Application of soybean MicroRNA172a in regulation and control of plant grain traits

Abstract

The invention provides an application of soybean MicroRNA172a in regulation and control of the traits of plant grains. The MicroRNA172a (miR172a) is as shown in SEQ ID NO: 2, and the pre-microRNA coding gene of the miR172a is as shown in SEQ ID NO: 1. According to the invention, soybean miR172a overexpression plants are obtained by taking soybean Jack as an acceptor material, and compared with wild soybean Jack, the seed protein contents of overexpression plants OE1, OE7, OE13 and OE17 are obviously higher than those of the acceptor Jack, and the oil content is reduced. Experiments prove that the miR172a related biological material provided by the invention can obviously improve the protein content of the seeds of plants, and has important significance for cultivating plant varieties with increased protein content of the seeds so as to improve the quality of crops.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to the application of soybean MicroRNA172a in regulating plant seed traits. Background Art

[0002] Soy protein is a plant protein. The amino acid composition of soy protein is similar to that of milk protein. Except for a slightly lower content of methionine, the other essential amino acids are relatively rich. It does not contain cholesterol, and the physiologically active substances isoflavones it contains have the effect of lowering cholesterol. Soy protein is close to human amino acids in genetic structure, so it is the most nutritious plant protein and is widely used in various food systems. In addition to being used to make soy milk and various soy products, it is also used as an additive for meat products, baked foods, dairy products, beverages, etc. because of its emulsifying properties. Therefore, increasing the protein content in soybean seeds is one of the main directions of soybean breeding.

[0003] MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides, which has a variety of important regulatory functions in cells. MicroRNA exists in many forms, the most primitive of which is pri-miRNA, which is about 300-1000 bases long; after one processing, pri-miRNA becomes pre-miRNA, or microRNA precursor, which is about 70-90 bases long; pre-miRNA is then cleaved by Dicer enzyme to become mature miRNA of about 20-24nt in length.

[0004] In plants, miRNA binds to the mRNA of the target gene under the action of RISC, and then regulates the gene by degrading mRNA or inhibiting translation. Each miRNA can have multiple target genes, and several miRNAs can also regulate the same gene. This complex regulatory network can regulate the expression of multiple genes through one miRNA, or finely regulate the expression of a gene through a combination of several miRNAs. It is known that miRNA in plants participates in plant reproductive development and floral organ differentiation by regulating the expression of genes related to flowering and floral organ development. Some miRNAs regulate plant development and stress tolerance. For example, lead stress response miRNA in corn is related to the plant's tolerance to lead stress; Bo Weiping et al. of Hainan University analyzed the differences in miRNAs in cassava under low temperatures. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to regulate plant seed traits.

[0006] In order to solve the above problems, the present invention provides a microRNA or a substance that regulates the expression of the microRNA encoding gene or a substance that regulates the activity or content of the microRNA for use in regulating plant grain traits, wherein the microRNA is miR172a, and the miR172a is a single-stranded RNA whose nucleotide sequence is SEQ ID NO: 3.

[0007] In the above application, the SEQ ID NO: 3 is specifically: 5'-agaaucuugaugaugcugcau-3'.

[0008] In the above application, the substance is pre-microRNA or a biological material related to the pre-microRNA or a biological material related to miR172a, and the pre-microRNA is a precursor microRNA of miR172a;

[0009] The biological material may be any of the following:

[0010] A1) a nucleic acid molecule encoding the pre-microRNA;

[0011] A2) a nucleic acid molecule encoding the miR172a;

[0012] A3) an expression cassette containing the nucleic acid molecule described in A1) or A2);

[0013] A4) a recombinant vector containing the nucleic acid molecule described in A1) or A2), or a recombinant vector containing the expression cassette described in A3);

[0014] A5) a recombinant microorganism containing the nucleic acid molecule described in A1) or A2), or a recombinant microorganism containing the expression cassette described in A3), or a recombinant microorganism containing the recombinant vector described in A3);

[0015] A6) a transgenic plant cell line containing the nucleic acid molecule described in A1) or A2), or a transgenic plant cell line containing the expression cassette described in A3);

[0016] A7) transgenic plant tissue containing the nucleic acid molecule described in A1) or A2), or transgenic plant tissue containing the expression cassette described in A3);

[0017] A8) A transgenic plant organ containing the nucleic acid molecule described in A1) or A2), or a transgenic plant organ containing the expression cassette described in A3).

[0018] The pre-microRNA may be a precursor microRNA.

