Application of beta-glucosidase gene SpBGLU25 of stigma leptostachys in improvement of drought resistance of plants

Abstract

The invention discloses application of a beta-glucosidase gene SpBGLU25 of stigma leptostachyum to improvement of drought resistance of plants, and belongs to the technical field of gene engineering. The CDS sequence of the beta-glucosidase gene SpBGLU25 is as shown in SEQ ID NO. 5, and the amino acid sequence of the protein coded by the beta-glucosidase gene SpBGLU25 is as shown in SEQ ID NO. 6. According to the invention, a new beta-glucosidase BGLU25 of stigma leptostachys is found and named as SpBGLU25, meanwhile, a plant expression vector of the gene is successfully constructed and transformed, and the gene is verified to have an important function of enhancing the drought stress resistance of plants in transgenic plants. The invention is of great significance to reveal the stress resistance mechanism of stigma leptostachyum, enrich the plant stress resistance molecular biology theory and improve the stress resistance of plants.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to the application of a spathiphyllum β-glucosidase gene SpBGLU25 in improving plant drought resistance. Background Art

[0002] Drought is the main abiotic factor limiting plant growth and development. According to statistics, one-third of my country's land is in arid areas. The lack of soil moisture will cause the cell membranes of plants to be destroyed, photosynthesis to decrease, respiration rate to decrease, growth to be inhibited, and even lead to plant death in severe cases.

[0003] Stipagrostis pennata is a pioneer sand-fixing plant widely distributed in sand dunes. Due to its perennial dry growth environment, low precipitation, severe wind erosion, and high degree of land sandification, Stipagrostis pennata has desert adaptability characteristics such as resistance to drought, storm erosion, and sand burial. Stipagrostis pennata has a special sand structure that can adapt well to extreme environments such as drought and high temperature. It can also effectively improve the stability of sand dunes, increase plant diversity, and has the potential for ecological restoration. Therefore, the study of the arid plant Stipagrostis pennata has both important scientific value and great practical significance.

[0004] β-Glucosidase belongs to the hydrolase class and is a member of the glycosyl hydrolase family I. It can participate in plant metabolism and regulate plant growth and development by catalyzing the hydrolysis and release of β-glycosidic bond compounds. Based on the similarity of amino acid sequence and conserved domain, β-glucosidase in plants can be divided into eight families, namely GH1 (glycosidehydro-lase (GH) families 1), GH3, GH5, GH7, GH9, GH12, GH35, and GH116. Among them, the GH1 family has the most glycosidase members. The proteins in this family have the function of transglycosidase and can synthesize glycosides. In higher plants, this gene exists in the chromosome in the form of a gene family. Studies have shown that there are 48 and 40 BGLU genes in Arabidopsis and rice, respectively. Most AtBGLU family genes in Arabidopsis are regulated by salt and drought stress, while OsBGLU family genes in rice are insensitive to salt stress induction, and only a few genes are induced by drought stress. This indicates that BGLU family genes are involved in the response of plants to external stress. In plants, β-glucosidase is involved in various physiological processes in plants, such as plant defense response to adversity, plant hormone metabolism, cell wall lignification, and sugar metabolism in organisms. Lignin is an important component of the cell wall and can enhance the tolerance of plants to drought, salt and other stresses. β-glucosidase maintains the secondary structure of the cell wall by degrading oligosaccharides in the cell wall and releasing lignin monomers from glycosides. Recent studies have preliminarily demonstrated that β-glucosidase AtBG1 can hydrolyze ABA-GE (ABA-glucose ester) to produce biologically active free ABA, and participate in the dehydration stress response of plants. In the process of participating in polysaccharide metabolism research, β-glucosidase genes were involved in polysaccharide metabolism through metabolomics analysis, and participated in the development of rice leaves, seeds and other organs and stress resistance through their effects on polysaccharide metabolism. Studies have found that β-glucosidase participates in the EMP glycolysis pathway. β-glucosidase participates in the sugar metabolism of organisms and makes a huge contribution to the maintenance of normal physiological functions of organisms.

