MaGRAS51 gene and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a sweet clover gene MaGRAS51 and application thereof.The MaGRAS51 gene is cloned, a recombinant expression vector is constructed to verify the function of the MaGRAS51 gene, and it is found that overexpression of the MaGRAS51 gene can promote root nodule symbiosis of sweet clover roots, the salt stress resistance function is achieved, and in a high-salt environment, the salt stress resistance of the sweet clover is improved. The root nodulation of the sweet clover can still be induced. The gene and the discovery of the function show that the genetic strategy taking the MaGRAS51 as the key gene can improve the symbiotic nitrogen fixation efficiency, sustainability and yield of sweet clover under salt stress, a theoretical basis is provided for efficient nodulation and nitrogen fixation of leguminous plants under abiotic environment stress, and the development of green sustainable agriculture is promoted.

Description

[Technical field]

[0001] The present invention relates to the field of biotechnology, in particular to MaGRAS51 gene and application thereof. [Background technology]

[0002] The interaction between legumes and soil nitrogen-fixing bacteria (rhizobia) leads to the formation of a unique organ called a nodule on the plant roots, which is a plant organ specialized for the mutual exchange of nutrients and provides a site for the nitrogen fixation reaction of rhizobia. Rhizobia convert nitrogen from the air into ammonia by assimilating carbon provided by the host plant, providing an ample source of effective nitrogen for plant growth and soil, reducing dependence on industrial nitrogen fertilizers, and is an important component of sustainable agricultural systems. Sweet clover (Melilotus) is a legume and diploid herb with a strong nitrogen fixation ability, which can improve soil quality and has strong stress resistance. Among the major legume forages, its tolerance to salt and cold is particularly outstanding.

[0003] The symbiotic relationship between legumes and rhizobia is strongly affected by a variety of abiotic stresses, including salt stress. The early stage of nodulation is particularly sensitive to salt stress, and high salt treatment can inhibit bacterial colonization, root hair deformation, root hair curling, and the formation of infection lines. Studies have shown that under high salinity conditions, the number and weight of nodules of legumes are significantly reduced, resulting in decreased plant growth and yield. At the same time, salt stress can significantly inhibit nodules and nitrogen fixation efficiency, resulting in decreased field plant yields. However, there are few studies on the genetic and molecular mechanisms of legume nodule formation and nitrogen fixation in response to salt stress.

[0004] The GRAS protein family is a class of transcription factors (TFs) with unique functions in higher plants, playing a key regulatory role in plant growth and development, signal transduction, and responses to biotic and abiotic stresses. However, research on GRAS genes in Melilotus alba is relatively limited, and there are no reports on their application in regulating symbiotic nitrogen fixation and promoting nodulation and salt tolerance in Melilotus alba. [Summary of the invention]

[0005] In view of the above, it is necessary to conduct applied research on symbiotic nitrogen fixation and promoting nodulation and salt tolerance, to find the effects that can promote plant root nodulation and improve plant salt tolerance at the same time, and still enhance plant nodulation ability under high salt conditions, which will help provide a theoretical basis for efficient nodulation and nitrogen fixation of leguminous plants under abiotic environmental stress and promote the development of green and sustainable agriculture.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] The Clerodendrum truncatum gene MaGRAS51, the nucleic acid sequence of the gene MaGRAS51 is shown in the sequence listing SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0008] The present invention also includes an overexpression vector, which contains the MaGRAS51 gene as claimed in claim 1.

[0009] The present invention also includes a host cell, which comprises the overexpression vector according to claim 3.

[0010] The present invention also includes the use of the Clerodendrum leucoderma gene MaGRAS51 in inducing plant root nodulation.

[0011] The present invention also includes the use of the Clerodendrum leucoderma gene MaGRAS51 in promoting plant growth and development under salt stress conditions.

[0012] The present invention also includes the use of the Clerodendrum leucoderma gene MaGRAS51 in inducing plant root nodulation under high salt stress.

[0013] The present invention also includes a method for inducing plant root nodulation, salt stress tolerance or plant root nodulation under high salt stress, which comprises: overexpressing the sweet clover gene MaGRAS51; specifically, transferring the overexpression vector into Agrobacterium rhizogenes to transform the plant.

