The application of a gene ZmWAKL21 encoding a protein containing WAK domain in corn to corn fungal disease resistance

Abstract

The application relates to application of a corn WAK domain-containing protein coding gene ZmWAKL21 in corn fungal disease resistance, and belongs to the technical field of plant disease prevention and control and transgenic technology. The nucleotide sequence of the gene ZmWAKL21 is shown in SEQ ID No. 1, and the application is specifically application in corn breeding for resisting Puccinia polysora. The research result of the application shows that ZmWAKL21 can affect the infection efficiency of Puccinia polysora, and the research can lay a foundation for corn and pathogenic fungus interaction research. Meanwhile, the application successfully obtains Puccinia polysora infection resistance transgenic corn through a transgenic mode, and unexpected technical effects are achieved.

Description

Technical Field

[0001] This invention relates to the fields of plant disease control and transgenic technology, and mainly to the application of ZmWAKL21, a protein-coding gene containing the WAK domain in maize, in maize's resistance to fungal diseases. Background Technology

[0002] Southern rust of maize, caused by *Styrax multifiliis*, is an obligate parasitic fungus that can only infect, grow, and reproduce on maize plants. In the early stages, maize leaves develop chlorotic spots, which gradually develop into orange-yellow to brownish-yellow circular spots, often with a slightly raised surface. Within about 1-2 weeks, the uredinia mature, and the epidermis ruptures, releasing powdery urediniospores. Southern rust of maize is a severely destructive fungal disease; historically, it has caused numerous large-scale outbreaks, resulting in significant yield losses.

[0003] Currently, the main method for controlling fungal diseases in maize is through the spraying of chemical agents. While this method is highly effective, it causes serious environmental pollution in the long run, hindering the sustainable development of green agriculture and ecological balance. Therefore, discovering resistance genes and cultivating resistant varieties is beneficial for better control of maize fungal diseases. Based on current research, cultivating disease-resistant maize plant lines is currently the most effective means of controlling maize fungal diseases.

[0004] Cell wall-associated receptor kinases (WAKs) and WAK analogs (WAKLs), as representatives of pattern recognition receptors (PRRs), are increasingly recognized as important contributors to plant immunity. In recent years, several new WAK and WAKL gene members have been cloned from various crops, revealing their direct roles in managing broad-spectrum and specific isolate resistance. In maize, the ZmWAKL gene encodes a cell wall-associated receptor kinase-like protein and is a pathogenic gene at the major quantitative resistance site against gray leaf spot (GLS). Another cell wall-associated kinase gene, ZmWAK, has been identified as a pathogenic gene at the qHSR1 site, reducing disease incidence by approximately 25%. ZmWAK-RLK1 is a gene that provides quantitative resistance to northern maize leaf spot (NCLB).

[0005] Beyond maize, WAK and WAKL genes also play important roles in disease resistance in other crops. For example, in wheat, silencing TaWAK-6D weakens resistance to *F. pseudograminearum* and *R. cerealis* and reduces the expression of defense genes. TaWAK6 enhances resistance to *Puccinia triticina* leaf rust. In rice, OsWAK14, OsWAK91, and OsWAK92 enhance resistance to *Pseudomonas oryzae*, while OsWAK112d reduces resistance. In cotton, GhWAK7A plays a key role in resistance to fungal wilt through interaction with chitin receptors. In soybean, GmWAK1 has a positive effect on resistance to *Phytophthora sojae*. However, the functions of WAKs and WAKLs in host-pathogen interactions require further analysis, and their role in maize southern rust resistance has not yet been reported. Summary of the Invention

[0006] To address the aforementioned issues, this invention provides the application of the WAK domain-encoding gene ZmWAKL21 in maize for resistance to fungal diseases. The research results of this invention indicate that ZmWAKL21 can influence the infection efficiency of *Rust hygroscopicus*, and this research also lays the foundation for research on the interaction between maize and pathogenic fungi. Furthermore, this invention successfully obtained transgenic maize resistant to *Rust hygroscopicus* infection through transgenic methods, achieving unexpected technical results.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] Application of a maize protein encoding a WAK domain gene, ZmWAKL21, in maize resistance to fungal diseases. The nucleotide sequence of the gene ZmWAKL21 is shown in SEQ ID No. 1.