[0005] At present, there are few studies on feather needle grass at home and abroad, especially the research on drought resistance genes is still blank. Exploring feather needle grass β-glucosidase and its physiological process in plants, exploring its function in feather needle grass sand cover development and its mechanism of adaptation to extreme drought are of great significance to expanding plant drought resistance gene resources. Summary of the invention

[0006] The purpose of the present invention is to provide an application of a β-glucosidase gene SpBGLU25 of feather needle grass in improving plant drought resistance, so as to solve the problems existing in the above-mentioned prior art. The present invention discovered a new β-glucosidase BGLU25 of feather needle grass, named SpBGLU25, and verified in transgenic plants that the gene has an important function of enhancing the ability of plants to resist drought stress, which is of great significance for revealing the stress resistance mechanism of feather needle grass, enriching the molecular biology theory of plant stress resistance, and improving the stress resistance of plants.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a beta-glucosidase gene SpBGLU25 of Pinus truncatula, and the CDS sequence of the beta-glucosidase gene SpBGLU25 is shown as SEQ ID NO.5.

[0009] The present invention also provides a protein encoded by the β-glucosidase gene SpBGLU25, and the amino acid sequence of the protein is shown in SEQ ID NO.6.

[0010] The present invention also provides a recombinant plasmid comprising the beta-glucosidase gene SpBGLU25.

[0011] The invention also provides a recombinant bacterium comprising the recombinant plasmid.

[0012] The present invention also provides the use of the beta-glucosidase gene SpBGLU25, the protein, the recombinant plasmid or the recombinant bacteria in enhancing the drought stress resistance of plants.

[0013] The present invention also provides the use of the beta-glucosidase gene SpBGLU25, the protein, the recombinant plasmid or the recombinant bacteria in cultivating plants with strong drought stress resistance.

[0014] Optionally, the plant comprises Arabidopsis thaliana.

[0015] The present invention also provides a method for enhancing the drought stress resistance of plants, comprising the steps of introducing the beta-glucosidase gene SpBGLU25 into plants to overexpress the beta-glucosidase gene SpBGLU25.

[0016] The present invention also provides a method for cultivating plants with strong drought stress resistance, comprising the steps of introducing the β-glucosidase gene SpBGLU25 into plants to obtain transgenic plants overexpressing the β-glucosidase gene SpBGLU25.

[0017] Optionally, the plant comprises Arabidopsis thaliana.

[0018] The present invention discloses the following technical effects:

[0019] The present invention discovered a new β-glucosidase BGLU25 of Feather Needle Grass and named it SpBGLU25. At the same time, the plant expression vector of the gene was successfully constructed and transformed. The gene was verified in transgenic plants to have an important function of enhancing the drought stress resistance of plants. The present invention is of great significance for revealing the stress resistance mechanism of Feather Needle Grass, enriching the molecular biology theory of plant stress resistance, and improving the stress resistance of plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 The figure is the gel electrophoresis of the PCR amplification product of the SpBGLU25 gene CDS sequence; wherein M is a marker, and 1-2 is a PCR amplification product;

[0022] Figure 2 This is the gel electrophoresis diagram of the PCR product of Agrobacterium monoclonal bacteria transformed with the SpBGLU25 gene overexpression vector; where M is a marker and 1-9 are positive monoclonals;

[0023] Figure 3 The figure is the result of gel electrophoresis identification of PCR products of Arabidopsis thaliana overexpressing SpBGLU25 gene; wherein M is a marker, and 1-7 are the transgenic plants screened;