[0014] Furthermore, the plant is Sweet Sweet Melilotus.

[0015] The present invention has the following beneficial effects:

[0016] The present invention cloned the MaGRAS51 gene, constructed a recombinant expression vector to verify the function of the MaGRAS51 gene, and found that overexpression of the MaGRAS51 gene can promote the nodule symbiosis of the root system of Melilotus truncatus, and also has the function of salt stress resistance, and can still induce nodulation of the root system of Melilotus truncatus in a high-salt environment. The discovery of the gene and the function shows that the genetic strategy with MaGRAS51 as the key gene can improve the symbiotic nitrogen fixation efficiency, sustainability and yield of Melilotus truncatus under salt stress, which helps to provide a theoretical basis for the efficient nodulation and nitrogen fixation of leguminous plants under abiotic environmental stress, and promote the development of green sustainable agriculture.

Brief Description of the Drawings

[0017] Figure 1 Gene structure of MaGRAS51 from Melilotus officinalis. In the figure, the DNA sequence of MaGRAS51 includes 1524 nucleotides, consisting of 1 exon and no introns. Exons are represented by boxes, and the numbers are the numbers of nucleotides.

[0018] Figure 2 MaGRAS51 protein domain prediction diagram. In the figure, the protein sequence of MaGRAS51 includes 508 amino acids and contains a typical GRAS domain.

[0019] Figure 3 The expression pattern of MaGRAS51 during the nodulation process of Melilotus alba. In the figure, A is the expression level of MaGRAS51 in the flower, leaf, stem, root and nodule tissues of JiMa389; B is the expression level of MaGRAS51 in four tissues of JiMa389 and nodulation-deficient mutant Jima61; C is the expression level of MaGRAS51 in the root and nodule of Melilotus alba at different time points after SM1021 treatment.

[0020] Figure 4 MaGRAS51 positively regulates nodulation of Melilotus officinalis. In the figure, A is the phenotypic analysis of transgenic Melilotus officinalis hairy roots expressing empty vector (EV), OE-MaGRAS51 and RNAi-MaGRAS51 at 30 days; B is the relative expression level of MaGRAS51 in transgenic Melilotus officinalis hairy roots expressing EV, OE-MaGRAS51 and RNAi-MaGRAS51 at 30 days (n=10-12 roots). The number of nodules (C) and fresh weight of nodules (D) of hairy roots (10-12 roots) at 30 days were analyzed using EV, OE-MaGRAS51 and RNAi-MaGRAS51. The relative expression levels of MaNSP1 (E), MaNIN (F) and MaENOD40 (G) in transgenic hairy roots at 30 days after inoculation were analyzed using EV, MaGRAS51-OE and RNAi-MaGRAS51.

[0021] Figure 5 This is a diagram showing the expression of MaGRAS51 gene in the aerial parts and roots of Melilotus officinalis at different times after salt stress analyzed by qRT-PCR.

[0022] Figure 6 It is the salt tolerance of MaGRAS51 in the yeast expression system; among them, the pYES2 vector is the yeast blank control, and pYES2-MaGRAS51 is the yeast expression system of the MaGRAS51 gene.

[0023] Figure 7The results of the experiment on salt tolerance of MaGRAS51 in Melilotus officinalis; A is the phenotypic response of OE-MaGRAS51 and RNAi-MaGRAS51 transgenic hairy root composite plants to salt stress. Under normal conditions and 250 mM NaCl treatment, fresh weight (B), dry weight (C), MDA content (D), H2O2 content (E), GR activity (F), SOD activity (G), Pro content (H) and GPX activity (I) of OE-MaGRAS51 and RNAi-MaGRAS51 transgenic hairy root composite plants.

[0024] Figure 8 The results of histochemical staining using NBT and DAB on the hairy roots of transgenic EV, MaGRAS51-OE and RNAi-MaGRAS51 under normal conditions and treated with 250 mM NaCl for 7 days.

