Method for efficiently obtaining hairy roots of transgenic roses without tissue culture

Abstract

The invention discloses a method for efficiently obtaining hairy roots of transgenic roses without tissue culture. The method comprises the following steps: selecting a robust branch of a purple-branch rose seedling as an acceptor material, contacting a girdling wound with agrobacterium rhizogenes for infection, carrying out sealed culture on the infected acceptor material in a high-pressure propagation box, applying antibiotics every week after culturing for one week, and then forming positive callus at the girdling wound, after growing for two weeks, the positive callus is differentiated to form a positive root, and the hairy root of the transgenic rose is obtained. According to the established transgenic rose hairy root induction system, gene function verification can be efficiently and rapidly carried out in rose origin species, the rose molecular breeding process is accelerated, and a new method is provided for cultivation of new rose varieties.

Description

Technical Field

[0001] The invention relates to the technical field of plant transgenic technology, and in particular to a method for efficiently obtaining transgenic rose hairy roots without tissue culture. Background Art

[0002] Rose (Rosa rugosa) is a deciduous upright shrub of the genus Rosa in the family Rosaceae. It is native to northern China. It is an important economic plant in my country with bright colors, fragrant flowers and high oil content. It is also one of the important ornamental and production flowers in the world. The traditional hybrid breeding method is used to breed new varieties, which takes a long time and requires a lot of work. In addition, it is limited by the variation of the breeding materials themselves, and the improvement range is limited. With the rapid development of biotechnology, plant cell engineering and genetic engineering technologies are becoming more and more mature. On the basis of keeping other traits of the variety relatively stable, the traits controlled by the exogenous genes can be used to improve the breeding efficiency, thus providing a new way to breed new rose varieties.

[0003] The research on rose genetic transformation is the basis of genetic engineering breeding, but there are few reports on the successful genetic transformation of roses at home and abroad. The Chinese invention patent entitled "A method for genetic transformation of roses mediated by Agrobacterium" (Announcement No.: CN201110202403.0) discloses a method for genetic transformation of roses mediated by Agrobacterium, which fills the gap that rose transgenic plants cannot be cultivated in China. However, the genetic transformation of roses currently has difficulties such as low transformation efficiency, complex operation, and long transformation cycle. It is impossible to efficiently and quickly verify the function of rose genes, which makes it difficult to meet the current needs of rose molecular breeding. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for efficiently obtaining transgenic rose hairy roots without tissue culture. The present invention uses rose plants as receptor materials and mediates rose genetic transformation through Agrobacterium rhizogenes. The method has the advantages of simple method, short culture cycle and no need for tissue culture.

[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0006] The present invention provides a method for efficiently obtaining transgenic rose hairy roots without tissue culture, comprising the following steps:

[0007] (1) Preparation of receptor materials: Select robust branches of rose seedlings and treat them to form ring-barking wounds as receptor materials;

[0008] (2) Infection: Apply Agrobacterium rhizogenes to the ring-barking wounds of the recipient material for infection;

[0009] (3) Co-cultivation: The infected recipient material is co-cultivated by sealing the ring-barking wound in a high-pressure propagation box;

[0010] (4) Selective culture: Antibiotics are applied to the recipient material after co-culture once a week, and transgenic rose hairy roots are obtained after culture.

[0011] Furthermore, in step (1), the specific steps of treating and forming the ringing wound are: using the ringing shears to ring-remove the epidermis of the branch with a width of 1 to 1.5 cm, and using a knife to scrape off the cambium cells at the ringing site to form the ringing wound.

[0012] Furthermore, in step (2), the Agrobacterium rhizogenes is Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 or Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1;

[0013] Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 carries the PK7WG2D.1 plasmid, which carries the EGFP reporter gene behind the proID promoter;

[0014] Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1 carries the pCAMBIA2300s-EsMYBA1 plasmid, which has the EsMYBA1 gene inserted between the two restriction sites of BamHI and SalI after the 35s promoter;

[0015] The infection was carried out once a day for three consecutive days.

[0016] Furthermore, the nucleotide sequence of the EGFP reporter gene is shown as SEQ ID NO: 1; the nucleotide sequence of the EsMYBA1 gene is shown as SEQ ID NO: 2.