[0009] Furthermore, the amino acid sequence of the protein encoded by the gene ZmWAKL21 is shown in SEQ ID No. 2.

[0010] Furthermore, the biomaterial associated with the protein encoded by the gene ZmWAKL21 is any one of the following A1) to A12):

[0011] A1) The nucleic acid molecule that encodes the protein;

[0012] A2) An expression cassette containing the nucleic acid molecules described in A1);

[0013] A3) A recombinant vector containing the nucleic acid molecules described in A1);

[0014] A4) A recombinant vector containing the expression cassette described in A2);

[0015] A5) Recombinant microorganisms containing the nucleic acid molecules described in A1);

[0016] A6) Recombinant microorganisms containing the expression cassette described in A2);

[0017] A7) Recombinant microorganisms containing the recombinant vector described in A3);

[0018] A8) Recombinant microorganisms containing the recombinant vector described in A4);

[0019] A9) Transgenic plant cell lines containing the nucleic acid molecules described in A1);

[0020] A10) A transgenic plant cell line containing the expression cassette described in A2);

[0021] A11) Transgenic plant cell lines containing the recombinant vector described in A3);

[0022] A12) Transgenic plant cell lines containing the recombinant vector described in A4).

[0023] Furthermore, the application is specifically in maize breeding resistant to Puccinia polysora.

[0024] A method for preparing a transgenic maize resistant to Puccinia polysora includes the following steps: transfecting starting maize with a ZmWAKL21 overexpression vector to obtain resistant transgenic maize, wherein the resistant transgenic maize has resistance to Puccinia polysora compared with the starting maize, and the nucleotide sequence of the ZmWAKL21 gene is shown in SEQ ID No. 1.

[0025] Furthermore, the specific steps include:

[0026] (1) Cloning of the maize ZmWAKL21 gene;

[0027] (2) Construction of overexpression vectors;

[0028] (3) Agrobacterium transformation and callus induction culture;

[0029] (4) Positive identification of genetically modified corn.

[0030] Furthermore, the cloning of the maize ZmWAKL21 gene includes the following steps:

[0031] 1) Design primers ZmWAKL21-F and ZmWAKL21-R based on the open reading frame (ORF) of ZmWAKL21.

[0032] ZmWAKL21-F: CCACCACCTATCCTTTCCTTCCT, as shown in SEQ ID No. 3;

[0033] ZmWAKL21-R: CAAGGCCTAAGTGACAGAACAAA, as shown in SEQ ID No. 4;

[0034] 2) Perform PCR reaction, recover the PCR product, ligate it into the pCE2-T vector, select single clones, send them for testing, and obtain the correct pCE2-T-ZmWAKL21 recombinant plasmid.

[0035] Furthermore, the construction of the overexpression vector includes the following steps:

[0036] 1) Design primers with XcmI restriction sites to amplify the ZmWAKL21 gene. The template is the pCE2-T-ZmWAKL21 recombinant plasmid that has been correctly identified by sequencing. The pBECXUN vector is digested with XcmI enzyme.

[0037] 2) After digesting the pBECXUN vector with enzymes, the PCR products were recovered and ligated to the vectors respectively; positive clones were selected and sequenced to confirm that the pBECXUN-ZmWAKL21 overexpression vector had been successfully constructed.

[0038] The primer sequences are as follows:

[0039] pBECXUN-ZmWAKL21-F:AGATCTTCCAATACTTATGCAGACCACCGCC,as shown in SEQ ID No. 5;

[0040] pBECXUN-ZmWAKL21-R:

[0041] TCGGATCCCCAATACTCACTTGTCATCGTCGTCCTTGTAATCCTTGTCATCGTCGTCCTTGTAATCCTTGTCATCGTCGTCCTTGTAATCACTGCTGTTATGGGTAGTGG, as shown in SEQ ID No. 6.