[0025] Fig. 9 The results of MaGRAS51 promoting the formation of nodules of Melilotus sibiricus under salt stress. In the figure, A shows the expression of MaGRAS51 in the roots of Melilotus sibiricus after 24 hours of co-inoculation with rhizobia with 75mMNaCl; B shows the expression level of MaGRAS51 in the nodules of Melilotus sibiricus after 75mMNaCl treatment for 30 days. Under normal conditions or salt stress, the nodulation phenotype (C), the expression level of MaGRAS51 (D), the fresh weight of nodules (E) and the dry weight of nodules (F) of the transgenic hairy roots of empty vector (EV), OE-MaGRAS51 and RNAi-MaGRAS51 were analyzed 30 days after inoculation, and the transcription levels of MaNSP1 (G), MaNIN (H) and MaENOD40 (I) in the transgenic hairy roots of EV, OE-MaGRAS51 and RNAi-MaGRAS51 were analyzed. [Specific implementation method]

[0026] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific implementation disclosed below.

[0027] Example 1

[0028] Cloning and sequence analysis of MaGRAS51 gene: Using the Malbus0704714.1 sequence of the reference genome of Melilotus truncatus as the reference sequence, primers (upstream primer P1 and downstream primer P2) were designed to amplify the MaGRAS51 gene from the whole plant of Melilotus truncatus. The nucleic acid sequence of the gene is shown in SEQ ID NO.1; the amino acid sequence is shown in SEQ ID NO.2.

[0029] Total RNA from the whole plant of Clerodendrum leucoderma was extracted according to the instructions of the RNA extraction kit. The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit. Using this cDNA as a template, PCR amplification was performed using the upstream primer P1 (5'-ATGAATGTAATGGATTATG AGC-3') and the downstream primer P2 (5'-CTAAAACGATTCAGATTCTGAAAG-3') with a high-fidelity enzyme. The PCR reaction system (25 μL) was as follows:

[0030] 12.5 μL Max Buffer, 0.5 μL dNTP, 1 μL 10 μM forward primer, 1 μL 10 μM reverse primer, 1 μL 100 ng / μL cDNA template, 0.5 μL Max Super-Fidelity DNA Polymerase, 8.5 μL of ddH2O.

[0031] The PCR program was: 95°C for 3min; 95°C for 30s, 55°C for 30s, 72°C for 1min and 30s, 35 cycles; 72°C for 5min. After the reaction, the PCR product was subjected to 1.5% agarose gel electrophoresis, and a band of approximately 1524bp was observed in the UV gel imaging system, which was consistent with the expected size. The MaGRAS51 gene fragment was recovered using a PCR product purification kit. The recovered and purified DNA fragment was connected using the 5min TA / Blunt-Zero Cloning Kit instructions. The recombinant plasmid T-MaGRAS51 was transformed into Escherichia coli competent cells, positive clones were screened with ampicillin (100 mg / L) markers, and bacterial liquid PCR was performed for identification. The bacterial liquid of the positive recombinant plasmid was sequenced. The online gene structure analysis system (http: / / gsds.cbi.pku.edu.cn / index.php) was used to analyze the composition of introns and exons of the Pc.APX gene, and the online protein domain analysis system (https: / / smart.embl.de / MEGA7.0) was used to analyze the domain structure of the Pc.APX protein.

[0032] Example 2

[0033] RNA extraction and reverse transcription real-time quantitative PCR analysis: Total RNA was isolated from plant samples using TransZol reagent (TransGen Biotech, Beijing, China) and reverse transcribed using Hifair III 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (Yeasen, Shanghai, China) to synthesize the first-strand cDNA. qRT-PCR was performed using HieffqPCR SYBR Green Master Mix (No Rox) (Yeasen) and gene-specific primers on a CFX96 Real-Time PCR detection system (Bio-Rad, Los Angeles, CA, USA). Maβ-tubulin was used as an internal reference gene. The relative expression level was calculated using the 2-ΔΔCT method. In all analyses, three independent biological replicates were used for each sample for statistical analysis. The primers used for qRT-PCR are as follows:

[0034] Table 1 qRT-PCR primers

[0035] Primer Sequences(5'-3') qPCR-MaGRAS51-F CATGGAGGGAATCCAATGGC qPCR-MaGRAS51-R AATCCGCGAACTCTTTGAGC qPCR-MaNSP1-F AACCCTTATTGTATGTGCTC qPCR-MaNSP1-R CATCATTCTCCTTTCATCAC qPCR-MaNIN-F AGCTTGTTATGTTGGTGACATGG qPCR-MaNIN-R GTGTCACGACAATCTTTAGGAAGG qPCR-MaENOD40-F ACAATCCTCCAATTTACAAGCC qPCR-MaENOD40-R CTTACGCAATGGTGGTTCCT qPCR-Maβ-tubulin-F CCTTGGTGGTGGAACTGGT qPCR-Maβ-tubulin-R GGAGATGGGAACACTGAGAAAG

[0036] Example 3

[0037] Analysis of the spatiotemporal expression pattern of MaGRAS51 in Melilotus alba: In order to identify whether MaGRAS51 is involved in the nodule symbiosis of Melilotus alba, the expression level of MaGRAS51 gene in different tissues of JiMa389 and nodule-deficient mutant Jima61 was analyzed by real-time fluorescence quantitative PCR. The results showed that MaGRAS51 gene was expressed in five tissues including flowers, leaves, stems, roots and nodules, among which MaGRAS51 was mainly expressed in nodules ( Figure 3 A), while the expression level of MaGRAS51 gene in wild-type JiMa389 tissues (flowers, leaves, stems and roots) was significantly higher than that in nodulation-deficient mutant Jima61 ( Figure 3 B), indicating that MaGRAS51 plays a role in nodule formation. To verify whether MaGRAS51 is expressed during rhizobium infection and nodule development, we analyzed the mRNA abundance of MaGRAS51 in roots and nodules at different times after inoculation with Sinorhizobium Meliloti 1021 (SM1021). Figure 3As shown in C, the transcript abundance of MaGRAS51 increased significantly 6 hours after inoculation, peaked at day 1 in roots and nodule roots, and gradually decreased at day 5. At all time points, the expression of MaGRAS51 in nodules was significantly induced in nodule roots, and during nodule development, the expression of MaGRAS51 gradually increased, reaching a peak in mature nodules ( Figure 3 C), indicating that MaGRAS51 may play a role in nodule development and function.

[0038] Example 4

[0039] Gateway technology was used to construct overexpression and RNAi expression vectors: According to the Gateway instruction manual, the attB site was merged into the 5' end of the gene-specific upstream and downstream primers to obtain the upstream primer P1 and downstream primer P2. P1: 5'-GGGGACAAGT TTGTACAAAAAAGCAGGCTTAATGAATGTAATGGATTATGAGC-3', P2: 5'-GGGGACCA CTTTGTACAAGAAAGCTGGGTTAAACGATTCAGATTCTGAAAG-3'. Using P1 / P2 as primers and T-MaGRAS51 plasmid as template, the expression vector was constructed by Max Super-Fidelity DNA Polymerase was used for PCR amplification, and the PCR product was recovered using a gel recovery kit. The entry vector pDONR-Zeo and the gel recovery product were used for BP reaction to construct the entry vector. The BP reaction system is as follows:

[0040] 0.4 μL of Gateway BPⅡ Clonase enzyme mixture, 0.4 μL of gel recovery product (120 ng / μL), 0.4 μL of target vector (120 ng / μL) and 0.8 μL of ddH2O.

[0041] React overnight at 25℃. Transform the ligation product into E. coli DH5α. After transformation, take 100μL of culture and apply it to LB solid plate containing spectinomycin Spe antibiotic with a final concentration of 50mg / L. After positive monoclonal bacterial liquid detection, shake the positive monoclonal with the target band, extract the plasmid with a plasmid extraction kit, and successfully construct the OE-MaGRAS51 and RNAi-MaGRAS51 recombinant plasmids, which are stored at -20℃.