[0019] In the above application, the pre-microRNA is a single-stranded RNA having a nucleotide sequence of SEQ ID NO: 2.

[0020] In the above application, the nucleic acid molecule described in A1) may specifically be a pre-microRNA gene.

[0021] In the above application, the pre-microRNA gene is the pre-miR172a coding chain of the miR172a, and the nucleotide sequence may be SEQ ID NO: 1: 5'-GTAGCATCATCAAGATTCACATGCAAGCGCAGGTGGTGGGTGGG ACTTGATGCAATCTAAGTGCTGTGCCAGCCAAGCCATAGGTCTTTTGGAACTGAGAATCTTGATGATGCTGCAT-3'.

[0022] In the above application, the pre-microRNA is the pre-miR172a of the miR172a, which may be a single-stranded RNA having a nucleotide sequence of SEQ ID NO: 2: 5'-GUAGCAUCAUCAAGAUUCACAUGCAAGCGCAGGUGGUGGGUGGGUGGGACUUGAUGCAAUCUAAGUGCUGUGCCAGCCAAGCCAUAGGUCUUUUUGGAACUGAGAAUCUUGAUGAUGCUG CAU-3'.

[0023] When using pre-miR172a to construct the recombinant plant expression vector described in A3), any enhanced promoter or constitutive promoter can be added before its transcription start nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, corn ubiquitin promoter (Ubiquitin), which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene.

[0024] Furthermore, among the biological materials, the recombinant microorganisms in A4) can specifically be yeast, bacteria, algae and fungi.

[0025] Furthermore, the recombinant microorganism may be Agrobacterium. The Agrobacterium may be GV3101.

[0026] Furthermore, among the biological materials, the plant tissues in A6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and / or anthers.

[0027] Furthermore, in the biological material, the transgenic plant organ described in A7) can be the root, stem, leaf, flower, fruit and seed of the transgenic plant.

[0028] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.) or chemical resistance marker genes (such as herbicide resistance genes), etc.

[0029] In the above application, the regulation of the expression of the gene encoding the microRNA or the regulation of the activity or content of the microRNA may be enhancement, improvement or upregulation.

[0030] The pre-miR172a can be obtained by artificially synthesizing a gene and then performing biological expression.

[0031] The regulating plant seed traits may be to increase the protein content of the plant seed, or to reduce the fatty acid content of the plant seed. The coding gene of the microRNA may be a DNA that can be transcribed by the microRNA.

[0032] The term "transcribable DNA" refers to DNA that can be transcribed into an RNA molecule.

[0033] Herein, unless otherwise defined herein, terms are to be understood according to conventional usage by one of ordinary skill in the relevant art.

[0034] The present invention also provides a method for regulating seed plant grain traits, the method comprising the step of regulating the seed plant grain traits by regulating the expression of the microRNA encoding gene in the target seed plant; the grain trait is protein content and / or fatty acid content.

[0035] The present invention also provides a method for producing seed plants with altered grain traits, the method comprising the steps of regulating the expression of the microRNA encoding gene in the target seed plant to obtain the seed plant with altered grain traits; the grain trait is protein content and / or fatty acid content.

[0036] In the above method, the change in grain traits may be an increase in grain protein content and / or a decrease in fatty acid content.

[0037] The method comprises introducing any of the above recombinant expression vectors containing pre-miR172a into target seed plant cells to obtain plants with high seed protein content.

[0038] By using any vector that can guide the expression of foreign genes in plants, the soybean pre-miR172a provided by the present invention is introduced into plant cells to obtain transgenic plants with high grain protein content. The expression vector carrying pre-miR172a can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, and the transformed plant tissues are cultivated into plants. The transformed plant host can be either a monocot or a dicot, such as soybean, Arabidopsis, rice, wheat, corn, cucumber, tomato, lawn grass, alfalfa, etc.

[0039] Regulating the expression of the gene encoding the microRNA in the target seed plant may be enhancing, increasing or upregulating.

[0040] In the above method, the seed plant contains the microRNA or the microRNA gene.

[0041] In the above, the seed plant may be any one of the following: B1) dicotyledonous plants, B2) Rosales plants, B3) Leguminosae plants, B4) Glycine max plants, and B5) soybean.

[0042] The present invention also provides a product, which is the above-mentioned microRNA or biological material.

