Agrobacterium tumefaciens-mediated balsa wood genetic transformation method

Abstract

The invention relates to an agrobacterium tumefaciens-mediated cork tree genetic transformation method. The method comprises the following steps: preparing an infection solution from an agrobacterium solution; the method comprises the following steps: taking in-vitro cotyledons or stems as explants after cork tree seeds germinate into seedlings, infecting the cotyledons or stems of the cork tree by adopting an infection solution, and carrying out co-culture, recovery culture and screening culture after infection is completed, so as to obtain transgenic hairy roots or transgenic calluses. According to the scheme provided by the invention, stable transformation of balsa roots can be realized, verification of functional genes is realized, the functional genes exist in a living body form for a long time, and the genetic transformation efficiency of balsa is improved.

Description

Technical Field

[0001] The present application relates to the technical field of plant genetic engineering, and in particular to a method for genetic transformation of balsa wood mediated by Agrobacterium tumefaciens. Background Art

[0002] Balsa (Ochroma lagopus Swartz), also known as balsa wood, is a perennial tree of the genus Balsa in the Malvaceae family. It is one of the fastest growing and lightest trees in the world. Balsa is native to the equatorial region of South America and is distributed in Ecuador, Colombia, Papua Guinea, Indonesia, Brazil, Costa Rica, Guatemala and other places. Ecuador ranks first in the world in the production of balsa. Since 1960, it has been introduced and cultivated in Guangdong, Fujian, Yunnan and other provinces in my country. Balsa is suitable for growing in high temperature and high humidity environments, and is suitable for planting in fertile areas with deep soil and good drainage. There are very few environments suitable for the growth of balsa in my country, which are limited to parts of a few provinces such as Yunnan, Taiwan and Hainan. Since balsa forests cannot withstand winds above level 5, they are only suitable for planting in Xishuangbanna. The temperature in the area is high, there is no extreme low temperature in winter, and there is no typhoon, which is suitable for the growth of balsa. It is the only area in China suitable for large-scale planting of balsa.

[0003] Balsa wood has the advantages of light weight, good elasticity, impact resistance, strong sound absorption, and short growth cycle. It is a high-quality wood with good mechanical properties and processing performance and affordable price. It has a wide range of uses and good commercial application value. In addition to being the core material of wind power equipment, balsa wood can also be used in construction, furniture, aerospace and other fields. Under the advocacy of energy conservation and emission reduction, my country needs to import a large amount of balsa wood every year for the manufacture of wind turbine blades; with the rapid development of the domestic wind power industry and the intensification of the trade war, the price of balsa wood has risen year by year, and the domestic balsa wood raw materials are in short supply. Moreover, the amount of balsa wood imported by my country is increasing every year. Due to the inability to be self-sufficient, my country's balsa wood is completely dependent on imports. With the continuous increase in demand and the uncertainty of Sino-foreign trade, the supply of balsa wood raw materials has become a problem for my country's wind power equipment manufacturing industry. Most of the balsa wood raw materials needed in my country rely on imports, so the localization of balsa wood is imminent. Since 2000, a total of about 20,000 acres of balsa wood have been planted in Banna, Hekou, Menglian and other places. Due to the great differences in geographical and climatic environment between Banna and its place of origin, a series of problems have arisen in the process of promoting the planting of balsa wood. Among them, inconsistent growth, low branching, frequent diseases and insect pests, and susceptibility to cold damage are key issues leading to low wood yield and quality. Therefore, it is particularly important to strengthen balsa wood breeding and develop balsa wood breeding technology.

[0004] In existing research, the technology of using transgenic technology to transfer the target gene that is known to regulate excellent traits into the organism through microbial mediation, microinjection or gene gun bombardment, thereby giving the organism new excellent traits. Common methods of genetic transformation include: Agrobacterium-mediated method, gene gun transformation method and polyethylene glycol-mediated method. The use of transgenic technology can achieve the improvement of plant varieties, which is a major breakthrough in the field of modern biotechnology. Since the Agrobacterium-mediated genetic transformation method of different plants is not universal, and many factors such as Agrobacterium strain type, Agrobacterium bacterial solution concentration, plant species, explant type, development period, degree of injury, infection time, infection solution composition, auxiliary means, co-cultivation conditions and screening conditions will have an important impact on the success of plant genetic transformation. Different Agrobacterium strains have great differences in their ability to infect different plants, which depends on the interaction between Agrobacterium and plant cells and the growth and reproduction ability in plant tissues.

[0005] At present, research on Agrobacterium-mediated genetic transformation of balsa wood is still in its infancy. Whether from the perspective of genetic improvement or gene function analysis, it is urgent to establish an Agrobacterium-mediated genetic transformation method for balsa wood. Summary of the invention

[0006] In order to solve or partially solve the problems existing in the related art, the present application provides a method for establishing a genetic transformation system of balsa wood roots mediated by Agrobacterium rhizogenes, which can achieve genetic transformation of balsa wood roots and callus and improve genetic transformation efficiency.