[0017] Furthermore, the method for preparing the Agrobacterium rhizogenes cells comprises the following steps:

[0018] 1) electroporating the plasmid into competent cells of Agrobacterium rhizogenes ATCC15834 to obtain a single colony of Agrobacterium rhizogenes, wherein when the plasmid is PK7WG2D.1 plasmid, the Agrobacterium rhizogenes is Agrobacterium rhizogenes ATCC15834-PK7WG2D.1;

[0019] Alternatively, when the plasmid is pCAMBIA2300s-EsMYBA1 plasmid, Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1;

[0020] 2) Streaking and activating a single colony of Agrobacterium rhizogenes on TY solid medium containing antibiotics to grow a single colony;

[0021] 3) Pick a single colony and inoculate it in TY liquid medium containing antibiotics for activation culture to obtain an activated bacterial solution;

[0022] 4) inoculating the activated bacterial solution into TY liquid culture medium containing antibiotics to obtain a bacterial solution;

[0023] 5) The bacterial liquid was centrifuged to collect the bacterial cells, and the cells were added with MMA resuspension solution for resuspending and then statically cultured, and the bacterial cells were collected by centrifugation to obtain the rhizogenes Agrobacterium cells.

[0024] Furthermore, when the Agrobacterium rhizogenes is Agrobacterium rhizogenes ATCC15834-PK7WG2D.1, the antibiotic is spectinomycin, and the content of spectinomycin is 100 mg / L;

[0025] Alternatively, when the Agrobacterium rhizogenes is Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1, the antibiotic is kanamycin, and the content of kanamycin is 100 mg / L.

[0026] Furthermore, in step 2), the streaking activation condition is culturing in the dark in a 28° C. incubator for 2 days;

[0027] In the step 3), the activation culture conditions are 28° C., 200 rpm shaking culture for 12 to 16 hours;

[0028] In the step 4), the volume ratio of the activated bacterial solution to the TY liquid culture medium containing antibiotics is 1:900-1000, and the culture conditions are 28° C. and 200 rpm shaking culture until the bacterial solution OD600 is 0.8-1.0;

[0029] In the step 5), the components of the MMA resuspension solution include 10 mM magnesium chloride, 10 mM 2-morpholineethanesulfonic acid, 100 μM acetosyringone, pH=5.6; the static culture condition is 2 to 4 hours.

[0030] Furthermore, in the step (3), the composition of the soil matrix in the high-pressure propagation box is matrix soil: peat soil: vermiculite mass ratio = 2:1:1;

[0031] The growth conditions in the high-pressure propagation box are a temperature of 24±2°C, a soil humidity of 70-85%, and a dark environment until the transgenic rose hairy roots grow.

[0032] Furthermore, in step (4), the antibiotic is kanamycin, the concentration is 100 mg / L, and the application amount is 50 to 100 mL.

[0033] Furthermore, in step (3) and step (4), foliar fertilizer is sprayed on the receptor material every week during the co-cultivation and selection culture stages. The foliar fertilizer is a 500-fold diluted solution of nitrogen, phosphorus and potassium water-soluble fertilizer, and the spraying amount is 50 mL.

[0034] Beneficial effects of the present invention:

[0035] 1. The present invention utilizes Agrobacterium rhizogenes to infect roses to obtain transgenic hairy roots. The entire genetic transformation process does not require aseptic operation. Compared with the previous method of obtaining transgenic hairy roots through plant tissue culture, not only is the genetic transformation operation simpler and more convenient, but the genetic transformation cycle is also greatly shortened. Transgenic rose hairy roots can be obtained in only 4 to 6 weeks.

[0036] 2. The method of the present invention successfully uses rose branches as transformation receptor materials, and obtains transgenic rose hairy roots containing the GFP gene or the EsMYBA1 gene through Agrobacterium rhizogenes mediation and subsequent further cultivation.

[0037] 3. The receptor material used in the present invention is easy to obtain, and the genetic transformation experiment of rose can be carried out without material limitation. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the plasmid map of PK7WG2D.1;

[0039] Figure 2 is the plasmid map of pCAMBIA2300s;

[0040] Figure 3 A technical roadmap for the method of efficiently obtaining transgenic rose hairy roots without tissue culture;

[0041] Figure 4 This is a phenotypic comparison of GFP-transformed rose hairy roots and untransformed rose roots under natural light and 475nm excitation light;

[0042] In the figure, a-b: untransformed rose root system and GFP-transformed rose hairy roots under natural light, a: untransformed rose root system, b: GFP-transformed rose hairy roots;

[0043] c~d: GFP gene-transformed rose hairy roots and untransformed rose roots under 475nm excitation light, c: untransformed rose roots, d: GFP gene-transformed rose hairy roots.