[0043] This patent analyzes the function of soybean microRNA172a (miR172a) and shows that overexpression of pre-miR172a in soybean increases the seed protein content of transgenic plants. Experiments have shown that the plant seed protein content-related microRNA of the present invention can significantly increase the seed protein content of plants. The present invention is of great significance for cultivating plant varieties with increased seed protein content, thereby improving the quality of crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Schematic diagram of the plant expression vector pBin438-miR172a.

[0045] Figure 2 Molecular detection of miR172a overexpressing plants.

[0046] Figure 3 To detect the seed quality of plants overexpressing miR172a. DETAILED DESCRIPTION

[0047] The following examples were processed using SPSS11.5 statistical software, and the experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used, and P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a very significant difference.

[0048] The primers and nucleic acids used in the following examples were synthesized by Sanbo Biotechnology Co., Ltd.

[0049] The soybean material in the following embodiments: Glycine max (L.) Merr. cv Jack, recorded in the document “Jin-Song Zhang1, et al., A transcriptional regulatory module controls lipid accumulation in soybean, New Phytologist (2021), 231: 661-678”.

[0050] The plant binary expression vector pBin438 in the following examples was kindly donated by the laboratory of Academician Fang Rongxiang, Institute of Microbiology, Chinese Academy of Sciences; References: Li Taiyuan, Tian Yingchuan, Qin Xiaofeng, et al. Research on highly efficient insect-resistant transgenic tobacco [J]. Chinese Science (Series), 1994, 24(3): 276-282.

[0051] In the following examples, Agrobacterium GV3101 is described in the document “Lee CW et al., Agrobacterium tumefaciens promotes tumor induction by modulating pathogen defense in Arabidopsisthaliana, Plant Cell, 2009, 21(9), 2948-62)”.

[0052] The above biological materials are available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and are only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0053] Overexpression transgenic plant identification kit: Youlong Bio, CP4 EPSPS detection kit, catalog number: AA0832-LS.

[0054] Example 1. Obtaining transgenic pre-miR172a soybeans

[0055] 1.1 Cloning of soybean miR172

[0056] Our laboratory previously obtained some miRNA sequences and their target genes in soybean through RNA-Seq sequencing. A soybean miRNA library was established. Several miRNAs were selected and their biological functions were identified through transgenic technology. Among them, miR172a regulates the protein content of plant seeds.

[0057] According to the soybean miRNA database, the pre-miR172a gene sequence was obtained, containing 118 bp, and the per-miRNA172a sequence with homology arms was directly synthesized by Sanbo Biotechnology Co., Ltd. (the homology arm sequence is shown below). After delivery by the company, sequencing was confirmed. The pre-miR172a gene sequence is sequence 1 in the sequence table (SEQ ID NO: 1, 118 bp): 5'-GTAGCAT CATCAAGATTCACATGCAAGCGCAGGTGGTGGGTGGGACTTGATGCAATCTAAGTGCTGTGCCAGCCAAGCCAT AGGTCTTTTGGAACTGAGAATCTTGATGATGCTGCAT-3'.

[0058] Pre-miR172a is an RNA of sequence 2 (SEQ ID NO: 2), specifically as follows:

[0059] 5'-GUAGCAUCAUCAAGAUUCACAUGCAAGCGCAGGUGGUGGGUGGGACUUGAUGCAAUCUAAGUGCUGUGCCAGCCAAGCCAUAGGUCUUUUGGAACUGAGAAUCUUGAUGAUGCUGCAU-3'.

[0060] It corresponds to sequence 1 in the sequence table, except that thymine deoxynucleotide (T) in sequence 1 is replaced by uracil nucleotide (U), adenine deoxynucleotide (A) is replaced by adenine nucleotide (A), guanine nucleotide (G) is replaced by guanine deoxynucleotide (G), and cytosine deoxynucleotide (C) is replaced by cytosine nucleotide (C), and the rest are the same.

[0061] miR172a is obtained by shearing pre-miR172a. miR172a is a single-stranded RNA with the following nucleotide sequence:

[0062] 5'-agaaucuugaugaugcugcau-3' (corresponding to SEQ ID NO: 3, 21 nt).

[0063] 1.2 Construction of pre-miR172a overexpression plant vector

[0064] The plant expression vector used was the binary expression vector pBin438. Pre-miR172a was inserted into the vector by homologous recombination.

[0065] Homology arm F: 5'-CAATTACTGCAGGGATCCGTCGAC-3',

[0066] Homology arm R: 5′-CTTATCGTCGTCATCCTTGTAATC-3′.