[0007] The present application provides a method for genetic transformation of balsa wood mediated by Agrobacterium tumefaciens, which uses Agrobacterium rhizogenes K599 or Agrobacterium tumefaciens GV3101 to infect balsa wood explants to obtain transgenic hairy roots or callus tissue.

[0008] Optionally, the balsa wood explants are infected with an infection fluid prepared with a bacterial solution containing the target vector, and after the infection is completed, the infected balsa wood explants are inoculated into a co-culture medium for co-cultivation; the infection fluid is an infection fluid of Agrobacterium rhizogenes K599 or an infection fluid of Agrobacterium tumefaciens GV3101.

[0009] Optionally, the balsa wood explants are cotyledons or stem segments; the bacterial solution OD 600 is 0.4-0.8, the bacterial solution is Agrobacterium rhizogenes K599 or Agrobacterium tumefaciens GV3101; the co-culture medium is MS+0.2mg / L NAA+0.1mg / L 6-BA or 1 / 2MS+0.2mg / L NAA+0.1mg / L 6-BA.

[0010] Optionally, the balsa wood explants are balsa wood cotyledons; the bacterial solution OD 600is 0.5-0.7; the co-culture medium is 1 / 2MS+0.2mg / LNAA+0.1mg / L 6-BA.

[0011] Optional, bacterial culture OD 600 is 0.6.

[0012] Optionally, the target vector refers to a pOCA30 vector containing a target gene; when the bacterial solution is Agrobacterium rhizogenes K599 bacterial solution, the target gene is RUBY or JcFT gene; when the bacterial solution is Agrobacterium tumefaciens GV3101 bacterial solution, the target gene is RUBY gene;

[0013] The infection time is 20 minutes; the co-cultivation stage is dark cultivation, and the co-cultivation time is 3 days.

[0014] Optionally, the infection solution is prepared by the following method: centrifuging the bacterial solution at 4° C., discarding the supernatant, resuspending the bacteria in MS liquid culture medium and adding 100 μM AS and 3 mg / L 6-BA to prepare the infection solution.

[0015] Optionally, the method for preparing balsa wood explants is as follows: select full balsa wood seeds, disinfect them with 1.0% sodium hypochlorite for 15 minutes, rinse them three times with sterile water, heat them in a 55°C water bath for 30 minutes, inoculate them in 1 / 2MS culture medium and germinate them for 30 days, take out the seedlings, separate the sterile cotyledons and stem segments, and pretreat them with 5 mg / L xylanase for 30 minutes to obtain the balsa wood explants.

[0016] Optionally, the following steps are also included:

[0017] When the bacterial solution is the bacterial solution of Agrobacterium rhizogenes K599, the cotyledons or stem segments of the balsa wood after co-culture are subjected to recovery culture and screening culture to obtain transgenic hairy roots, and the transgenic hairy roots are subjected to induction culture to obtain transgenic hairy root callus;

[0018] When the bacterial solution is Agrobacterium tumefaciens GV3101 bacterial solution, the cotyledons or stem segments of the balsa wood after co-culture are subjected to recovery culture and screening culture to obtain transgenic callus tissue.

[0019] Optionally, when the bacterial solution is Agrobacterium rhizogenes K599 bacterial solution, the medium in the recovery culture is 1 / 2MS+0.1mg / L6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / L Cef+200mg / L Tim; when the bacterial solution is Agrobacterium tumefaciens GV3101 bacterial solution, the medium in the recovery culture is MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / L Cef+200mg / L Tim;

[0020] The culture medium in the screening culture was MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / LCef+200mg / L Tim+20.0mg / L kanamycin;

[0021] The culture medium for induction culture was MS+0.5mg / L 6-BA+0.1mg / L NAA+1g / L chlormequat.

[0022] The above culture media also include 30.0 g / L sucrose and 6.5 g / L agar, and the pH is 5.8.

[0023] The technical solution provided by this application may have the following beneficial effects:

[0024] 1) In this application, Agrobacterium rhizogenes K599 or Agrobacterium tumefaciens GV3101 is used to achieve genetic transformation of balsa wood; balsa wood has abundant secondary metabolites, which seriously affect the vitality of the infected bacterial solution. In this application, K599 is selected as the host of the delivery system. The K599 strain proliferates rapidly and has strong virulence, and is not significantly affected by the secondary metabolites of balsa wood. In addition, the use of xylanase to treat balsa wood cotyledons and stem segments can reduce the impact of secondary metabolites in balsa wood.

