium rhizogenes is selected from K599, AR1193, C58cl, Arqual, MSU440, LBA9402, and R1601.

[0022] On the other hand, the present invention provides the use of the gene as described above or the nucleotide sequence encoding the protein as described above, or the sequence inhibiting the expression of the gene or protein as described above, or the expression vector or host cell as described above in cultivating soybeans with altered nodule number.

[0023] In some embodiments, the change in nodule number is manifested as an increase in the number of nodules, the number of nodules per root, and / or the number of nodules per unit root length.

[0024] In some embodiments, the change in nodule number is manifested as a decrease in the number of nodules, the number of nodules per root, and / or the number of nodules per root length.

[0025] On the other hand, the present invention provides a method for cultivating transgenic plants with improved yield or altered nodule number and / or nodule number per unit root length, which comprises introducing the gene as described above or the nucleotide sequence encoding the protein as described above, or the sequence inhibiting the expression of the gene or protein as described above, or the expression vector or host cell as described above into target plant cells or tissues to obtain transgenic plants, wherein the yield of the transgenic plant is improved or the nodule number is altered compared with the target plant, and the plant is soybean, and optionally, the change in nodule number is manifested as an increase in the number of nodules, the number of nodules per root and / or the number of nodules per unit root length, and optionally, the change in nodule number is manifested as a decrease in the number of nodules, the number of nodules per root and / or the number of nodules per unit root length.

[0026] definition

[0027] CDS sequence: the coding region sequence. CDS is the part of the transcript that is actually translated into protein, that is, the sequence of the exon. It represents the sequence of amino acids encoded in the gene and is the direct template for protein synthesis. CDS usually does not include introns because introns are spliced ​​out during post-transcriptional processing, leaving only the exon sequence that encodes the protein.

[0028] Transcript sequence: Transcripts are RNA molecules produced by gene transcription, including mRNA, tRNA and rRNA. Transcripts may contain introns and exons. Introns are spliced ​​out during post-transcriptional processing, while exons are retained and ultimately used to encode proteins.

[0029] Tandem duplication: Tandem duplication mainly occurs in the chromosome recombination region. The gene family members formed by tandem duplication are usually closely arranged on the same chromosome, forming a gene cluster with similar sequences and similar functions.

[0030] Beneficial Effects

[0031] A total of 9 PMTs exist in the soybean genome. Homology and evolutionary analysis showed that GmPMT3 / 4 / 5 / 6 / 7 / 8 were expanded from soybean by tandem duplication events. However, GmPMT7 and GmPMT8 were expressed at low levels in nodules. The specific expression of GmPMT1 / 3 / 4 / 5 / 6 in nodules may contribute to energy supply and affect the development of nodules ( Figure 1 A and 1B). To test this hypothesis, we used RNA interference (RNAi) to inhibit the expression of GmPMT1 / 3 / 4 / 5 / 6 and found that the GmPMTs RNAi lines showed a significant decrease in the number of nodules compared with the control ( Figure 1 C-1E). This finding suggests that GmPMTs may play a key role in soybean nodulation development by affecting sugar supply. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 .Functional analysis and verification of nodule organ-specific expression genes GmPMTs. Among them:

[0033] A: Expression pattern analysis of GmPMTs. Heat map of GmPMTs expression in nodule tissue and root & nodule tissue, and histogram comparing the sum of expression in nodule tissue, root & nodule tissue, and other tissues. GmPMTs are numbered according to their position on the chromosome.

[0034] B: Homology of the genomic region containing GmPMTs on chromosome 11 of the soybean genome and its homology between soybean and four other legume species. Genes are represented by rectangular arrows and indicate the direction. Homologous genes are represented by the same color and connected by curved lines. Connections between GmPMTs are highlighted in pink.

[0035] C: Phenotypes of the control group and GmPMTs RNAi lines in soybean hairy root transformed plants.

[0036] D: Comparison of the number of nodules per root in the control group and the GmPMTs RNAi line.

[0037] E: Relative expression levels of GmPMTs in the control group and GmPMTs RNAi strain. DETAILED DESCRIPTION

[0038] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0039] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods or are selected according to the product specifications. The test materials used in the following examples, unless otherwise specified, are purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all repeated at least three times, and the results were averaged.