[0044] Figure 5 This is the PCR detection diagram of the hairy roots of roses transformed with GFP gene and the roots of untransformed roses;

[0045] In the figure, M represents DNA Maker, and WT represents untransformed rose roots.

[0046] Figure 6 This is a comparison of the root phenotypes of EsMYBA1-transformed rose hairy roots and untransformed roses;

[0047] In the figure, a: untransformed rose root system, b: EsMYBA1 gene-transformed rose hairy roots.

[0048] Figure 7 This is the PCR detection diagram of EsMYBA1 gene-transformed rose hairy roots and untransformed rose roots;

[0049] In the figure, M represents DNA Maker, and WT represents untransformed rose roots. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0051] Test Materials:

[0052] 1. Receptor material: strong branches of purple rose seedlings.

[0053] 2. Strains and plasmids: The Agrobacterium rhizogenes strain used in the experiment was Agrobacterium rhizogenes competent cell ATCC15834, purchased from Shanghai Weidi Biotechnology Co., Ltd. The plasmids used in the experiment were PK7WG2D.1 plasmid and pCAMBIA2300s-EsMYBA1 plasmid. The plasmid map of PK7WG2D.1 plasmid is shown in Figure 1 As shown, the plasmid carries the EGFP reporter gene behind the proID promoter, and the nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO: 1; the plasmid map of the pCAMBIA2300s plasmid is shown in Figure 2 As shown, the plasmid inserts the EsMYBA1 gene between the two restriction sites of BamHI and SalI after the 35s promoter, and the nucleotide sequence of the EsMYBA1 gene is shown in SEQ ID NO:2.

[0054] 3. Culture medium or solution formulation

[0055] (1) YT solid or liquid medium: 3 g / L Yeast Extract, 5 g / L Tryptone, 10 mM CaCl2, 15 g / L Agar in solid medium;

[0056] (2) MMA resuspension solution: 10 mM magnesium chloride (MgCl2), 10 mM 2-morpholineethanesulfonic acid (MES), 100 μM acetosyringone (AS), pH = 5.6;

[0057] (3) Antibiotics: 100 mg / L kanamycin (Km), 100 mg / L spectinomycin (Spe);

[0058] (4) AS acetosyringone: Weigh a certain amount of AS, dissolve it in 95% alcohol, and finally dilute it with sterile distilled water to prepare a 100 mM stock solution. Sterilize it by filtering with a 0.45 μm filter membrane and store it at -20°C.

[0059] (5) The composition of the soil matrix in the high-pressure propagation box: the mass ratio of matrix soil: peat soil: vermiculite is 2:1:1.

[0060] Example 1

[0061] Preparation of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 for infection

[0062] 1. Transform PK7WG2D.1 plasmid into Agrobacterium rhizogenes competent cells ATCC15834

[0063] (1) Take out the 0.1 cm electric shock cup and cup cover from the storage solution and invert it on clean absorbent paper for 5 minutes to drain the water. Place it upright for 5 minutes to allow the ethanol to evaporate completely. Once the ethanol has evaporated, immediately insert it into ice and compact the ice surface. Keep the top of the electrode cup 0.5 cm away from the ice surface to facilitate the cup cover. Let it stand in the ice for 5 minutes to fully cool down.

[0064] (2) Take the competent cells of Agrobacterium rhizogenes ATCC15834 stored at -80°C and put them in ice for 5 min. After they melt, add 100 ng of PK7WG2D.1 plasmid DNA (the plasmid carries the EGFP reporter gene after the proID promoter, and the nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO: 1), stir the bottom of the tube by hand to mix, and immediately put it in ice. Use a 200 μL pipette tip to quickly transfer the competent cell-plasmid mixture to the electroporation cup, cover the cup, and keep the empty tube for later use.

[0065] (3) Start the electroporator and set the parameters: C = 25 μF, PC = 200 ohm, V = 2400 V. Take the electroporation cup out of the ice, dry the outer surface with absorbent paper, quickly put it into the electroporation tank, start the electroporation, and quickly insert it into ice after the electroporation is completed. Add 1 mL of liquid TY culture medium without antibiotics and transfer it to a 1.5 mL empty tube. Incubate at 28°C with shaking for 2 to 3 h.

[0066] (4) Centrifuge at 6000 rpm for one minute to collect the bacteria. Take about 100 μL of the supernatant and gently blow to resuspend the bacteria. Spread the plate on a TY solid culture medium containing 100 mg / L Spe antibiotics and invert it in a 28°C incubator for 72 h.