[0042] Furthermore, the Agrobacterium transformation and callus induction culture includes the following steps:

[0043] 1. Preparation of Agrobacterium

[0044] Add 1 µL of plasmid to 50 µL of EHA105 Agrobacterium competent cells, mix thoroughly, and then transfer to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and then transfer to a 1.5 mL centrifuge tube. Incubate in a shaker at 30 °C and 180 rpm for 30 min. Inoculate 50 µL of the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30 °C for 48 h.

[0045] 2. Maize genetic transformation

[0046] 2.1 Disinfection and Embryo Retrieval

[0047] Remove the outer shell of the spikelet and place it in a container for sterilization; take a sterilized 2mL EP tube, add the suspension to the tube, and take the immature embryo;

[0048] 2.2 Agrobacterium infection and co-culture

[0049] Agrobacterium was picked into the infection solution to prepare OD. 600 = 0.2% Agrobacterium resuspension, aspirate the suspension liquid from the EP tube, add the prepared Agrobacterium bacterial solution, and infect; pour the infected embryos along with the bacterial solution into a co-culture, aspirate the bacterial solution dry; incubate in a dark incubator at 25℃ for 2-3 days;

[0050] 2.3 Callus induction and screening

[0051] After co-culture, the embryos were inoculated onto induction medium and cultured in the dark at 28°C for 7-10 days. The induced calluses were then inoculated onto screening medium for screening culture and cultured in the dark at 28°C for 2 weeks. The calluses that survived the first screening were then used for the second screening.

[0052] 2.4 Differentiation and Rooting

[0053] The selected embryogenic callus was inoculated onto a predifferentiation medium and cultured in the dark at 28°C for 10 days. The predifferentiated embryogenic callus was then inoculated onto a differentiation medium and cultured under light at 25°C until seedlings differentiated. The differentiated seedlings were then transferred to a rooting medium and cultured under light at 25°C until the root system was fully developed. The developed seedlings were then hardened off and transplanted into the greenhouse substrate.

[0054] Furthermore, the positive identification of the genetically modified corn includes the following steps:

[0055] Total RNA was extracted from maize leaves of the test and control maize plants using the TRIzol method and reverse transcribed into cDNA. The maize ZmEF1α gene was used as an internal control, and ZmWAKL21 and ZmEF1α specific primers were used for detection. The relative gene expression levels were used to determine whether the maize plants were resistant.

[0056] Furthermore, the specific primer sequences are as follows:

[0057] qRT-ZmWAKL21-F: GACAAGAGCGACGTGTACAG, as shown in SEQ ID No. 7;

[0058] qRT-ZmWAKL21-R: CTGGCCAGGTTGACGTC, as shown in SEQ ID No. 8;

[0059] ZmEF1α-F: TGGGCCTACTGGTCTTACTACTGA, as shown in SEQ ID No. 9;

[0060] ZmEF1α-R: ACATACCCACGCTTCAGATCCT, as shown in SEQ ID No. 10.

[0061] Furthermore, the judgment method is as follows: if the relative expression level of the ZmWAKL21 gene in the maize plant to be tested is significantly higher than that in the control, then it is a resistant maize.

[0062] This invention utilizes plant transgenic technology to transform the full-length ZmWAKL21 gene into maize, and then screens for transgenic lines with high expression levels. Experiments show that after maize is infected with *Russula multifiliis*, the resistance to fungal infection by the ZmWAKL21 overexpression transgene is significantly increased compared to the wild-type control. ZmWAKL21 plays a positive regulatory role in maize disease resistance.