[0040] In the following examples, the soybean hairy root transformation receptor is Zhonghuang 13. Zhonghuang 13 was bred by sexual hybridization of Yudou No. 8 as the female parent and Zhongzuo 90052-76 as the male parent by the Crop Research Institute of the Chinese Academy of Agricultural Sciences, and was selected by pedigree method. The variety has a growth period of 100 to 105 days, 125 to 127 days for spring sowing, and a pod-setting habit of limited sex, purple flowers, gray hairs, elliptical leaves, 3 to 5 effective branches, 100-grain weight of 24 to 26 grams, elliptical seeds, yellow grain color, brown navel, high protein content, lodging resistance, strong disease resistance, good commerciality, and strong adaptability. It was approved by the National Crop Variety Approval Committee in 2001, and the approval number is 2001008. pDonor221 vector, pK7GWⅡRR vector, Agrobacterium rhizogenes strain K599, and Bradyrhizobium diazoefficiens strain USDA110 were purchased from China Plasmid Vector Strain Cell Gene Collection Center (Biovector Science Lab, Inc).

[0041] The Gateway, recovery kit and other consumables used for RNAi vector construction were purchased from Thermo Fisher Scientific and Tiangen Biotech (Beijing) Co., Ltd.

[0042] The name and number of the gene in this application:

[0043] GmPMT2 SoyZH13_02G054200

[0044] GmPMT9 SoyZH13_16G124800

[0045] GmPMT7 SoyZH13_11G064900

[0046] GmPMT8 SoyZH13_11G065000

[0047] GmPMT3 SoyZH13_11G064402

[0048] GmPMT6 SoyZH13_11G064800

[0049] GmPMT4 SoyZH13_11G064600

[0050] GmPMT1 SoyZH13_01G158000

[0051] GmPMT5 SoyZH13_11G064701

[0052] Example 1 Establishment of GmPMT gene silencing transgenic plants

[0053] Based on a large number of sequence analyses and functional verifications, a polyol and sugar-H+ cotransporter that regulates the number of nodules was found in the soybean variety Zhonghuang 13, named GmPMT3, the coding region sequence of which is shown in SEQ ID NO: 1, and the protein sequence encoded by it is shown in SEQ ID NO: 2. Given that soybean has the GmPMT gene, the present invention studies the function of the gene by gene silencing.

[0054] 1. Construction of recombinant plasmid

[0055] 1. Separate the nodule tissue of soybean variety Zhonghuang 13 from the root, extract RNA and perform reverse transcription to obtain cDNA of the nodule tissue of soybean variety Zhonghuang 13.

[0056] 2. Using the cDNA synthesized in step 1 as a template, perform PCR amplification using a primer pair consisting of F1 and R1 to obtain a PCR amplification product (SEQ ID NO: 3).

[0057] F1: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTT

[0058] CTAGCCACGGTTGG-3' (SEQ ID NO: 4);

[0059] R1: 5'- GGGGACCACTTTGTACAAGAAAGCTGGGTTCCAATGGC

[0060] AAGACCTTGTGC-3' (SEQ ID NO: 5).

[0061] 3. Recover PCR products from gel.

[0062] 4. The PCR product of step 3 and the intermediate vector pDonor221 were connected by BP ClonaseTM II enzyme mix (Invitrogen 11789-020) to obtain the recombinant plasmid GmPMT3-pDonor221. According to the sequencing results, it was confirmed that the recombinant plasmid GmPMT3-pDonor221 was a double-stranded DNA molecule as shown in SEQ ID NO: 3 inserted into the pDonor221 vector.

[0063] 5. The plasmid GmPMT3-pDonor221 obtained in step 4 was connected with the final vector pK7GWⅡRR through LR CLONASEII ENZYME MIX (Invitrogen 11791-020) to obtain the recombinant plasmid GmPMT3-pK7GWⅡRR. According to the sequencing results, the structure of the recombinant plasmid GmPMT3-pK7GWⅡRR was described as follows: a double-stranded DNA molecule as shown in SEQ ID NO: 3 was inserted between attR1 and attR2 of the pK7GWⅡRR vector, which verified that the expression cassette was constructed.

[0064] Table 1 Primers for vector construction

[0065]

[0066] 2. Obtaining transgenic hairy roots with GmPMT3 gene silencing

[0067] 1. Introduce the recombinant plasmid GmPMT3-pK7GWⅡRR into the Agrobacterium rhizogenes strain K599 to obtain the recombinant Agrobacterium, which was frozen at -80°C and stored in glycerol.

[0068] 2. The Agrobacterium rhizogenes obtained in step 1 is transformed into the recipient plant Zhonghuang 13 using the hairy root transformation method. The specific operation steps are as follows:

[0069] (1) Select Zhonghuang 13 soybean seeds that are large, plump, and free of disease spots.