[0042] Example 5

[0043] MaGRAS51 gene transformation into the hairy roots of Clerodendrum leucoderma: OE-MaGRAS51, RNAi-MaGRAS51 and empty vector were transformed into Agrobacterium rhizogenes K599 by electroporation. Single clones were selected for bacterial liquid PCR detection, and the product fragment was consistent with the expected target fragment size, indicating that Agrobacterium with MaGRAS51 gene overexpression and RNAi vector was successfully obtained.

[0044] 200 μL of EV-K599, OE-MaGRAS51-K599 and RNAi-MaGRAS51-K599 bacterial solution was applied to the plate. After germination of Melilotus officinalis seeds for 7 days, the root tip of Melilotus officinalis was quickly cut off with a scalpel 5 mm above the root tip. The cut root seedlings were lightly dipped in the Agrobacterium biofilm and placed on 1 / 2MS medium containing 100 mg / L PPM antibiotics, wrapped in tin foil and cultured in the dark for 5 days. After 5 days of co-culture, the seedlings were taken out of the dark treatment condition, placed on 1 / 2MS solid medium, and placed in a filter paper-seedling-filter paper structure, and placed upright in a 22°C tissue culture room (16h light / 8h dark) for 10 days to start growing hairy roots, and then transferred to water for about 14 days to observe the growth and conduct subsequent experiments.

[0045] Example 6

[0046] MaGRAS51 positively regulates rhizobium infection and nodule formation in Melilotus alba: To investigate whether MaGRAS51 plays a regulatory role in the nodulation process of Melilotus alba, the nodulation phenotype of overexpression (OE-MaGRAS51) and RNAi (MaGRAS51-RNAi) transgenic roots of composite plants inoculated with SM1021 were analyzed. qRT-PCR analysis showed that the transcript accumulation of MaGRAS51 in OE-MaGRAS51 hairy roots was 6.6 times higher than that in vector controls, and the transcript accumulation in MaGRAS51-RNAi hairy roots was 70% lower than that in vector controls ( Figure 4 B). The average number of nodules per MaGRAS51-OE hairy root was significantly increased, while the average number of nodules per RNAi-MaGRAS51 hairy root was significantly decreased compared to the vector control. The vector control hairy roots had an average of approximately 25.4 nodules per root, which increased to 47.4 nodules per root in MaGRAS51-OE hairy roots, while decreasing to 15.8 nodules per root in RNAi-MaGRAS51 hairy roots compared to the vector control, representing increases of 86.8% and 37.8%, respectively ( Figure 4 A, C). Compared with the vector control, the fresh weight of nodules in MaGRAS51-OE hairy roots increased by 86.7% and decreased by 47.4%, respectively ( Figure 4D) These results suggest that MaGRAS51 plays an important role as a positive regulator of root nodules in Melilotus officinalis.

[0047] To investigate whether the expression of key genes in nodulation is affected by MaGRAS51 overexpression and knockdown, we examined the expression levels of MaNSP1, an important transcription factor in the symbiotic signaling pathway, and two early nodule genes, MaNIN and MaENOD40, which are involved in rhizobium entry, nodule initiation, and subsequent organogenesis. qRT-PCR analysis showed that the expression levels of MaNSP1 in MaGRAS51 overexpression and knockdown hairy roots were significantly higher and lower than those in the control hairy roots, respectively ( Figure 4 E). At the same time, qRT-PCR results showed that overexpression of MaGRAS51 significantly increased the expression level of MaNIN, while MaGRAS51 knockdown significantly reduced the expression of MaNIN ( Figure 4 F). Therefore, MaGRAS51 overexpression and knockout also significantly up-regulated and down-regulated the expression level of MaENOD40, respectively ( Figure 4 G). These results suggest that MaGRAS51 may promote root nodulation by activating MaNIN and downstream nodulation genes.

[0048] Example 7

[0049] Yeast expression vector construction: Using the plasmid of T-MaGRAS51 as a template, upstream primer P1 and downstream primer P2 were used for PCR amplification by high-fidelity enzyme. P1: 5'-TACCGAGCTCGGATCATGAATGTAATGGATTATGAGC-3', P2: 5'-GATGCGGCCCTCTAGCTAAAACGATTCAGATTCTGAAAG-3'; PCR reaction system (25 μl) was as follows: 12.5 μL Max Buffer, 0.5 μL of dNTP, 1 μL of P1 (10 μM), 1 μL of P2 (10 μM), 1 μL of plasmid template (100 ng / μL), 0.5 μL of Max Super-Fidelity DNA Polymerase and 8.5 μL of ddH2O.