[0025] 2) In the present application, cotyledons of balsa wood are used as explants, and the root-generating Agrobacterium K599 bacterial liquid is suspended in MS and AS and 6-BA are added to prepare the root-generating Agrobacterium K599 infection liquid. The infected cotyledons are then inoculated into 1 / 2MS co-culture medium for co-culture, thereby improving the genetic transformation efficiency of balsa wood. The total positive root rate of transgenic hairy roots obtained by infecting cotyledon explants with the root-generating Agrobacterium K599 infection liquid containing the target vector of the target gene RUBY is as high as 66.67%; the cotyledon explants are infected with the root-generating Agrobacterium K599 infection liquid containing the target vector of the target gene JcFT, and PCR detection shows that 8 out of 15 hairy root DNAs contain fragments of the FT gene, and the positive transformation rate reaches 53.3%.

[0026] 3) In the present application, the stable transformation of balsa wood roots can be achieved to verify the functional genes and to exist in a living form for a long time. The transgenic hairy roots obtained by transformation mediated by Agrobacterium rhizogenes K599 can form callus tissue after dedifferentiation, laying the foundation for plant regeneration.

[0027] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The above and other objects, features and advantages of the present application will become more apparent through a more detailed description of exemplary embodiments of the present application in conjunction with the accompanying drawings, wherein the same reference numerals generally represent the same components in the exemplary embodiments of the present application.

[0029] Figure 1 Schematic diagram of the growth of hairy roots shown in Example 1 of the present application, wherein A is the control group and BI is the growth of hairy roots;

[0030] Figure 2 1 is a schematic diagram of positive hairy root PCR detection shown in Example 1 of the present application, wherein CK1 is a positive plasmid control; CK2 is a negative control of untransformed roots; 1-15 are hairy roots induced by Agrobacterium infection;

[0031] Figure 3 This is a schematic diagram of the transgenic hairy roots forming red callus after dedifferentiation as shown in Example 1 of the present application;

[0032] Figure 4 It is a schematic diagram of the positive callus morphology shown in Comparative Example 4 of the present application. DETAILED DESCRIPTION

[0033] The embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and to fully convey the scope of the present application to those skilled in the art.

[0034] Example 1

[0035] An Agrobacterium-mediated genetic transformation method for balsa wood comprises the following steps:

[0036] 1) Prepare the K599 bacterial culture of Agrobacterium rhizogenes: Take out the transformed K599 Agrobacterium rhizogenes from the -80℃ ultra-low temperature freezer, activate it on a YEB solid plate containing 100mg / L spectinomycin, and invert it in a biochemical incubator at 28℃ for 2-3 days. Pick a single clone from the plate and place it in 10mL YEB liquid medium containing 100mg / L spectinomycin. Culture it at 28℃, 200rpm for 10-12h, then take 200μL of the bacterial culture and add it to 50mL YEB liquid medium containing 100mg / L spectinomycin. Culture it at 28℃, 200rpm for 12h, take 1mL of the bacterial culture in a 1.5mL centrifuge tube, and measure the OD of the bacterial culture with a spectrophotometer. 600 value, and the Agrobacterium rhizogenes K599 bacterial liquid was prepared.

[0037] 2) Preparing Agrobacterium rhizogenes K599 infection fluid: Place the Agrobacterium rhizogenes K599 bacterial fluid at 4°C and centrifuge at 5000 rpm for 9 min, discard the supernatant, collect the bacteria, and resuspend the bacteria in MS liquid culture medium, then add 100 μM acetosyringone (AS) and 3 mg / L 6-BA to prepare the Agrobacterium rhizogenes K599 infection fluid.

[0038] 3) Preparation of balsa wood explants: Select full balsa wood seeds, disinfect them with 1.0% sodium hypochlorite for 15 minutes, rinse them three times with sterile water, heat them in a 55°C water bath for 30 minutes, inoculate them in 1 / 2MS medium and germinate them for 30 days. Take out the seedlings, separate the sterile cotyledons and stem segments, and pretreat them with 5 mg / L xylanase (Solebo, X8091) for 30 minutes as balsa wood explants.

[0039] 4) Agrobacterium rhizogenes K599-mediated transformation: using OD 600 The Agrobacterium rhizogenes K599 infection solution prepared by the Agrobacterium rhizogenes K599 bacterial solution containing the target vector (pOCA30 vector containing 35S promoter and RUBY gene) at 0.4, 0.5, 0.6, 0.7 and 0.8 was used to infect the cotyledons or stem segments of the light wood, and the cotyledons or stem segments were placed in a constant temperature oscillator for infection for 20 minutes to make the Agrobacterium rhizogenes K599 infection solution fully contact with the cotyledons or stem segments of the light wood. The cotyledons or stem segments of the light wood were taken out, and the infection solution remaining on the surface was absorbed with sterile filter paper, and inoculated into a co-culture medium (1 / 2MS+0.2mg / L NAA+0.1mg / L 6-BA+30.0g / L sucrose+6.5g / L agar, pH: 5.8) for co-culture, so that the back of the cotyledons or stem segments of the light wood were attached to the co-culture medium, and cultured in a constant temperature incubator in the dark for 3 days.