[0070] (2) The selected seeds were sown in vermiculite and germinated in a greenhouse for 3 days. The soybean seeds were transformed when their cotyledons were about to open.

[0071] (4) When sowing seeds, streak the Agrobacterium rhizogenes K599 containing the target vector on solid LB medium and culture it in a 28°C incubator for about 2 days. One day before infection, pick a single clone and inoculate it into 3-5 mL LB liquid medium containing rifampicin (50 μg / mL), streptomycin (10 μg / mL) and spectinomycin (100 μg / mL) and culture it in a shaking incubator at 28°C overnight.

[0072] (5) When the OD600 of the bacterial solution was about 0.8, the cells were collected by centrifugation at 5000 rpm for 6 min and resuspended in infection solution (10 mM MES (2-morpholineethanesulfonic acid) and 10 mM MgCl2) for infecting soybean hypocotyls.

[0073] (6) Use the puncture injection method to infect the hypocotyl of the seedling. The injection site is selected to penetrate the middle of the hypocotyl below the cotyledon, leaving two drops of injection solution on both sides of the stem.

[0074] (7) After the injection is completed, fill the black tray with water, cover it with a transparent lid, and secure it with tape (rooting in a high humidity environment). Cultivate at 28°C for 9 to 14 days to induce transgenic hairy roots on the hypocotyl. Cut the hairy roots and soak them in a disposable plastic cup filled with water to continue culturing until the roots elongate.

[0075] (8) dsRED screening tag, observe after green fluorescence excitation, and screen positive roots.

[0076] (9) Transplant the positive plants into pure vermiculite for cultivation.

[0077] Example 2 Changes in the number of nodules during GmPMT3 gene silencing

[0078] 1. Rhizobium inoculation treatment

[0079] (1) Take 1 mL of Bradyrhizobium diazoefficiens strain USDA110 stored at -80°C and add it to 200 mL of TY liquid medium (5 g / L tryptone, 3 g / L yeast extract, 0.7 g / L CaCl2·2H2O) containing 50 mg / L spectinomycin. Incubate the culture at 28°C with a shaker at 200 rpm for about 4 days until the OD600 is between 0.8 and 1.

[0080] (2) Collect the bacterial suspension in a 500 mL centrifuge bottle and centrifuge at 6000 rpm for 10 min. Resuspend the bacterial cells in sterilized ddH2O to an OD600 of about 0.04 for inoculation.

[0081] (3) Each seedling was inoculated with 50 mL of resuspended bacterial solution.

[0082] (4) Observe the nodulation phenotype 21 days after inoculation.

[0083] 2. Nodule number phenotype statistics and analysis

[0084] 21 days after inoculation, the vermiculite was washed off with tap water and dried with absorbent paper. Green fluorescent light was used to confirm the positive soybean hairy roots of empty vector and GmPMT3-RNAi. It was observed that the number of nodules in the hairy roots of GmPMT3-RNAi was significantly lower than that in the control of empty vector ( Figure 1 C).

[0085] The inventors counted the number of nodules in the hairy roots transfected with GmPMT3-RNAi and the hairy roots transfected with an empty vector. Figure 1 D. From Figure 1 C and Figure 1 As can be seen in D, the average number of nodules per root of GmPMT3-RNAi transgenic hairy roots is only 30% of that of the empty vector control, which indicates that the GmPMT3 gene is involved in the production of soybean nodules.

[0086] 3. Identification of gene expression

[0087] The hairy roots of the empty vector and the hairy roots of the GmPMT3 gene silenced were identified as follows:

[0088] (1) Roots and nodules were collected, total RNA was extracted and reverse transcribed into cDNA.

[0089] (2) Using the cDNA extracted in step (1) as a template, a primer pair consisting of F and R was used to identify the expression level of the GmPMT3 gene and the expression level of the internal reference gene (Actin gene).

[0090] The conditions for quantitative PCR amplification were: pre-denaturation at 95°C for 5 min; amplification (45 cycles) at 95°C for 10 s, 59°C for 15 s, and 72°C for 20 s. After the amplification cycle, the melting curve was started: 95°C for 5 s, 65°C for 1 min, and 65-97°C (the temperature increased at a rate of 0.11°C / s).