[0067] (5) Pick a single clone and perform PCR detection using primers GFP-F / R. The primer sequences are as follows:

[0068] GFP-F: ATGGTGAGCAAGGGCGAGGA;

[0069] GFP-R:TTACAGCTCGTCCTTCTTGTACAG.

[0070] After verification, a positive single colony was obtained, namely Agrobacterium rhizogenes ATCC15834-PK7WG2D.1.

[0071] 2. Preparation of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1

[0072] (1) A single colony of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 was selected and inoculated into 2 mL of TY liquid culture medium containing 100 mg / L Spe, and cultured overnight (12 to 16 h) on a constant temperature shaker at 28°C and 200 rpm.

[0073] (2) On the next day, 200 μL of bacterial solution was transferred to 200 mL of TY liquid medium containing 100 mg / L Spe, and cultured on a 28°C constant temperature shaker at 200 rpm until OD600 = 0.8-1.0.

[0074] (3) Transfer the bacterial solution from the conical flask to a 50 mL centrifuge tube, centrifuge at 5000 r / min for 10 min, remove the supernatant, place the collected Agrobacterium rhizogenes ATCC15834 cells in MMA resuspension solution, resuspend and culture at room temperature for 2 to 4 h, then centrifuge at 5000 r / min for 10 min to collect Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 cells for infection of the receptor material.

[0075] Example 2

[0076] Preparation of Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1 for infection

[0077] 1. Transform the pCAMBIA2300s-EsMYBA1 plasmid into Agrobacterium rhizogenes competent cells ATCC15834

[0078] (1) Take out the 0.1 cm electric shock cup and cup cover from the storage solution and invert it on clean absorbent paper for 5 minutes to drain the water. Place it upright for 5 minutes to allow the ethanol to evaporate completely. Once the ethanol has evaporated, immediately insert it into ice and compact the ice surface. Keep the top of the electrode cup 0.5 cm away from the ice surface to facilitate the cup cover. Let it stand in the ice for 5 minutes to fully cool down.

[0079] (2) Take the competent cells of Agrobacterium rhizogenes ATCC15834 stored at -80°C and put them in ice for 5 min. After they melt, add 100 ng of pCAMBIA2300s-EsMYBA1 plasmid DNA (EsMYBA1 gene is inserted between the two restriction sites of BamHI and SalI after the 35s promoter, and the nucleotide sequence of EsMYBA1 gene is shown in SEQ ID NO: 2), stir the bottom of the tube by hand to mix, and immediately put it in ice. Use a 200 μL pipette tip to quickly transfer the competent cell-plasmid mixture to the electroporation cup, cover the cup, and keep the empty tube for later use.

[0080] (3) Start the electroporator and set the parameters: C = 25 μF, PC = 200 ohm, V = 2400 V. Take the electroporation cup out of the ice, dry the outer surface with absorbent paper, quickly put it into the electroporation tank, start the electroporation, and quickly insert it into ice after the electroporation is completed. Add 1 mL of liquid TY culture medium without antibiotics and transfer it to a 1.5 mL empty tube. Incubate at 28°C with shaking for 2 to 3 h.

[0081] (4) Collect the bacteria by centrifugation at 6000 rpm for one minute. Take about 100 μL of the supernatant and gently blow to resuspend the bacteria. Spread the plate on a TY solid culture medium containing 100 mg / L Km antibiotics and invert it in a 28°C incubator for 72 h.

[0082] Pick a single clone and perform PCR detection using primers MYBX-F / R. The primer sequences are as follows:

[0083] MYBX-F: CGGGATCCATGAAGCCAGATTTTAGTGAGATGT;

[0084] MYBX-R:GCGTCGACTCATTCAAAATTCCAAAAGTTCAAGT.

[0085] After verification, a positive single colony was obtained, namely Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1.

[0086] 2. Preparation of Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1

[0087] (1) A single colony of Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1 was streaked on TY solid medium containing 100 mg / L Km, and then the plate was inverted and cultured in a 28°C incubator in the dark for 2 days until a single colony was produced.

[0088] (2) Pick a single colony and inoculate it into 2 mL of TY liquid culture medium containing 100 mg / L Km, and culture it on a constant temperature shaker at 28°C and 200 rpm overnight (12 to 16 h).