[0050] The PCR product was subjected to 1.5% agarose gel electrophoresis, and a fragment consistent with the expected size was observed using an ultraviolet gel imager. The MaGRAS51 gene fragment was recovered using a PCR product purification kit.

[0051] Digest the yeast expression vector plasmid pYES2 with BamHI and XbaI. After digestion, purify the product with a PCR product purification kit. Double digestion reaction system: 1 μg of vector plasmid, 1 μL of BamHI, 1 μL of XbaI, 5 μL of 10× buffer, and ddH2O to 50 μL. Digest at 37℃ for 1 hour.

[0052] The target DNA fragment and the linearized vector were homologously recombined using a one-step cloning kit. The system was as follows: linearized vector (fragment length × 0.02 μL), insert fragment (fragment length × 0.04 μL), 5×CE MultiS Buffer 5 μL, ddH2O to 50 μL; react at 37°C for 30 min; cool to 4°C or immediately place on ice. Transform Escherichia coli DH5α by heat shock method. Pick a single clone for bacterial liquid PCR detection, send the positive single clone for sequencing, and the single clone with the correct sequencing is the successful vector constructed. Shake the bacteria, extract the plasmid with a plasmid extraction kit, and store at -20°C.

[0053] Example 8

[0054] Analysis of MaGRAS51 expression pattern in the aerial parts and roots of Clerodendrum leucoderma under salt stress: In order to verify the expression pattern of MaGRAS51 gene under salt stress, the qRT-PCR method was used to analyze the mRNA abundance of MaGRAS51 gene in the stems and roots of Clerodendrum leucoderma at different times (0, 3, 6, 9, 12, 24h) after salt stress treatment. We found that the expression trend of MaGRAS51 gene in stems and roots was not completely consistent, and the response of MaGRAS51 gene to salt stress was more obvious in roots than in stems ( Figure 5 The salt tolerance function of MaGRAS51 gene was further verified by heterologous expression analysis in yeast. The empty pYES2 plasmid and the recombinant pYES2-MaGRAS51 plasmid were transfected into Saccharomyces cerevisiae INVSc1, and the positive single clone was picked and inoculated into 10mL SC-U / 2% (w / v) glucose medium and cultured at 30℃ and 200rpm for 24h. The OD value of the bacterial solution was measured. 600 , transferred to 10 mL SC-U / 2% (w / v) galactose medium to an OD 600 0.4, 30°C, 200 rpm, culture for 36 h; take 200 μL of bacterial solution and set the OD 600 Adjust to 1, centrifuge at 10000rpm at room temperature for 10s, discard the supernatant, add an equal amount of 5M NaCl as salt stress treatment, add an equal amount of sterile water as control, and culture at 30℃ for 36h; the treated bacterial solution is diluted 1, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10-5 times, take 2 μL and spot it on a solid plate containing 50 mg / LAmp of SC-U / 2% (w / v) glucose, invert it in a 30°C incubator and culture it for 3-4 days, take pictures and observe the growth of yeast. The results showed that yeast cells carrying the MaGRAS51 gene were significantly more resistant to 5M NaCl than the control ( Figure 6 ). These results indicated that salt stress strongly induced the expression of MaGRAS51 gene.