[0091] The expression levels of the GmPMT3 gene in different materials obtained by quantitative PCR amplification using the cDNA as a template and each specific primer pair are shown in Figure 1 E. From Figure 1As can be seen from E, in the gene silencing strain GmPMT3-RNAi, the average gene expression level of GmPMT3 is only 40% of that of the empty vector control, the average gene expression level of GmPMT6 is only 50% of that of the empty vector control, the average gene expression level of GmPMT4 is only 30% of that of the empty vector control, the average gene expression level of GmPMT1 is only 20% of that of the empty vector control, and the average gene expression level of GmPMT5 is only 40% of that of the empty vector control.

[0092] Table 2 Quantitative identification primers

[0093]

[0094] sequence

[0095] SEQ ID NO:1 GmPMT3 coding region sequence

[0096]

[0097] SEQ ID NO: 2 Amino acid sequence of GmPMT3

[0098] MAGALLFIKEELQISDLQVGLLAGILNVCALPACMVAGRTSDYLGRRYTIILASVIFLLGSLLMGYGPSYSILIIGRCIVGIGVGFALIIAPVYSAEISSPSYRGFLISLPDVSLNFGLLLGYVSNYFLGKLSLKLGWRTMLVVPAVPSLVLVILMFKLVESPRWLIMQGRVGEARKVLLLVSNTKEEAEKRLKEIKGAAGIDEKCTEDIVHVPKQIRSGAGALKELLCKPSLPVRNILVAAIGVHVFQQVCGIESILLYSPRVFEKTGIMDKSMLLLATVGMGISQAVFTFISAFLLDRVGRRILLLISAGGVVVTLLGLGFCMTMVENSKEKQLWAMGFTIVFTYIFVAFVAIGIGPVTWVYSSEIFPLRLRAQGLAIGVTVNRIANVVVVTSFISIYKKITLGGTFFMYVGITALAWWFYYSLPETKGRSLEDMETIFGKNSKSEIQVKPELWISCMK

[0099] SEQ ID NO: 3 GmPMT3 RNAi fragment

[0100] CTCCTTCTAGCCACGGTTGGTATGGGAATTAGCCAAGCTGTGTTTACATTCATATCTGCTTTCTTGTTGGACAGGGTTGGGAGGAGGATTCTGTTGCTGATTAGTGCAGGTGGTGTGGTTGTGACCCTCTTAGGATTGGGTTTTTGCATGACCATGGTGGAAAACTCCAAAGAAAAACAATTGTGGGCAATGGGTTTTACCATTGTTTTTACCTACATATTTGTAGCTTTTGTGGCTATTGGTATTGGACCTGTGACGTGGGTTTATAGCTCTGAGATTTTTCCCCTCAGGTTGAGAGCACAAGGTCTTGCCATTGG

[0101] SEQ ID NO: 4 Primer F1

[0102] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTT

[0103] CTAGCCACGGTTGG-3'

[0104] SEQ ID NO:5 Primer R1

[0105] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCCAATGGCAAG

[0106] ACCTTGTGC-3'

[0107] SEQ ID NO:6 PMT3-pdonr221-F

[0108] GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTTCTAGCCACGGTTGG

[0109] SEQ ID NO:7 PMT3-pdonr221-R

[0110] GGGGACCACTTTGTACAAGAAAGCTGGGTTCCAATGGCAAGACCTTGTGC

[0111] SEQ ID NO:8 PMT3-QRT-F

[0112] TTGGTATCACTGCGTTGGCT

[0113] SEQ ID NO:9 PMT3-QRT-R

[0114] CAGCGACAGAAACATGACCC

[0115] SEQ ID NO:10 PMT1-QRT-F

[0116] AGGTCGACGCTACACCATCA

[0117] SEQ ID NO:11 PMT1-QRT-R

[0118] AACTGGTGCAACTACTAGGGC

[0119] SEQ ID NO:12 PMT4-QRT-F

[0120] AAGGTCGACGCTACACCATC

[0121] SEQ ID NO:13 PMT4-QRT-R

[0122] ATGAGTGCAAAACCCACGGA

[0123] SEQ ID NO:14 PMT5-QRT-F

[0124] TGTCACAGGAGTGATGAGTGG

[0125] SEQ ID NO:15 PMT5-QRT-R

[0126] TGGAAGCGAGAGTGATGGTG

[0127] SEQ ID NO:16 PMT6-QRT-F

[0128] GCTTTGGCTTGGTGTTTCTACT

[0129] SEQ ID NO:17 PMT6-QRT-R

[0130] GTGTTGCTCTCTGGCTTCGT

[0131] SEQ ID NO:18 Actin11-QRT-F

[0132] GAGCTATGAATTGCCTGATGG

[0133] SEQ ID NO:19 Actin11-QRT-R

[0134] CGTTTCATGAATTCCAGTAGC

[0135] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An isolated gene that regulates soybean root nodule symbiotic nitrogen fixation or nodulation number, characterized in that: The coding region sequence of the gene is as shown in SEQ ID NO: 1 or its homologous sequence or has one or more nucleotide substitutions, deletions and / or insertions compared with the sequence shown in SEQ ID NO:

1.