[0040] 5) After 3 days, the balsa wood cotyledons or stem segments after co-cultivation were rinsed 4-5 times with sterile water containing 500 mg / L Cef, placed on sterile filter paper to absorb the surface moisture, and inoculated into a recovery medium without a selection agent (1 / 2MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / L Cef+200mg / L Tim+30.0g / L sucrose+6.5g / L agar, pH: 5.8) for recovery culture for 20 days. Then, the balsa wood cotyledons or stem segments after recovery culture were transferred to a selection medium containing hygromycin (MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / L Cef+200mg / L The transgenic hairy roots were obtained by screening and culturing in Tim+20.0mg / L kanamycin+30.0g / L sucrose+6.5g / L agar, pH: 5.8) for 20 days. Fifty explants were cultured in each experimental group, repeated 3 times, and the hairy root generation rate was counted after 30 days; the positive rate of transgenic hairy roots was observed and recorded after 60 days.

[0041] Example 2

[0042] The difference between Example 2 and Example 1 is that: in step 4 of Example 2, the co-culture medium is: MS + 0.2 mg / L NAA + 0.1 mg / L 6-BA + 30.0 g / L sucrose + 6.5 g / L agar, pH: 5.8, and other conditions remain unchanged.

[0043] The experimental results of the root number, rooting rate, cotyledon positive root number, stem segment positive root number, total positive root number and total positive root rate of Example 1 and Example 2 are shown in Table 1.

[0044] Table 1 Experimental results of different Agrobacterium rhizogenes concentrations, different explants and different culture media

[0045]

[0046] As shown in Table 1, in order to explore the genetic transformation system of balsa wood, Example 1 used OD 600 The root-generating Agrobacterium K599 was used to infect the cotyledons or stems of the light wood at 0.4, 0.5, 0.6, 0.7, and 0.8, and co-cultured in 1 / 2MS medium. After selection by adding 20.0 mg / L hygromycin to the screening medium, the positive hairy roots turned red ( Figure 1 ), after 60 days, positive hairy roots were found after infection with five infection solution concentrations. The results showed that the infection efficiency of Agrobacterium was OD 600 Value 0.6>0.5>0.7>0.4>0.8; in terms of rooting rate, OD 600 The rooting rate was the highest when the value was 0.6, with a rooting rate of 72%. 600 The rooting rate of OD values ​​of 0.7 and 0.5 was 60.7% and 57.3% respectively. 600 When the value was 0.6, the total number of positive roots and the total positive root rate were the highest, with a total number of 72 positive roots and a positive rate of 66.67%. 600 The total positive root number and total positive root rate of OD were 0.5 and 0.7, respectively, with the total positive root number being 53 and 54, and the total positive root rate being 61.63% and 59.34%; 600 When the values ​​were 0.4 and 0.8, the number of roots and positive roots were both small. Comparative analysis showed that OD 600 The infection effect is best when the value is 0.6, and the bacterial solution concentration OD 600 The value can be between 0.5-0.7.

[0047] Comparing the infection effects of balsa wood cotyledons or stem segments, it was found that the infection effect of balsa wood cotyledons was better than that of stem segments under the five bacterial solution concentrations, and the ratio of the number of positive roots of balsa wood cotyledons to that of stem segments was about 3:1 (Table 1). It can be concluded that it is easier to obtain transgenic hairy roots by selecting balsa wood cotyledons as receptors during transformation.

[0048] In Example 2, the co-culture medium was MS culture medium. The rooting conditions of MS and 1 / 2MS culture medium were compared. It was found that no matter which bacterial solution concentration, the rooting rate and positive root rate of explants in 1 / 2MS culture medium were greater than those in MS culture medium. 600 When the value was 0.6, the rooting rate was 64.7% and the positive rate was 57.73%, while the OD 600 When the value was 0.6, the rooting rate was 72%, and the positive root rate was 66.67%. The analysis results showed that the rooting effect of 1 / 2MS medium was better than that of MS medium; that is, the optimal transformation conditions mediated by rhizogenes Agrobacterium were: bacterial solution concentration OD 600 When the infection rate was 0.6, the cotyledons of balsa wood were selected as explants for infection and cultured in 1 / 2MS medium.