[0055] Example 9

[0056] Salt tolerance test of transgenic composite sweet clover: To investigate whether MaGRAS51 can promote plant growth and development under salt stress conditions, we treated OE-MaGRAS51 and MaGRAS51-RNAi transgenic hairy root composite plants with 250 mM NaCl and found that the change in MaGRAS51 expression in transgenic root composite plants significantly affected plant growth. Compared with the vector control, overexpression of MaGRAS51 significantly enhanced the tolerance of transgenic composite plants to salt stress, while the growth of transgenic MaGRAS51-RNAi composite plants was significantly inhibited ( Figure 7 A). Compared with the vector control under normal conditions, the fresh weight of MaGRAS51-OE and RNAi-MaGRAS51 transgenic composite plants increased and decreased by 32.5% and 18.2%, respectively, and the dry weight increased and decreased by 44.4% and 23.9%, respectively. Under 250 mM NaCl treatment, the fresh weight of MaGRAS51-OE and RNAi-MaGRAS51 transgenic composite plants increased and decreased by 58.5% and 39.8%, respectively, and the dry weight increased and decreased by 80.4% and 45.5%, respectively. Figure 7 B, C). The changes in fresh weight and dry weight of transgenic composite plants under 250 mM NaCl treatment were more significant than those under normal conditions, indicating that MaGRAS51 positively regulated the salt tolerance of plants.

[0057] Example 10

[0058] Determination of physiological indicators of the complex white sweet clover under salt stress: The control plants, OE-MaGRAS51 and RNAi-MaGRAS51 transgenic hairy roots were treated with 250mM NaCl and then the physiological indicators were determined. The determination method was referred to the kit instructions. The results showed that under normal conditions, compared with the vector control, the MDA content and SOD activity of the transgenic OE-MaGRAS51 and RNAi-MaGRAS51 hairy roots did not change significantly ( Figure 7D, G), while the H2O2 content in the roots of transgenic OE-MaGRAS51 was significantly reduced, and the GR activity, Pro content and GPX activity were significantly increased, respectively; the H2O2 content in the roots of transgenic RNAi-MaGRAS51 was significantly increased; while the GR activity, Pro content and GPX activity did not change significantly ( Figure 7 E, F, H, I). Under 250 mM NaCl treatment, the MDA content and H2O2 content in the hairy roots of transgenic MaGRAS51-OE and RNAi-MaGRAS51 were significantly decreased and increased, respectively, while GR activity, SOD activity, Pro content and GPX activity showed opposite trends ( Figure 7 DI). NBT and DAB staining showed that under 250 mM NaCl treatment, OE-MaGRAS51 transgenic hairy roots were lighter stained than the empty vector control hairy roots, while the RNAi-MaGRAS51 transgenic hairy roots were the opposite ( Figure 8 )These results suggest that the MaGRAS51 gene may respond to salt stress in an anti-oxidative stress manner.

[0059] Embodiment 11

[0060] MaGRAS51 is highly induced by salt stress during nodulation and its application in promoting nodulation under salt stress:

[0061] MaGRAS51 was identified as a salt-responsive gene and a positive regulator of salt tolerance in Melilotus alba. It was hypothesized that MaGRAS51 may confer nodulation tolerance to salt stress in Melilotus alba. To verify this possibility, we analyzed the expression of MaGRAS51 in uninfected and infected roots of Melilotus alba under salt stress. The results showed that the expression of MaGRAS51 was significantly induced in uninfected roots 24 h after salt treatment and infected roots under normal conditions. It is worth noting that the expression of MaGRAS51 in infected roots under salt stress was more strongly induced, significantly higher than that in uninfected and unstressed roots ( Fig. 9 A). Next, we also found that salt stress had a significant induction effect on MaGRAS51 in nodules ( Fig. 9 B). Given the active roles of MaGRAS51 in both salt stress and nodulation, these results suggest that MaGRAS51 plays a key role in the nodulation response under salt stress.