[0067] The vector was double-digested with BamH I and Kpn I, and the sequence and vector were connected using homologous recombinase (seamless connection kit). The product was sequenced and confirmed. The plant expression vector obtained was: pBin438-per-miRNA172a ( Figure 1 pBin438-per-miRNA172a is a recombinant vector obtained by replacing the fragment between 5'-CAATTACTGCAGGGATCCGTCGAC-3' and 5'-CTTATCGTCGTCATCCTTGTAATC-3' of pBin438 with a double-stranded DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1, while keeping the other nucleotides of pBin438 unchanged.

[0068] 1.3 Molecular identification of plants overexpressing miRNA172a

[0069] A total of four plants overexpressing pBin438-pre-miR172, OE1, OE7, OE13 and OE17, were obtained. Total RNA of plants overexpressing pBin438-pre-miR172, OE1, OE7, OE13, OE17 and control Jack were extracted and reverse transcribed into cDNA. Using cDNA as a template, miR172a-F and miR172a-R were used as primers to analyze the expression of pre-miR172. Real-Time PCR reaction used CP4 EPSPS detection kit (Youlong Biology, catalog number AA0832-LS) and was operated according to the instructions. Primers used:

[0070] miRNA172a-qF: 5'-GGAGAATCTTGATGATGCTGCAT-3';

[0071] miRNA172a-qR: The kit (miRcute Plus miRNA qPCR Kit (SYBR Green)) comes with a reverse primer, with soybean GmTubulin gene as the internal standard, and the primers used are Primer-TF and Primer-TR.

[0072] Primer-TF: 5'-AACTCATTTCGTCCATTCCTTC-3';

[0073] Primer-TR: 5'-TTGAGTGGATTCCCAACAACG-3'.

[0074] The biological experiments were repeated three times, and the results were expressed as mean ± standard deviation.

[0075] Figure 2 The relative expression levels of miRNA172a in the control Jack and transgenic lines OE1, OE7, OE13 and OE17 were 0.029±0.015, 0.071±0.045, 0.043±0.009, 0.057±0.023 and 0.109±0.071, respectively. The relative expression level of miRNA172a in the miRNA172a overexpression lines was significantly higher than that in the control Jack.

[0076] Example 2: Identification of the phenotype of plants overexpressing pre-miR172

[0077] The seeds of T2 plants of the four transgenic events of OE1, OE7, OE13 and OE17 overexpressing pre-miR172 and the control Jack seeds were planted in greenhouse pots. The greenhouse conditions were: 16h light time, 11000Lux and 8h dark, 30 to 37℃ during the day and 25 to 28℃ at night, and the growth and development status was observed. The seeds were harvested on the 130th day. No significant differences were found in the phenotypes of OE1, OE7, OE13 and OE17 and the control Jack during the growth and maturity periods.

[0078] After the above-mentioned potted soybean seeds matured, the seeds harvested from each plant were dried at 37°C for one week, and the protein content in the seeds of the receptor control Jack and the transgenic lines OE1, OE7, OE13 and OE17 was measured. Fifteen plants were taken from each line, and the biological experiment was repeated three times. The results are expressed as mean ± standard deviation, and the One-way ANOVA test was used. P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates an extremely significant difference.

[0079] Determination of total protein content in seeds: Thermo Flash2000 organic element analyzer (Molecular Agriculture Center Platform, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) was used to determine seed protein. Soybean seeds were harvested at maturity, dried at 37°C for three days, and then fully dried at 65°C for another day. 0.004g of seeds were weighed for each sample and wrapped in a tin capsule. Based on the principle of the Dumas combustion method, the sample entered the combustion reaction tube through an automatic sampler, and further reacted after combustion to obtain the N element content in the sample. The measured value was multiplied by the conversion coefficient of 6.25 to obtain the crude protein content of the sample.

[0080] Determination of total oil content in seeds: Grind the dried seeds into powder, weigh 100 mg into a centrifuge tube, and weigh four portions in parallel. Add 500 μl of n-hexane, mix thoroughly, and incubate at 37°C overnight. Centrifuge slowly for 3 minutes, and aspirate the n-hexane into a new weighed tube. Continue to soak the remaining powder in n-hexane, then centrifuge, and then collect the n-hexane into the same centrifuge tube. Put the centrifuge tube into a vacuum pump, evacuate, and completely evaporate the n-hexane. Then weigh the centrifuge tube again. The change in weight before and after the centrifuge tube is the weight of the extracted lipids; the calculation formula for the total oil content (%) is total oil content (%) = (weight of extracted lipids / total weight of seeds × 100%).