[0049] Example 3

[0050] 1) Agrobacterium rhizogenes-mediated transformation: Light wood cotyledons were cut off as explants and the OD 600 The cotyledons of the balsa wood were infected with the infection solution of Agrobacterium rhizogenes K599 containing the target vector (pOCA30 vector containing SUC2 promoter and JcFT gene) at 0.6, and placed in a constant temperature oscillator for infection for 20 minutes to allow the bacterial solution to fully contact the cotyledons of the balsa wood. The cotyledons of the balsa wood were taken out, and the infection solution remaining on the surface was absorbed with sterile filter paper, and inoculated into the co-culture medium (1 / 2MS+0.2mg / L NAA+0.1mg / L 6-BA+30.0g / L sucrose+6.5g / L agar, pH: 5.8) for co-culture, so that the back of the balsa wood cotyledons adhered to the culture medium, and cultured in the dark in a constant temperature incubator for 3 days.

[0051] 2) After 3 days, rinse the balsa wood cotyledons with sterile water containing 500 mg / L Cef for 4-5 times, place them on sterile filter paper to absorb the surface moisture, and inoculate them into recovery medium without selection agent (1 / 2MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / LIBA+300mg / L Cef+200mg / L Tim+30.0g / L sucrose+6.5g / L agar, pH: 5.8) for recovery culture for 20 days. Then, transfer the balsa wood cotyledons after recovery culture to the selection medium containing corresponding selection agent (MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / L Cef+200mg / L Tim+20.0mg / L kanamycin+30.0g / L sucrose+6.5g / L agar, pH: 5.8) for selection culture for 20 days. Fifty explants were cultured in each experimental group, repeated three times, and the rooting rate was counted and positive identification was performed after 40 days.

[0052] Experimental results:

[0053] PCR identification of positive transgenic roots:

[0054] The hairy roots were removed and genomic DNA was extracted by the modified CTAB method; wild-type balsa wood hairy roots were used as negative controls, and the K599 plasmid transformed with SUC2:JcFT was used as positive controls for PCR amplification. The primer sequence was TCGTGTGATTGGGGATGTTTTA,

[0055] TGGTGGATACACGGTCTGCCTT. PCR amplification system: 10μL Taq PCR Master Mix, 1.0μL DNA template, 0.5μL of each primer, ddH2O to 20μL. Amplification conditions are as follows: 94℃ pre-denaturation for 3min, 94℃ denaturation for 30s, 58.1℃ annealing for 30s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 8min, PCR product detection by 1% agarose gel electrophoresis, and observation and photography under gel imager.

[0056] The balsamic wood cotyledon explants infected with the root-generating Agrobacterium K599 strain carrying SUC2:JcFT were cultured for 40 days. The statistical results showed that the rooting rate of the 150 infected explants reached 59.3%. Then, 15 explants were randomly selected to extract the hairy root DNA for PCR amplification. It was determined that the hairy root DNA fragments numbered 1, 2, 6, 8, 9, 11, 13, and 14 contained the FT gene, and the hairy root DNA fragments numbered 3, 4, 5, 7, 10, 12, and 15 did not contain the FT gene. Figure 2As shown, its positive transformation rate reached 53.3%, which was slightly lower than that of the transformation reporter gene 35S:RUBY.

[0057] Example 4: Transgenic hairy root callus induction

[0058] The transgenic hairy roots induced by Agrobacterium rhizogenes-mediated transformation in Example 2 were cut off and placed in a culture medium (MS+0.5 mg / L 6-BA+0.1 mg / L NAA+1 g / L chlormequat+30.0 g / L sucrose+6.5 g / L agar, pH: 5.8) for induction culture. The induction culture conditions were: light intensity 2000-2500 lx, light time 14 h (light) / 10 h (dark) alternating culture (alternating culture of 14 h light and 10 h dark), temperature 23-27° C.; 20 transgenic hairy roots were cultured in each experimental group, repeated 3 times, and the state of hairy root callus was observed and counted after 20 days.

[0059] Experimental results, such as Figure 3 As shown, the transgenic hairy roots after culturing for 20 days formed red callus tissue after dedifferentiation. The statistical and analysis results showed that a total of 60 transgenic hairy roots were cultured, and only 17 hairy roots formed red callus tissue, and the induction rate of hairy root callus tissue was 28.3%. The results showed that the culture medium: MS+0.5mg / L 6-BA+0.1mg / L NAA+1g / L chlormequat chloride can induce red callus tissue from the hairy roots.