[0062] To investigate whether MaGRAS51 regulates nodulation under salt stress, we statistically analyzed the nodulation numbers of MaGRAS51-overexpressing and -knockdown transgenic composite plants under salt stress ( Fig. 9C and D). Under salt stress, the average number of nodules per hairy root of the empty vector was about 16.4, which was 35.4% less than that under normal conditions; the number of nodules per hairy root of OE-MaGRAS51 and RNAi-MaGRAS51 was reduced to 38 and 15.8, respectively, which was 19.9% ​​and 55.1% less than that under normal conditions, respectively ( Fig. 9 E). Compared with normal conditions, under salt stress, the nodule fresh weight of the empty vector control, OE-MaGRAS51 and RNAi-MaGRAS51 decreased by 44.8%, 30.4% and 66.3%, respectively ( Fig. 9 F). Compared with the empty vector hairy roots treated with NaCl, NaCl treatment had a smaller inhibitory effect on the nodule number and nodule fresh weight of OE-MaGRAS51 hairy roots, while a larger inhibitory effect on RNAi-MaGRAS51 hairy roots, indicating that MaGRAS51 mediated the positive effects of salt stress during nodulation. In addition, qRT-PCR results showed that compared with the empty vector control, in the hairy roots overexpressing MaGRAS51, the expression levels of MaNSP1 and MaNIN were significantly increased to 6.8 and 11.4 times, respectively, while MaGRAS51 knockdown led to a significant downregulation of the expression of MaNSP1 and MaNIN. Correspondingly, MaGRAS51 overexpression and knockdown also significantly upregulated (to 4.7 times) and downregulated the expression level of MaENOD40 ( Fig. 9 GI). These results indicate that MaGRAS51 is a key regulator of root nodule symbiosis in Melilotus alba under salt stress and may promote nodulation of Melilotus alba under salt stress by activating downstream nodulation genes.

[0063] The wild type JiMa389 (Ma389) and the nodulation-deficient mutant Jima61 (Ma61) in the examples of the present application have been disclosed in the paper "Nodulation phenotype and biomass analysis of the nodulation-deficient mutant of Melilotifolia" previously published by the research group.

[0064] In summary, the present application conducted Bulked Segregant Analysis (BSA) resequencing on wild-type JiMa389 and nodulation-deficient mutant Jima61, and located a GRAS gene MaGRAS51. The experiment on the hairy roots of Melilotus officinalis showed that the overexpression of the MaGRAS51 gene could significantly increase the number of nodules and the fresh weight of nodules in transgenic hairy roots, while the knockdown of MaGRAS51 significantly reduced the number of nodules and the fresh weight of nodules in transgenic hairy roots. The overexpression of the MaGRAS51 gene significantly increased the salt tolerance of transgenic hairy root composite plants, while the growth of the composite plants with MaGRAS51 knockdown was significantly inhibited. At the same time, the MDA content and H2O2 content in the overexpressed transgenic hairy roots were significantly reduced, and the GR activity, SOD activity, Pro content and GPX activity were significantly increased, while RNAi-MaGRAS51 showed the opposite trend. This shows that the MaGRAS51 gene not only plays a key role in the salt tolerance of roots, but also may be a key regulatory factor for nodulation under salt stress. Under salt stress conditions, compared with the empty vector control, overexpression of the MaGRAS51 gene could significantly increase the number and fresh weight of nodules in transgenic hairy roots, and significantly upregulated the expression levels of symbiotic signaling pathway genes MaNSP, MaNIN and MaENOD4, while the transgenic hairy roots of RNAi-MaGRAS51 showed the opposite results.

[0065] The above-described embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several modifications and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the attached claims.

Claims

1. The Clerodendrum tiliaceum gene MaGRAS51, characterized in that The nucleic acid sequence of the gene MaGRAS51 is shown in the sequence listing as SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.

2.

2. An overexpression vector, characterized in that: The overexpression vector contains the MaGRAS51 gene as claimed in claim 1.

3. A host cell, characterized in that The host cell comprises the overexpression vector according to claim 3.

4. Use of the Clerodendrum leucoderma gene MaGRAS51 according to claim 1 in inducing plant root nodulation.

5. Use of the Clerodendrum leucoderma gene MaGRAS51 according to claim 1 in promoting plant growth and development under salt stress conditions.

6. Use of the Clerodendrum leucoderma gene MaGRAS51 according to claim 1 in inducing plant root nodulation under high salt stress.

7. A method for inducing plant root nodulation, salt stress tolerance or inducing plant root nodulation under high salt stress, characterized in that: The method comprises: overexpressing the sweet clover gene MaGRAS51 as claimed in claim 1; specifically comprising transferring the overexpression vector as claimed in claim 2 into Agrobacterium rhizogenes to transform plants.

8. The method according to claim 7, characterized in that The plant is sweet clover.

Images