[0089] (3) On the next day, 200 μL of the bacterial solution was transferred to 200 mL of TY liquid medium containing 100 mg / L Km and cultured overnight on a 28°C constant temperature shaker at 200 rpm until the bacterial solution OD600 = 0.8-1.0.

[0090] (4) Transfer the bacterial solution from the conical flask to a 50 mL centrifuge tube, centrifuge at 5000 r / min for 10 min, remove the supernatant, place the collected Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1 cells in MMA resuspension solution, resuspend and culture at room temperature for 2 to 4 h, then centrifuge at 5000 r / min for 10 min to collect the Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1 cells as receptor materials for infection.

[0091] Example 3

[0092] A method for efficiently obtaining transgenic rose hairy roots without tissue culture

[0093] Combination Figure 3 As shown, the method for efficiently obtaining transgenic rose hairy roots without tissue culture comprises the following steps:

[0094] 1. Preparation of receptor material: Use the healthy branches of purple rose seedlings as receptor materials, use ring-barking shears to ring-bark and remove the 1-1.5 cm wide epidermis, and use a knife to scrape off the ring-barking area to form a ring-barking wound to provide receptor materials for genetic transformation.

[0095] Since the branches of rose seedlings are used as the transformation receptor materials, healthy and disease-free branches are strictly selected. After the branches that are too young and diseased are infected with Agrobacterium rhizogenes, it is difficult to form callus tissue at the ring-barking wound during the subsequent growth process, and the branches above the ring-barking wound gradually die.

[0096] 2. Infection: Use a brush to evenly apply the Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 prepared in Example 1 and the Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1 prepared in Example 2 to the ring-barking wounds of the receptor material prepared in step 1, and repeat the application once a day for three consecutive days to complete the infection.

[0097] For rose plants, multiple infections are an important factor affecting the success of infection. When infecting with Agrobacterium rhizogenes, repeatedly infecting the ring-barking wound once a day for three consecutive days can greatly improve the infection efficiency.

[0098] 3. Co-cultivation: The infected receptor material is sealed in a high-pressure propagation box for co-cultivation. The growth conditions in the high-pressure propagation box are a temperature of 24±2°C, a soil humidity of 70-85%, and a dark environment for 7 days.

[0099] The control of water and fertilizer during the growth of the infected recipient material has a great impact on the entire genetic transformation cycle. Reasonable fertilization can shorten the period of obtaining transgenic rose hairy roots. Therefore, foliar fertilizer is sprayed every week during the co-cultivation and selection culture stages. The foliar fertilizer is a 500-fold diluted solution of nitrogen, phosphorus and potassium water-soluble fertilizer, and the spraying amount is 50mL.

[0100] 4. Selective culture: 50-100 mL 100 mg / L Km antibiotic solution was applied to the receptor material after co-culture for 7 days. The antibiotic was applied once a week. The growth conditions in the high-pressure propagation box were 24±2°C, 70-85% soil humidity, and dark environment; the rose growth conditions were 24±2°C, 35-50% air humidity, 3000-3500 lux, and 16h light and 8h dark. After two weeks, positive callus tissue was formed at the ring-barking wound. After two weeks of growth, the positive callus tissue differentiated into positive roots, and the GFP gene-transformed rose hairy roots and EsMYBA1 gene-transformed rose hairy roots were obtained respectively.

[0101] Example 4

[0102] Detection of Transgenic Rose Hairy Roots

[0103] The GFP gene-transformed rose hairy roots and untransformed rose roots obtained in Example 3 were placed under 475 nm excitation light for GFP fluorescence detection; the obtained GFP gene-transformed rose hairy roots and EsMYBA1 gene-transformed rose hairy roots were used as materials, and the untransformed rose roots were used as negative control, and total DNA was extracted by the CTAB method for PCR detection.

[0104] The results are as follows Figure 4 to Figure 7 As shown, a total of 20 transgenic rose plants were transformed in the experiment, including 15 GFP gene-transformed rose plants, and the total number of GFP gene-transformed rose hairy roots was 384, 263 of which were positive, with a transformation efficiency of 68.49%; 5 EsMYBA1 gene-transformed rose plants, and the total number of EsMYBA1 gene-transformed rose hairy roots was 133, 83 of which were positive, with a transformation efficiency of 62.41%.