2. A protein for regulating symbiotic nitrogen fixation or nodulation number of soybean nodules, characterized in that: The amino acid sequence of the protein is as shown in SEQ ID NO: 2 or a homologous sequence thereof, or has one or more amino acid residues substituted, deleted and / or inserted compared with the sequence shown in SEQ ID NO:

2.

3. An expression vector, characterized in that The expression vector comprises the gene according to claim 1 or comprises a nucleotide sequence encoding the protein according to claim 2, or comprises a sequence that inhibits the expression of the gene according to claim 1 or the protein according to claim 2, for example, comprises an interfering sequence of the gene according to claim 1 or an interfering sequence of a nucleotide sequence encoding the protein according to claim 2, optionally the nucleotide sequence of the interfering sequence is as shown in SEQ ID NO:

3.

4. The expression vector according to claim 3, characterized in that The expression vector comprises a marker, optionally, the marker is selected from a luminescent marker, an antibiotic marker and an anti-chemical marker, optionally, the luminescent marker is selected from a red fluorescent protein and a green fluorescent protein, optionally, the antibiotic marker is selected from an ampicillin marker, a chloramphenicol marker, a kanamycin marker, a neomycin marker, a rifampicin marker, a spectinomycin marker, a hygromycin marker, a streptomycin marker and a tetracycline marker, optionally, the anti-chemical marker is an anti-herbicide marker.

5. The expression vector according to claim 3 or 4, characterized in that The vector is a plant expression vector, including a binary Agrobacterium rhizogenes vector and / or a vector that can be used for plant microprojectile bombardment.

6. A host cell comprising the expression vector according to any one of claims 3 to 5.

7. The host cell according to claim 6, characterized in that The host cell is selected from Escherichia coli cells, Agrobacterium cells (such as Agrobacterium rhizogenes cells) and plant cells. Optionally, the Agrobacterium rhizogenes is selected from K599, AR1193, C58cl, Arqual, MSU440, LBA9402 and R1601.

8. A method for obtaining soybean hairy roots, comprising transforming the gene according to claim 1 or the nucleotide sequence encoding the protein according to claim 2, or the sequence inhibiting the expression of the gene according to claim 1 or the protein according to claim 2, or the expression vector according to any one of claims 3 to 5 or the host cell according to claim 6 or 7 into soybean cells or tissues and cultivating transgenic hairy roots, optionally, the nodule number of the transgenic hairy roots is changed relative to that of hairy roots that have not been genetically transformed, optionally, the change in nodule number is manifested as an increase in the number of nodules, the number of nodules per root and / or the number of nodules per unit root length, optionally, the change in nodule number is manifested as a decrease in the number of nodules, the number of nodules per root and / or the number of nodules per unit root length.

9. Use of the gene according to claim 1 or the nucleotide sequence encoding the protein according to claim 2, or the sequence inhibiting the expression of the gene according to claim 1 or the protein according to claim 2, or the expression vector according to any one of claims 3 to 5, or the host cell according to claim 6 or 7 in cultivating soybeans with improved yield or altered nodule number, optionally, the change in nodule number is manifested as an increase in the number of nodules, the number of nodules per root and / or the number of nodules per unit root length, optionally, the change in nodule number is manifested as a decrease in the number of nodules, the number of nodules per root and / or the number of nodules per unit root length.

10. A method for cultivating transgenic plants with increased yield or altered nodulation number, characterized in that: The method comprises introducing the gene according to claim 1 or the nucleotide sequence encoding the protein according to claim 2, or the sequence inhibiting the expression of the gene according to claim 1 or the protein according to claim 2, or the expression vector according to any one of claims 3 to 5 or the host cell according to claim 6 or 7 into the target plant cell or tissue to obtain a transgenic plant, wherein the yield of the transgenic plant is increased or the number of nodules is changed compared with the target plant, optionally, the plant is a leguminous plant, preferably soybean, optionally, the change in the number of nodules is manifested as an increase in the number of nodules, the number of nodules per root and / or the number of nodules per unit root length, optionally, the change in the number of nodules is manifested as a decrease in the number of nodules, the number of nodules per root and / or the number of nodules per unit root length.

Images