[0060] Example 5: Genetic transformation of balsa wood cotyledons using Agrobacterium tumefaciens GV3101

[0061] 1) Prepare Agrobacterium tumefaciens GV3101 bacterial solution: Take out the transformed Agrobacterium tumefaciens GV3101 from the -80℃ ultra-low temperature freezer, activate it on a YEB solid plate containing 100mg / L spectinomycin, and invert it in a biochemical incubator at 28℃ for 2-3 days. Pick a single clone from the plate and add it to 10mL YEB liquid medium containing 100mg / L spectinomycin. After shaking and incubating at 28℃ and 200rpm for 10-12h, take 200μL of the bacterial solution and add it to 50mL YEB liquid medium containing 100mg / L spectinomycin. After shaking and incubating at 28℃ and 200rpm for 12h, take 1mL of the bacterial solution and place it in a quartz cuvette to measure the OD of the bacterial solution with a spectrophotometer. 600 Value, OD 600 When the concentration reached 0.4, 0.6 or 0.8, the Agrobacterium tumefaciens GV3101 bacterial liquid was obtained.

[0062] 2) Preparation of GV3101 infection fluid: Place the Agrobacterium tumefaciens GV3101 bacterial solution at 4°C and centrifuge at 5000 rpm for 9 min. Discard the supernatant, collect the bacteria, and resuspend the bacteria in 50 ml of MS liquid culture medium. Then add 100 μM acetosyringone and 3 mg / L 6-BA to prepare GV3101 infection fluid.

[0063] 3) Prepare balsa wood infected explants according to the method in step 3) of Example 1:

[0064] 4) Use the cotyledons of balsa wood as explants and use OD 600 The GV3101 infection solution prepared by using 0.4, 0.6 or 0.8 of Agrobacterium tumefaciens GV3101 bacterial solution containing the target vector (pOCA30 vector containing promoter 35S and RUBY gene) was used to infect the cotyledons of the balsa wood. After the infection was completed, the cotyledons of the balsa wood were inoculated into a co-culture medium (1 / 2MS+0.2mg / L NAA+0.1mg / L 6-BA+30.0g / L sucrose+6.5g / L agar, pH: 5.8) for co-cultivation, and co-cultivated in a constant temperature incubator in the dark for 3 days;

[0065] 5) The cotyledons of the balsa wood after co-cultivation were cultured in recovery medium (MS+0.1mg / L 6-BA+0.2mg / LNAA+0.1mg / L IBA+300mg / L Cef+200mg / L Tim+30.0g / L sucrose+6.5g / L agar, pH: 5.8) for 20 days; then they were cultured in screening medium (MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / L Cef+200mg / LTim+20.0mg / L kanamycin+30.0g / L sucrose+6.5g / L agar, pH: 5.8) for 20 days. Fifty explants were cultured in each experiment, and the experiment was repeated 3 times to allow the explants to grow transgenic callus tissue. The positive callus induction rate was counted after 40 days.

[0066] Experimental results:

[0067] Table 2 Positive rate of callus infected with different concentrations of Agrobacterium

[0068]

[0069] Adopt OD 600 The cotyledons of sterile seedlings of balsa wood were infected with Agrobacterium tumefaciens GV3101 (carrying 35S:RUBY) at concentrations of 0.4, 0.6, and 0.8, and red positive calli were obtained after resistance screening ( Figure 4 ), after 60 days, it was found that positive callus was produced after infection with the three concentrations of bacterial solution. The statistical and analytical results showed (Table 2), OD600 When the value was 0.4, the callus positive rate was 9.3%; 600 When the value was 0.6, the callus positive rate was 16.0%; 600 When the value was 0.8, the callus positive rate was 6.7%. The analysis results showed that the infection effect of Agrobacterium tumefaciens GV3101 (OD 600 )0.6>0.4>0.8, the highest positive callus rate of balsa wood cotyledons mediated transformation by Agrobacterium tumefaciens was 16.0%, and the total positive root rate of balsa wood cotyledons mediated transformation by Agrobacterium rhizogenes in Example 1 could reach 66.67%. It can be seen that the genetic transformation of balsa wood by Agrobacterium rhizogenes is more effective.

[0070] Comparative Example 1

[0071] The difference between Comparative Example 1 and Example 3 is that: in step 2) of Comparative Example 1, the recovery medium is: MS + 0.3 mg / L KT + 0.3 mg / L 2,4-D + 0.1 mg / L TDZ + 0.01 mg / L IBA + 200 mg / L Tim + 20.0 g / L sucrose + 6.5 g / L agar pH: 5.8; the screening medium is: MS + 0.3 mg / L KT +

[0072] 0.3mg / L 2,4-D+0.1mg / L TDZ+0.01mg / L IBA+200mg / L Tim+20.0mg / L kanamycin+20.0g / L sucrose+6.5g / L agar, pH: 5.8.

[0073] Experimental results: The induction rate of transgenic hairy roots was 19.6% and the positive rate was 8.6%.