[0024] Figure 4 The phenotypes of four Arabidopsis thaliana treated with 20% PEG for 12 hours; CK is the control group of normal culture, and PEG is the drought stress group treated with 20% PEG for 12 hours. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] The total RNA extraction kit used in the embodiments of the present invention; the cDNA first-strand reverse transcription kit; 2×TaqPCRMaster MixII; the DNA gel recovery kit and the plasmid extraction kit were all purchased from TIANGEN; the pMD-19T cloning vector and the Real time PCR reagent were purchased from TaKaRa Biological Company; Kpn I, XbaⅠ and other related enzymes were purchased from TaKaRa Biological Company; penicillin ampicillin, kanamycin, gentamicin, MES, acetosyringone, MgCl2 and chemical reagents for culture medium preparation were all domestic analytical grade and purchased from Shanghai Shenggong Biotechnology Co., Ltd.; the Escherichia coli competent strain DH 5α was purchased from Beijing Quanshijin Biological Company; the synthesis of PCR primers and DNA sequencing were completed by Xinjiang Youkang Biotechnology Co., Ltd. and Shanghai Shenggong Biotechnology Co., Ltd.

[0031] Biological materials used in the experiment:

[0032] Agrobacterium strain GV 3101 and plant expression vector pCAMBIA 1300 were provided by the Key Laboratory of Agricultural Biotechnology, College of Life Sciences, Shihezi University, Xinjiang, and can also be purchased by the public through any public channels.

[0033] Arabidopsis mutant material: The serial number of the Atbglu25 gene deletion mutant is AT1G26560 (the public website is https: / / www.arabidopsis.org / pagenotfound), and the mutant material was purchased from AraShare Science, and the public website is https: / / www.arashare.cn / index / Product / index.html.

[0034] Example 1 Cloning of the β-glucosidase gene SpBGLU25 of Pinellia foetida

[0035] 1. Cultivation and planting of Feather Needle Grass

[0036] The seeds of Feather Grass were collected in bags in the desert near Mosuowan Reservoir in Shihezi City, Xinjiang Uygur Autonomous Region in June. The collected seeds were dried, the seed coats were removed, and they were soaked in gibberellin for 24 hours and then planted in the sand at a depth of 1 cm. Samples were collected after 45 days for later use.

[0037] 2. Extraction of total RNA from Psoralea corylifolia and synthesis of cDNA

[0038] The total RNA of the collected Feather Needle Grass samples was extracted using a total RNA extraction kit. The operation was performed according to the instructions of the plant total RNA extraction kit of TIANGEN. After extraction, its integrity was detected by 1.1% agarose gel electrophoresis, and the RNA concentration was measured. Then, cDNA was synthesized using a reverse transcription kit and stored in a -20℃ refrigerator.

[0039] 3. Cloning of the β-glucosidase gene SpBGLU25 from Pinellia foetida

[0040] Primers SpBGLU25-F and SpBGLU25-R and homology arm primers SpBGLU25-tong-F and SpBGLU25-tong-R containing KpnI and XbaI restriction sites were designed, and PCR amplification was performed using the cDNA of Stipa foetida as a template. The reaction system was as follows: cDNA (50 ng·μL -1)2μL, 2×Taq PCR Master Mix 25μL, Primer SpBGLU25-F 2μL, Primer SpBGLU25-R 2μL, ddH2O 19μL, a total of 50μL. Amplification program: 95℃5min; 95℃30s, 56℃30s, 72℃1min, 35 cycles; 72℃5min; 4℃ storage. Use 1.2% agarose gel electrophoresis to detect and recover the target band ( Figure 1 ) and sent to Xinjiang Youkang Biotechnology Co., Ltd. for sequencing. The primer sequences and the CDS sequence of the SpBGLU25 gene obtained by amplification are as follows.

[0041] SpBGLU25-F: 5'-ATGGAAGTACTTTGTGAAACC-3', SEQ ID NO.1;

[0042] SpBGLU25-R: 5'-CCTGGCGGTCATTGTCAT-3', SEQ ID NO. 2.

[0043] SpBGLU25-tong-F: attggagaggacagggtaccATGAAGGACATTGGCATGGATG, SEQ ID NO.3; SpBGLU25-tong-R: ggtactagtgtcgactctagaAAGTCCATTGCTCGTGATGCTG, SEQ ID NO.4.