[0105] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A method for efficiently obtaining transgenic rose hairy roots without tissue culture, characterized in that: The following steps are involved: (1) Preparation of receptor materials: Select robust branches of rose seedlings and treat them to form ring-barking wounds as receptor materials; (2) Infection: Apply Agrobacterium rhizogenes to the ring-barking wounds of the recipient material for infection; (3) Co-cultivation: The infected recipient material is co-cultivated by sealing the ring-barking wound in a high-pressure propagation box; (4) Selective culture: Antibiotics are applied to the recipient material after co-culture once a week, and transgenic rose hairy roots are obtained after culture.

2. The method according to claim 1, characterized in that: In the step (1), the specific steps of treating and forming the girdling wound are: using girdling shears to gird and remove the epidermis of the branch with a width of 1 to 1.5 cm, and using a knife to scrape off the cambium cells at the girdling site to form the girdling wound.

3. The method according to claim 1, characterized in that: In the step (2), the Agrobacterium rhizogenes is Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 or Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1; Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 carries the PK7WG2D.1 plasmid, which carries the EGFP reporter gene behind the proID promoter; Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1 carries the pCAMBIA2300s-EsMYBA1 plasmid, which has the EsMYBA1 gene inserted between the BamHI and SalI restriction sites after the 35s promoter; The infection was carried out once a day for three consecutive days.

4. The method according to claim 3, characterized in that: The nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO: 1; the nucleotide sequence of the EsMYBA1 gene is shown in SEQ ID NO:

2.

5. The method according to claim 3, characterized in that: The preparation method of the Agrobacterium rhizogenes comprises the following steps: 1) electroporating the plasmid into competent cells of Agrobacterium rhizogenes ATCC15834 to obtain a single colony of Agrobacterium rhizogenes, wherein when the plasmid is PK7WG2D.1 plasmid, the Agrobacterium rhizogenes is Agrobacterium rhizogenes ATCC15834-PK7WG2D.1; Alternatively, when the plasmid is pCAMBIA2300s-EsMYBA1 plasmid, Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1; 2) Streaking and activating a single colony of Agrobacterium rhizogenes on TY solid medium containing antibiotics to grow a single colony; 3) Pick a single colony and inoculate it in TY liquid medium containing antibiotics for activation culture to obtain an activated bacterial solution; 4) inoculating the activated bacterial solution into TY liquid culture medium containing antibiotics to obtain a bacterial solution; 5) The bacterial liquid was centrifuged to collect the bacterial cells, and the cells were resuspended in MMA resuspension solution and then cultured statically. The bacterial cells were collected by centrifugation to obtain Agrobacterium rhizogenes cells.

6. The method according to claim 5, characterized in that: When the rhizogenes Agrobacterium is Agrobacterium rhizogenes ATCC15834-PK7WG2D.1, the antibiotic is spectinomycin, and the content of spectinomycin is 100 mg / L; Alternatively, when the Agrobacterium rhizogenes is Agrobacterium rhizogenes ATCC15834-pCAMBIA2300s-EsMYBA1, the antibiotic is kanamycin, and the content of kanamycin is 100 mg / L.

7. The method according to claim 5, characterized in that: In the step 2), the streaking activation condition is culturing in the dark in a 28° C. incubator for 2 days; In the step 3), the activation culture conditions are 28° C., 200 rpm shaking culture for 12 to 16 hours; In the step 4), the volume ratio of the activated bacterial solution to the TY liquid culture medium containing antibiotics is 1:900-1000, and the culture conditions are 28° C. and 200 rpm shaking culture until the bacterial solution OD600 is 0.8-1.0; In the step 5), the components of the MMA resuspension solution include 10 mM magnesium chloride, 10 mM 2-morpholineethanesulfonic acid, 100 μM acetosyringone, pH=5.6; the static culture condition is 2 to 4 hours.

8. The method according to claim 1, characterized in that: In the step (3), the composition of the soil matrix in the high-pressure breeding box is matrix soil: peat soil: vermiculite mass ratio = 2:1:1; The growth conditions in the high-pressure propagation box are a temperature of 24±2°C, a soil humidity of 70-85%, and a dark environment until the transgenic rose hairy roots grow.

9. The method according to claim 1, characterized in that: In the step (4), the antibiotic is kanamycin, the concentration is 100 mg / L, and the application amount is 50 to 100 mL.

10. The method according to claim 1, characterized in that: In the steps (3) and (4), during the co-cultivation and selection culture stages, foliar fertilizer is sprayed on the receptor material every week, the foliar fertilizer being a 500-fold diluted solution of nitrogen, phosphorus and potassium water-soluble fertilizer, and the spraying amount is 50 mL.

Images