[0074] Comparative Example 2

[0075] The difference between Comparative Example 1 and Example 3 is that: in step 2) of Comparative Example 1, the recovery medium (1 / 2MS + 0.5mg / L 6-BA + 0.01mg / L IBA + 200mg / L Tim + 15.0g / L sucrose + 6.5g / L agar pH: 5.8; the corresponding screening medium (1 / 2MS + 0.5mg / L 6-BA + 0.01mg / L IBA + 200mg / L Tim + 20.0mg / L kanamycin + 15.0g / L sucrose + 6.5g / L agar pH: 5.8)

[0076] Experimental results: The induction rate of transgenic hairy roots was 28.3% and the positive rate was 12.5%.

[0077] It can be seen from Comparative Examples 1 and 2 that the positive rates of recovery medium and screening medium using other formulations are low, only 8.6% and 12.5%, while the positive conversion rate in Example 3 is as high as 53.3%. It can be seen that the positive conversion rate is improved by using the recovery medium and screening medium formulations in this application.

[0078] Comparative Example 3

[0079] The difference between Comparative Example 3 and Example 4 is that the culture medium in Comparative Example 3 is MS+1.0 mg / L 6-BA+0.1 mg / L NAA+0.5 g / L gibberellin+30.0 g / L sucrose+6.5 g / L agar, pH: 5.8.

[0081] Experimental results: The induction rate of transgenic hairy root callus was 12.6%.

[0082] Comparative Example 4

[0083] The difference between Comparative Example 4 and Example 4 is that the culture medium in Comparative Example 4 is MS+0.5 mg / L 6-BA+0.1 mg / L 2,4-D+0.5 g / L caffeic acid+30.0 g / L sucrose+6.5 g / L agar, pH: 5.8.

[0085] Experimental results: The induction rate of transgenic hairy root callus was 17.8%.

[0086] It can be seen from Comparative Examples 3 and 4 that the callus induction rates of transgenic hairy roots were 12.6% and 17.8% respectively when MS+1.0mg / L 6-BA+0.1mg / L NAA+0.5g / L gibberellin and MS+0.5mg / L 6-BA+0.1mg / L 2,4-D+0.5g / L caffeic acid were used to induce callus of transgenic hairy roots, which were much lower than the transgenic hairy root callus induction rate of 28.3% using MS+0.5mg / L 6-BA+0.1mg / L NAA+1g / L chlormequat in Example 4. It can be seen that the culture medium formula in this application can improve the callus induction rate of transgenic hairy roots.

[0087] At present, there are no reports on the genetic transformation of balsa wood. Balsa wood is rich in secondary metabolites, which will seriously affect the vitality of the infection solution. Therefore, cotyledons and stem segments need to be treated with 5 mg / L xylanase for 30 minutes before being used as infection explants. During the infection stage, if the concentration of the bacterial solution is too high, Agrobacterium will multiply in large numbers, and the explants will be wrapped by Agrobacterium and cause damage, or even cause the death of the explants, affecting the transformation efficiency. If the concentration of the bacterial solution is too low, the virulence of the bacteria is poor, and Agrobacterium is not easy to adsorb on the wound of the explant, resulting in a decrease in transformation efficiency.

[0088] In this application, OD 600The results showed that the OD values ​​of Agrobacterium rhizogenes were 0.4, 0.5, 0.6, 0.7, and 0.8 respectively, and the cotyledons and stems of balsa wood were infected. 600 The culture medium was inoculated with Agrobacterium rhizogenes at 0.6, and then inoculated into recovery medium (1 / 2MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / L Cef+200mg / LTim or MS+0.1mg / L 6-BA+0.2mg / LNAA+0.1mg / L IBA+300mg / L Cef+200mg / L Tim) and screening medium (MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / L Cef+200mg / L Tim+20.0mg / L kanamycin). The positive hairy roots were the most, and the number of positive roots in the cotyledons of the light wood was greater than that in the stem segments, with a positive rate of 66.7%. 600 When the cotyledons of sterile seedlings were infected with Agrobacterium tumefaciens at concentrations of 0.4, 0.6, and 0.8, the positive callus rate was only 16.0%.

[0089] The transgenic hairy roots were cut and cultured in MS medium (MS+0.5mg / L 6-BA+0.1mg / L NAA+1g / L chlormequat chloride). The results showed that the transgenic hairy roots could form red callus after dedifferentiation, and the callus induction rate was 28.3%.

[0090] After culturing explants infected with SUC2:JcFT K599 for 40 days, 15 explants were randomly selected to extract DNA from hairy roots and untransformed balsa wood roots for PCR amplification. PCR detection showed that 8 of the 15 hairy root DNAs contained fragments of the FT gene, and the positive transformation rate reached 53.3%.