[0044] SpBGLU25 gene CDS sequence (SEQ ID NO.5):

[0045] ATGAAGGACATTGGCATGGATGCTTACCGGTTCTCTATTTCATGGTCACGTATCTTTCCAAATGGAACAGGTGAACCTAATGAAGAAGGATTGAATTACTACAACAGCCTCATTGATGCTCTATTAGATAAAGGTATACAACCATATGTAACACTATTTCACTGGGATCTTCCGCAAGCACTAGAAGACAAATATGGTGGATGGTTAAACTCCCAAATTGTGGAGGATTTTGTTCAATTTGCCTCTACTTGCTTCAAGGAATTCGGAGATAGAGTGAAACACTGGATCACTTTCAATGAGCCCCACAACTTTGCAATTGAAGGTTATGACCTTGGCATCCAAGCACCTGGGAGATGTTCAATTATGTCACATCTGTTCTGTAGGGAGGGTAAATCATCGACTGAACCATATATTGTAGCTCACAACATACTCTTAGCTCATGCTGGTGCTTTTCATACTTACAAGCAACATTTCAAGAAAGAACAAGGAGGCCTCATTGGAATTTCACTTAATTCAAAGTGGTATGAACCATTTTCAGATGCTAATGAAGACAGAGGCAGCATCACGAGCAATGGACTTTGA。

[0046] Amino acid sequence encoded by the CDS sequence of SpBGLU25 gene (SEQ ID NO.6):

[0047] MKDIGMDAYRFSISWSRIFPNGTGEPNEEGLNYYNSLIDALLDKGIQPYVTLFHWDLPQALEDKYGGWLNSQIVEDFVQFASTCFKEFGDRVKHWITFNEPHNFAIEGYDLGIQAPGRCSIMSHLFCREGKSSTEPYIVAHNILLAHAGAFHTYKQHFKKEQGGLIGISLNSKWYEPFSDANEDRGSITSNGL。

[0048] Example 2 Construction of the plant expression vector of SpBGLU25 gene

[0049] SpBGLU25 gene CDS sequence was used as template, and homology arm primers SpBGLU25-tong-F and SpBGLU25-tong-R were used for PCR amplification, and the amplification system and amplification procedure were the same as those in Example 1. The PCR product was recovered by gel excision, sequenced, and aligned with the original sequence. After the alignment was correct, it was set aside.

[0050] The plant expression vector pCAMBIA1300 containing the 35S promoter was double-digested with Kpn I and Xba I to obtain the vector fragment. Recover the vector fragment. The gel recovery product after the above alignment was connected with the double-digested vector fragment with the help of a homologous recombination kit. The reaction system was: 2μL of vector fragment; 3μL of target gene fragment; 5μL of C1162×CE Mix; the reaction procedure was 50℃30min. The reaction product was spread on LB solid medium containing ampicillin resistance, placed in a 37℃ incubator for 12h, and then the positive monoclonal colonies were picked for colony PCR verification and sent to Xinjiang Youkang Biotechnology Co., Ltd. for testing.

[0051] Example 3 Agrobacterium transformation

[0052] The sequence after testing was compared with the original sequence by SnapGene. The plasmid was extracted from the bacterial solution with correct alignment according to the instructions of the plasmid extraction kit, and transformed into Agrobacterium GV 3101 by freeze-thaw method. -1 , Kan 50μg·mL -1 、Rif50μg·mL -1 ) on LB solid medium, cultured in a 28°C incubator for 36-48h, and selected single colonies for colony PCR verification ( Figure 2 ) and save the verified correct Agrobacterium solution.

[0053] Example 4: Infection of Arabidopsis thaliana by the Flower Drop Method

[0054] Wild-type and Atbglu25 gene deletion mutant Arabidopsis seeds were sterilized and sown in 1 / 2MS medium, and transplanted into nutrient soil after ten days. Transformation was performed after bolting after twenty days of growth.