[0063] The present invention mainly achieves the above-mentioned objectives by adopting the following solutions:

[0064] This invention focuses on ZmWAKL21 in maize. A recombinant expression vector, pBECXUN-ZmWAKL21, for the ZmWAKL21 gene was constructed. This vector was then transformed into maize embryos using Agrobacterium-mediated genetic transformation, ultimately inducing callus formation. The selected Agrobacterium strain was EHA105. Transgenic maize seedlings were obtained, and the transgenic plants were identified. The expression level of the ZmWAKL21 gene in maize was detected using quantitative real-time PCR (qRT-PCR), yielding homozygous transgenic maize with stable inheritance in the T3 generation. Resistance to ZmWAKL21 transgenic maize was assessed by artificial inoculation with *Rust moniliforme*. The results showed that, compared to the wild-type control, transgenic maize plants overexpressing ZmWAKL21 significantly enhanced maize resistance to *Rust moniliforme* infection. This demonstrates that ZmWAKL21 overexpression in transgenic maize significantly enhances maize resistance to *Rust moniliforme* infection. The results not only show that ZmWAKL21 affects the infection efficiency of *Heterostilbene styracifolium*, but also lay the foundation for research on the interaction between maize and pathogenic fungi.

[0065] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0066] (1) This invention obtains a stable genetically inherited overexpressed transgenic maize ZmWAKL21 by overexpressing ZmWAKL21, and analyzes the resistance of this transgenic to maize southern rust disease. This helps to deepen our understanding of the interaction between pathogenic fungi and host plants, and enriches the molecular mechanism of the interaction between pathogenic fungi and maize.

[0067] (2) This invention studies the mechanism of action of ZmWAKL21 in fungal infection, and discovers the interaction between plants and pathogenic fungi, laying the foundation for further research on disease resistance theory. Attached Figure Description

[0068] Figure 1 The results show the relative expression level of ZmWAKL21 in transgenic maize overexpressing ZmWAKL21.

[0069] Figure 2 This study compares the disease symptoms of ZmWAKL21 overexpressing transgenic strains and wild-type strains after infection with *Russula multifiliis*.

[0070] Figure 3 The results of the leaf spore biomass detection experiment of ZmWAKL21 overexpression transgenic and control wild-type after infection with *Russula multiflora*. Detailed Implementation

[0071] This invention provides the application of the protein-coding gene ZmWAKL21 containing the WAK domain in maize in maize resistance to fungal diseases. The nucleotide sequence of the gene ZmWAKL21 is shown in SEQ ID No. 1.

[0072] SEQ ID No. 1:

[0073]

[0074] Furthermore, the amino acid sequence of the protein encoded by the gene ZmWAKL21 is shown in SEQ ID No. 2.

[0075] SEQ ID No. 2:

[0076] *

[0077] Furthermore, the biomaterial associated with the protein encoded by the gene ZmWAKL21 is any one of the following A1) to A12):

[0078] A1) The nucleic acid molecule that encodes the protein;

[0079] A2) An expression cassette containing the nucleic acid molecules described in A1);

[0080] A3) A recombinant vector containing the nucleic acid molecules described in A1);

[0081] A4) A recombinant vector containing the expression cassette described in A2);

[0082] A5) Recombinant microorganisms containing the nucleic acid molecules described in A1);

[0083] A6) Recombinant microorganisms containing the expression cassette described in A2);

[0084] A7) Recombinant microorganisms containing the recombinant vector described in A3);

[0085] A8) Recombinant microorganisms containing the recombinant vector described in A4);

[0086] A9) Transgenic plant cell lines containing the nucleic acid molecules described in A1);

[0087] A10) A transgenic plant cell line containing the expression cassette described in A2);

[0088] A11) Transgenic plant cell lines containing the recombinant vector described in A3);

[0089] A12) Transgenic plant cell lines containing the recombinant vector described in A4).

[0090] The specific application is in maize breeding resistant to Puccinia polysora, as detailed in Examples 1-4.

[0091] Example 1

[0092] This embodiment describes the construction of a maize ZmWAKL21 overexpression vector.