[0091] In summary, the present invention uses balsa wood cotyledons as explants, uses Agrobacterium rhizogenes K599 to prepare Agrobacterium rhizogenes K599 infection solution, and the OD of the Agrobacterium rhizogenes K599 infection solution is 600 The root genetic transformation system of balsa wood was constructed by using 1 / 2MS culture medium and Agrobacterium-mediated method, which improved the genetic transformation efficiency of balsa wood and laid the foundation for the subsequent screening of functional genes and molecular breeding through genetic transformation.

[0092] The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A method for genetic transformation of balsa wood mediated by Agrobacterium tumefaciens, characterized in that: Transgenic hairy roots or callus were obtained by infecting balsa wood explants with Agrobacterium rhizogenes K599 or Agrobacterium tumefaciens GV3101.

2. The method for genetic transformation of balsa wood according to claim 1, characterized in that: The balsa wood explants are infected with an infection solution prepared with a bacterial solution containing the target vector. After the infection is completed, the infected balsa wood explants are inoculated into a co-culture medium for co-culture; the infection solution is an infection solution of Agrobacterium rhizogenes K599 or an infection solution of Agrobacterium tumefaciens GV3101.

3. The method for genetic transformation of balsa wood according to claim 2, characterized in that: The balsa wood explant is a cotyledon or a stem segment; the bacterial solution OD 600 is 0.4-0.8, the bacterial solution is Agrobacterium rhizogenes K599 bacterial solution or Agrobacterium tumefaciens GV3101 bacterial solution; the co-culture medium is MS+0.2mg / LNAA+0.1mg / L 6-BA or 1 / 2MS+0.2mg / L NAA+0.1mg / L 6-BA.

4. The method for genetic transformation of balsa wood according to claim 3, characterized in that: The balsa wood explant is balsa wood cotyledon; the bacterial solution OD 600 is 0.5-0.7; the co-culture medium is 1 / 2MS+0.2mg / L NAA+0.1mg / L 6-BA.

5. The method for genetic transformation of balsa wood according to claim 4, characterized in that: The bacterial solution OD 600 is 0.

6.

6. The method for genetic transformation of balsa wood according to claim 2, characterized in that: The target vector refers to a pOCA30 vector containing a target gene; when the bacterial solution is Agrobacterium rhizogenes K599 bacterial solution, the target gene is RUBY or JcFT gene; when the bacterial solution is Agrobacterium tumefaciens GV3101 bacterial solution, the target gene is RUBY gene; The infection time is 20 minutes; the co-cultivation stage is dark cultivation, and the co-cultivation time is 3 days.

7. The method for genetic transformation of balsa wood according to claim 2, wherein the infection solution is prepared by the following method: centrifuging the bacterial solution at 4°C, discarding the supernatant, resuspending the bacteria in MS liquid culture medium and adding 100 μM AS and 3 mg / L 6-BA to prepare the infection solution.

8. The method for genetic transformation of balsa wood according to claim 2, characterized in that: The preparation method of the balsa wood explant is as follows: full balsa wood seeds are selected and disinfected with 1.0% sodium hypochlorite for 15 minutes, then rinsed with sterile water for three times, heated in a 55°C water bath for 30 minutes, inoculated in a 1 / 2MS culture medium and germinated for 30 days, seedlings are taken out, sterile cotyledons and stem segments are separated, and the balsa wood explants are obtained after pretreatment with 5mg / L xylanase for 30 minutes.

9. The method for genetic transformation of balsa wood according to claim 2, characterized in that: The following steps are also included: When the bacterial solution is Agrobacterium rhizogenes K599 bacterial solution, the cotyledons or stem segments of the balsa wood after co-culture are subjected to recovery culture and screening culture to obtain transgenic hairy roots, and the transgenic hairy roots are subjected to induction culture to obtain transgenic callus tissue; When the bacterial solution is Agrobacterium tumefaciens GV3101 bacterial solution, the cotyledons or stem segments of the balsa wood after co-culture are subjected to recovery culture and screening culture to obtain transgenic callus tissue.

10. The method for genetic transformation of balsa wood according to claim 9, characterized in that: When the bacterial solution is Agrobacterium rhizogenes K599 bacterial solution, the medium in the recovery culture is 1 / 2MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / L Cef+200mg / L Tim; When the bacterial solution is Agrobacterium tumefaciens GV3101 bacterial solution, the medium in the recovery culture is MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / L IBA+300mg / LCef+200mg / L Tim; The culture medium in the screening culture is MS+0.1mg / L 6-BA+0.2mg / L NAA+0.1mg / LIBA+300mg / LCef+200mg / L Tim+20.0mg / L kanamycin; The culture medium in the induction culture is MS+0.5mg / L 6-BA+0.1mg / L NAA+1g / L chlormequat.

Images