[0081] In the above experiment, 15 seeds of each strain were taken, the experiment was repeated three times, and the results were expressed as mean ± standard deviation.

[0082] The statistical results of seed protein content are as follows Figure 3 As shown in A, the protein contents in the seeds of the recipient control Jack, OE1, OE7, OE13 and OE17 were 42.8±0.9, 46.8±1.0, 45.9±1.8, 44.1±1.9 and 49.7±1.3%, respectively. The protein contents in the seeds of the transgenic lines OE1, OE7, OE13 and OE17 were all significantly higher than those in the control Jack, with the protein contents of OE1, OE7, OE13 and OE17 seeds being 9.4, 7.2, 3.0 and 16.1% higher than those in the control, respectively.

[0083] The statistical results of seed oil content are as follows Figure 3 As shown in B, the oil content in the seeds of the receptor control Jack, OE1, OE7, OE13 and OE17 were 24.5±1.8, 19.7±1.3, 21.6±2.3, 22.7±1.5 and 17.7±0.9%, respectively. The oil content in the seeds of the overexpression lines OE1, OE7, OE13 and OE17 decreased by about 19.6, 8.8, 7.4 and 27.6% respectively compared with the control Jack, showing significant and extremely significant differences.

[0084] The above statistics show that three biological replicate experiments with 15 individual plants in each potted plant in the greenhouse of all materials showed that the seed protein content of the four strains OE1, OE7, OE13 and OE17 overexpressing pre-miR172 was significantly higher than that of the receptor Jack, indicating that miRNA172a positively regulates the protein content of soybean seeds, and increasing the expression of pre-miR172 can significantly increase the protein content of soybean seeds.

[0085] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of microRNA or a substance regulating the expression of a gene encoding the microRNA or a substance regulating the activity or content of the microRNA in regulating plant seed traits, characterized in that: The microRNA is miR172a, and the miR172a is a single-stranded RNA whose nucleotide sequence is SEQ ID NO:

3.

2. The use according to claim 1, characterized in that: The substance is pre-microRNA or a biological material related to the pre-microRNA or a biological material related to miR172a, and the pre-microRNA is a precursor microRNA of miR172a; The biological material is any of the following: A1) a nucleic acid molecule encoding the pre-microRNA; A2) a nucleic acid molecule encoding the miR172a according to claim 1; A3) an expression cassette containing the nucleic acid molecule described in A1) or A2); A4) a recombinant vector containing the nucleic acid molecule described in A1) or A2), or a recombinant vector containing the expression cassette described in A3); A5) a recombinant microorganism containing the nucleic acid molecule described in A1) or A2), or a recombinant microorganism containing the expression cassette described in A3), or a recombinant microorganism containing the recombinant vector described in A3); A6) a transgenic plant cell line containing the nucleic acid molecule described in A1) or A2), or a transgenic plant cell line containing the expression cassette described in A3); A7) transgenic plant tissue containing the nucleic acid molecule described in A1) or A2), or transgenic plant tissue containing the expression cassette described in A3); A8) A transgenic plant organ containing the nucleic acid molecule described in A1) or A2), or a transgenic plant organ containing the expression cassette described in A3).

3. The use according to claim 2, characterized in that: The pre-microRNA is a single-stranded RNA whose nucleotide sequence is SEQ ID NO:

2.

4. The use according to claim 2 or 3, characterized in that: A1) The nucleic acid molecule is a pre-microRNA gene.

5. The use according to claim 4, characterized in that: The nucleotide sequence of the coding strand of the pre-microRNA gene is SEQ ID NO:

1.

6. A method for regulating seed plant grain traits, characterized in that: The method comprises the step of regulating the seed plant grain traits by regulating the expression of the microRNA coding gene in the target seed plant; the seed plant grain trait is protein content and / or fatty acid content.

7. A method for producing seed plants with altered grain traits, characterized in that: The method comprises the steps of regulating the expression of the coding gene of the microRNA in the target seed plant to obtain the seed plant with changed grain traits; the grain trait is protein content and / or fatty acid content.

8. The method according to claim 6 or 7, characterized in that The seed plant contains the mic roRNA or the microRNA gene.

9. The use according to claims 1-5 or the method according to claims 6-8, characterized in that: The seed plant is any one of the following: B1) Dicotyledonous plants, B2) Plants of the order Rosales, B3) Leguminosae, B4) soybean plants, B5)Soybeans.

10. A product, characterized in that The product is the microRNA described in claim 1 or the biological material described in claim 2.

Images