[0093] (1) Cloning of the maize ZmWAKL21 gene

[0094] Primers ZmWAKL21-F and ZmWAKL21-R were designed based on the open reading frame (ORF) of ZmWAKL21. The primer sequences are as follows:

[0095] ZmWAKL21-F: CCACCACCTATCCTTTCCTTCCT, as shown in SEQ ID No. 3;

[0096] ZmWAKL21-R: CAAGGCCTAAGTGACAGAACAAA, as shown in SEQ ID No. 4.

[0097] PCR amplification system: The reaction system (25 μL) is as follows:

[0098] 12.5 μL of 2×KOD ONE PCR Master Mix, 1 μL each of forward and reverse primers (10 μM), 1 μL of cDNA template, and 9.5 μL of ddH2O.

[0099] PCR amplification program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 56℃ annealing for 5 s, 68℃ extension for 15 s, 35 cycles; 68℃ final extension for 5 min.

[0100] The PCR product was recovered, ligated into the pCE2-T vector, single clones were selected, and sent for sequencing to obtain the correct pCE2-T-ZmWAKL21 recombinant plasmid, which was then sent to Tianjin Qingke Biotechnology Co., Ltd. for sequencing. A sequence of 2034 bp encoding 678 amino acids was obtained.

[0101] (2) Construction of overexpression vector

[0102] Primers with XcmI restriction sites were designed to amplify ZmWAKL21. The template used was the correctly sequenced pCE2-T-ZmWAKL21 plasmid. The pBECXUN vector was digested with XcmI enzyme for the construction of the binary expression vector pBECXUN for the ZmWAKL21 gene. The primer sequences are as follows:

[0103] pBECXUN-ZmWAKL21-F:AGATCTTCCAATACTTATGCAGACCACCGCC,as shown in SEQ ID No. 5;

[0104] pBECXUN-ZmWAKL21-R:

[0105] TCGGATCCCCAATACTCACTTGTCATCGTCGTCCTTGTAATCCTTGTCATCGTCGTCCTTGTAATCCTTGTCATCGTCGTCCTTGTAATCACTGCTGTTATGGGTAGTGG, as shown in SEQ ID No. 6.

[0106] PCR amplification system: The reaction system (25 μL) is as follows:

[0107] 12.5 μL of 2×KOD ONE PCR Master Mix, 1 μL each of forward and reverse primers (10 μM), 1 μL of cDNA template, and 9.5 μL of ddH2O.

[0108] PCR amplification program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 56℃ annealing for 5 s, 68℃ extension for 15 s, 35 cycles; 68℃ final extension for 5 min.

[0109] After digesting the pBECXUN vector with enzymes, the PCR products were recovered and ligated into the vectors respectively. Positive clones were selected and sequenced to confirm that the pBECXUN-ZmWAKL21 expression vector had been successfully constructed.

[0110] Example 2

[0111] This example illustrates maize genetic transformation.

[0112] 1. Preparation of Agrobacterium

[0113] Add 1 µL of plasmid to 50 µL of EHA105 Agrobacterium competent cells, mix thoroughly, and then transfer to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and then transfer to a 1.5 mL centrifuge tube. Incubate in a shaker at 30 °C and 180 rpm for 30 min. Inoculate 50 µL of the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30 °C for 48 h.

[0114] 2. Maize genetic transformation

[0115] 2.1 Disinfection and Embryo Retrieval

[0116] Remove the outer shell of the spikelet and place it in a container for sterilization. Take a sterilized 2mL EP tube, add the suspension to the tube, and collect the immature embryo.

[0117] 2.2 Agrobacterium infection and co-culture

[0118] Agrobacterium was picked into the infection solution to prepare OD. 600 Prepare a 0.2 μL Agrobacterium resuspension, aspirate the liquid from the EP tube, add the prepared Agrobacterium culture, and infect the embryos. Transfer the infected embryos and culture solution together into a co-culture medium, and aspirate the culture solution. Incubate at 25°C in the dark for 2-3 days.

[0119] 2.3 Callus induction and screening

[0120] After co-culture, the embryos were inoculated onto induction medium and cultured in the dark at 28°C for 7-10 days. The induced calluses were then inoculated onto selection medium for selection culture and cultured in the dark at 28°C for 2 weeks. The calluses that survived the first selection were then used for a second selection.