[0055] Preparation of the infection solution: In LB liquid medium containing three antibodies (50 mg / L Kan, 50 mg / L Gen, 50 mg / L R Fif), the identified Agrobacterium containing the target gene was cultured overnight at 28°C, the bacterial solution was taken out, centrifuged at 25°C, 5000 rpm for 5 min, the supernatant was discarded, and the precipitate was suspended in liquid 1 / 2MS (5% sucrose + 0.02% Silwet L-77) to adjust the OD 600Reach about 0.6; soak the inflorescence in the infection solution for 1 minute, shake off the residual infection solution after 1 minute, culture the infected Arabidopsis in the dark for 24 hours, and then culture normally, and immerse once a week until there is no inflorescence. After the immersion is completed, place the Arabidopsis under normal light for cultivation, and collect the seeds after the fruit pods mature for later screening experiments.

[0056] Example 5 Identification of transgenic Arabidopsis

[0057] The collected infected Arabidopsis seeds were sown on a 1 / 2MS (containing 4% hygromycin) solid culture medium on a sterile operating table according to conventional planting methods. After growing in an artificial climate chamber for two to three weeks, the untransformed Arabidopsis seedlings gradually turned white and died, while the successfully transformed Arabidopsis seedlings grew normally. The normally growing Arabidopsis were transferred to culture soil for further cultivation, and then the DNA of the initially screened Arabidopsis was extracted for PCR identification ( Figure 3 ).

[0058] After 12 hours of 20% PEG drought stress on four plants, including wild-type Arabidopsis (WT), Arabidopsis overexpressing SpBGLU25 (SpBGLU25), Arabidopsis Atbglu25 gene deletion mutant (atbglu25), and Arabidopsis Atbglu25 gene deletion mutant overexpressing SpBGLU25 (SpBGLU25-atbglu25), it was found that the Arabidopsis Atbglu25 gene mutant was the most severely wilted and dried up, followed by wild-type Arabidopsis. Arabidopsis overexpressing SpBGLU25 gene had the best drought stress resistance, followed by Arabidopsis Atbglu25 gene mutant overexpressing SpBGLU25 gene ( Figure 4 ). This indicates that the SpBGLU25 gene can indeed increase the plant's resistance to drought stress.

[0059] The present invention not only obtains the SpBGLU25 gene of the feather needle grass, but also successfully constructs its plant expression vector and transforms it, and studies the important function of the gene in increasing plant resistance to drought stress in transgenic plants. This is of great significance for revealing the stress resistance mechanism of the feather needle grass, enriching the molecular biology theory of plant stress resistance, and improving the stress tolerance of plants.

[0060] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A β-glucosidase gene SpBGLU25 of Pinus truncatula, characterized in that: The CDS sequence of the β-glucosidase gene SpBGLU25 is shown in SEQ ID NO.

5.

2. The protein encoded by the β-glucosidase gene SpBGLU25 according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

6.

3. A recombinant plasmid comprising the β-glucosidase gene SpBGLU25 according to claim 1. A recombinant bacterium comprising the recombinant plasmid according to claim 3.

5. Use of the β-glucosidase gene SpBGLU25 according to claim 1, the protein according to claim 2, the recombinant plasmid according to claim 3 or the recombinant bacteria according to claim 4 in enhancing the drought stress resistance of plants.

6. Use of the β-glucosidase gene SpBGLU25 according to claim 1, the protein according to claim 2, the recombinant plasmid according to claim 3 or the recombinant bacteria according to claim 4 in cultivating plants with strong resistance to drought stress.

7. The use according to claim 5 or 6, characterized in that: The plants include Arabidopsis thaliana.

8. A method for enhancing the drought stress resistance of plants, characterized in that: The method comprises the step of introducing the β-glucosidase gene SpBGLU25 according to claim 1 into a plant to overexpress the β-glucosidase gene SpBGLU25.

9. A method for cultivating plants with strong drought stress resistance, characterized in that: The method comprises the steps of introducing the β-glucosidase gene SpBGLU25 according to claim 1 into a plant to obtain a transgenic plant overexpressing the β-glucosidase gene SpBGLU25.

10. The method according to claim 8 or 9, characterized in that: The plants include Arabidopsis thaliana.

Images