[0121] 2.4 Differentiation and Rooting

[0122] Embryogenic calluses that grew after screening were inoculated onto predifferentiation medium and cultured in the dark at 28°C for 10 days. The predifferentiated embryogenic calluses were then inoculated onto differentiation medium and cultured under light at 25°C until seedlings differentiated. The differentiated seedlings were then transferred to rooting medium and cultured under light at 25°C until the root system was fully developed. The developed seedlings were hardened off and transplanted into a greenhouse substrate to obtain the ZmWAKL21-OE transgenic lines ZmWAKL21-OE-1, ZmWAKL21-OE-2, and ZmWAKL21-OE-3, which overexpress the ZmWAKL21 gene.

[0123] Example 3

[0124] This example demonstrates a positive identification of a transgenic plant.

[0125] Total RNA was extracted from positive transgenic plants and reverse transcribed into cDNA, using the maize ZmEF1α gene as an internal control. Quantitative primers are shown in SEQ ID No. 7-10. The relative expression levels of the ZmWAKL21-OE transgenic lines ZmWAKL21-OE-1, ZmWAKL21-OE-2, and ZmWAKL21-OE-3, which overexpress the ZmWAKL21 gene, were significantly higher than the control. Figure 1 ).

[0126] qRT-ZmWAKL21-F: GACAAGAGCGACGTGTACAG, as shown in SEQ ID No. 7;

[0127] qRT-ZmWAKL21-R: CTGGCCAGGTTGACGTC, as shown in SEQ ID No. 8;

[0128] ZmEF1α-F: TGGGCCTACTGGTCTTACTACTGA, as shown in SEQ ID No. 9;

[0129] ZmEF1α-R: ACATACCCACGCTTCAGATCCT, as shown in SEQ ID No. 10.

[0130] Example 4

[0131] This embodiment involves artificial inoculation with multiple stalk rust fungi.

[0132] ZmWAKL21 transgenic maize and control maize were grown in a greenhouse until the four- to five-leaf stage. The suspension of *Russula multifiliis* spores was diluted to 1×10⁻⁶ with 0.01% Tween-20 solution. 6Spray the four- to five-leaf stage corn with spores / mL until the leaves are moist. After inoculation, the corn is cultured in the dark in a greenhouse for 12 hours at a temperature of 26°C and a humidity of 70% to 90%, and then cultured according to the normal photoperiod.

[0133] After disease onset, maize resistance to *Russula multifiliis* was determined by observing and detecting the biomass of *Russula multifiliis* spores on maize leaves. Eight circular leaf discs were uniformly collected from diseased maize leaves (using a 6 mm diameter perforator). DNA was extracted and uniformly diluted to 30 ng / μL as a template for qPCR quantitative analysis. Biomass was calculated using the CT values ​​obtained from qPCR and a standard curve. Three ZmWAKL21-OE transgenic lines (OE-1, OE-2, and OE-3) showed significant resistance to *Russula multifiliis* infection, such as... Figure 2 As shown. Further analysis of *Russula multifiliis* spore biomass on maize leaves revealed that the biomass of *Russula multifiliis* spores on leaves of the infected positive transgenic lines was significantly lower than that of the wild type, such as... Figure 3 As shown.

[0134] The primer sequences for qPCR biomass detection are as follows:

[0135] PPu-tub-qF: TTCCATCCCGAAACCTTG, as shown in SEQ ID NO.11;

[0136] PPu-tub-qR: ATCAATTCCTTCCCAACAGTA, as shown in SEQ ID NO.12.

[0137] Therefore, this invention successfully obtained transgenic maize resistant to multi-stalk rust fungus infection through transgenic methods, achieving unexpected technical results.

[0138] It should be understood that the specific examples and solutions described in this invention are given as examples for illustrative purposes only and are not intended to limit the invention. All further modifications or variations, including those within the spirit and scope of the invention, are considered to be covered within the scope of the invention.

Claims

1. The application of the maize protein-coding gene ZmWAKL21 containing the WAK domain in maize resistance to *Hemiberlesia lataniae*, characterized in that, The nucleotide sequence of the gene ZmWAKL21 is shown in SEQ ID No.

1.

2. The application of the protein-coding gene ZmWAKL21 containing the WAK domain in maize according to claim 1 in the resistance of maize to *Hemiberlesia lataniae*, characterized in that, The amino acid sequence of the protein encoded by the gene ZmWAKL21 is shown in SEQ ID No.

2.

3. The application of biomaterials related to the protein encoded by the gene ZmWAKL21 described in claim 2 in maize resistance to *Hemiberlesia lataniae*, characterized in that, The biomaterial associated with the protein encoded by the gene ZmWAKL21 is any one of the following A1) to A12): A1) The nucleic acid molecule that encodes the protein; A2) An expression cassette containing the nucleic acid molecules described in A1); A3) A recombinant vector containing the nucleic acid molecules described in A1); A4) A recombinant vector containing the expression cassette described in A2); A5) Recombinant microorganisms containing the nucleic acid molecules described in A1); A6) Recombinant microorganisms containing the expression cassette described in A2); A7) Recombinant microorganisms containing the recombinant vector described in A3); A8) Recombinant microorganisms containing the recombinant vector described in A4); A9) Transgenic plant cell lines containing the nucleic acid molecules described in A1); A10) A transgenic plant cell line containing the expression cassette described in A2); A11) Transgenic plant cell lines containing the recombinant vector described in A3); A12) Transgenic plant cell lines containing the recombinant vector described in A4).

4. The application of the maize protein-coding gene ZmWAKL21 containing the WAK domain according to claim 1 in maize resistance to *Hemiberlesia lataniae*, characterized in that, The specific application is in the treatment of multi-stalked rust fungus (… Puccinia polysora Application of ) in maize breeding.

5. A method for preparing transgenic maize resistant to *Rust hygroscopicus*, characterized in that, The process includes the following steps: Transforming starting maize into the ZmWAKL21 overexpression vector to obtain resistant transgenic maize, which, compared to the starting maize, exhibits multiple rust fungi (…). Puccinia polysora Resistance, the nucleotide sequence of the ZmWAKL21 gene is shown in SEQ ID No.

1.

6. The method for preparing transgenic maize resistant to *Rust hygroscopicus* according to claim 5, characterized in that, The specific steps include: (1) Cloning of the maize ZmWAKL21 gene; (2) Construction of overexpression vectors; (3) Agrobacterium transformation and callus induction culture; (4) Positive identification of genetically modified corn.

7. The method for preparing transgenic maize resistant to *Rust hygroscopicus* according to claim 6, characterized in that, The positive identification of the genetically modified corn includes the following steps: Total RNA was extracted from maize leaves of the test and control maize plants using the TRIzol method and reverse transcribed into cDNA. The maize ZmEF1α gene was used as an internal control, and ZmWAKL21 and ZmEF1α specific primers were used for detection. The relative gene expression levels were used to determine whether the maize plants were resistant.

8. The method for preparing transgenic maize resistant to *Rust hygroscopicus* according to claim 7, characterized in that, The specific primer sequences are as follows: qRT- ZmWAKL21-F GACAAGAGCGACGTGTACAG, as shown in SEQ ID No. 7; qRT-ZmWAKL21-R CTGGCCAGGTTGACGTC, as shown in SEQ ID No. 8; ZmEF1α-F TGGGCCTACTGGTCTTACTACTGA, as shown in SEQ ID No. 9; ZmEF1α-R ACATACCCACGCTTCAGATCCT, as shown in SEQ ID No.

10.

9. The method for preparing transgenic maize resistant to *Rust hygroscopicus* according to claim 7, characterized in that, The judgment method is as follows: if the relative expression level of the ZmWAKL21 gene in the maize plant to be tested is significantly higher than that in the control, then it is a resistant maize.

Images