Application of soybean Caiosin coding gene GmCLO1

Abstract

The invention discloses an application of a soybean Caiosin coding gene GmCLO1 (Gamma Cellosin 1). The invention discloses application of the soybean Caiosin coding gene GmCLO1 as shown in SEQ ID NO.1 in genetic engineering transformation of the resistance of soybeans to prodenia litura and the oil content of seeds. By inhibiting the expression of the gene, the resistance of soybeans to prodenia litura can be remarkably improved, meanwhile, the oil content of seeds is reduced, and the oil content of the seeds is remarkably improved by improving the expression of the gene. The soybean Caiosin coding gene GmCLO1 disclosed by the invention can be transformed into soybeans through genetic engineering, and the resistance of the soybeans to prodenia litura and the oil content of seeds are finally regulated and controlled.

Description

Technical Field

[0001] The invention relates to application of soybean Caleosin encoding gene GmCLO1 and belongs to the field of genetic engineering. Background Art

[0002] Soybean is an important food and oil crop, rich in plant protein and fat that is beneficial to humans and animals. However, during the growth and development of soybeans, they are often harmed by various herbivorous animals, which seriously affects the yield and quality of soybeans. Spodoptera litura is one of the main leaf-feeding pests in the soybean producing areas in southern my country. It feeds on various tissues of soybeans. Although the application of chemical pesticides can reduce insect pests to a certain extent, it also pollutes the environment. Therefore, using genetic engineering to overexpress or knock out endogenous genes to cultivate new insect-resistant varieties is one of the important measures for soybean pest control.

[0003] GmCLO1 encodes a soybean caleosin protein (caleosin), which contains a caleosin conserved domain and belongs to the soybean caleosin family. Caleosin has three regions: a hydrophilic N-terminal domain, a specific and highly conserved hydrophobic core domain, and a hydrophobic C-terminal α-helical domain. As a protein associated with oil bodies, caleosin can be detected in vegetative tissues in addition to the surface of plant seeds. They are associated with the endoplasmic reticulum, chloroplast vacuoles and envelopes. Some studies have found that caleosin not only affects lipid metabolism and oil body stability, but also plays a certain role in stress response. The use of RNAi technology in soybean seed oil bodies reduced the content of a 24kDa caleosin, accompanied by an increase in the content of caleosin, reflecting the compensatory mechanism of caleosin to maintain oil body stability. In Arabidopsis, embryos of AtCLO1 mutant seeds at the germination stage showed a significant delay in the decomposition of storage lipids, distorted vacuolar morphology, abnormal internalization of the vacuolar membrane, and significantly reduced interactions between vacuoles. In addition, the Ca2+ binding EF-hand motif at the N-terminus of caleosin suggests a role for this protein in environmental adaptation. AtCLO3, a leaf caleosin isoform with Ca2+-dependent protein kinase activity, is strongly induced under abiotic stresses such as drought, high salinity, and ABA, suggesting that this protein may be involved in stress signal transduction. In addition, a rice Caleosin gene OsCLO5 has been reported to negatively regulate cold tolerance through the JA signaling pathway. The presence of multiple heme-binding motifs in caleosin indicates that it can bind heme and has peroxygenase (PXG) function. In plants, peroxidases catalyze the hydroxylation and epoxidation of unsaturated fatty acids by transferring an oxygen atom from hydrogen peroxide to the corresponding substrate, thereby oxidizing them. The peroxidase activity of caleosin is involved in the oxylipin signaling pathway and plant defense response. Some caleosin proteins, such as AtCLO1-4 from Arabidopsis, have been identified as calcium-binding heme oxygenases with peroxidase activity. In addition to being induced by abiotic stress, AtCLO3 is also enhanced by pathogens, indicating that it also plays a role in biotic stress responses. However, there are few reports on the Caleosin family in the field of soybean oil content and insect resistance. Summary of the invention

[0004] The purpose of the present invention is to disclose the insect-resistant and high-oil genetic engineering application of soybean Caleosin gene GmCLO1. GmCLO1 gene is expressed in all soybean tissues and is induced by Spodoptera litura stress. Overexpression of GmCLO1 gene in soybean increases the oil content of soybean seeds, while knocking out GmCLO1 gene using CRISPR / Cas9 technology reduces the oil content of seeds and improves the resistance of soybean to Spodoptera litura.

[0005] GmCLO1 is used as the target gene through genetic engineering to overexpress or inhibit its expression level, thereby changing the insect resistance and seed oil content of soybean.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The soybean Caleosin encoding gene GmCLO1 is used in genetic engineering soybean resistance to Spodoptera litura and seed oil content. The soybean Caleosin encoding gene GmCLO1 has a coding region sequence as shown in SEQ ID NO.1 and an amino acid sequence as shown in SEQ ID NO.2.

[0008] In soybean, overexpression of the GmCLO1 gene increased the oil content of seeds, while knocking out the GmCLO1 gene using CRISPR / Cas9 technology increased soybean resistance to Spodoptera litura.

[0009] Beneficial Effects

[0010] GmCLO1 is a soybean Caleosin gene that regulates soybean seed oil content and transgenic soybean resistance to Spodoptera litura. Expression analysis showed that GmCLO1 was mainly expressed in various soybean tissues, and was first upregulated and then downregulated in leaves after insect induction. Genetic transformation revealed that the GmCLO1 gene regulates transgenic soybean resistance to Spodoptera litura and positively regulates seed oil content of transgenic soybean. Therefore, GmCLO1 can be used as a target for regulating soybean resistance to Spodoptera litura and seed oil content, and can be used for soybean insect resistance and seed oil content modification. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 .Agarose gel electrophoresis after PCR cloning of GmCLO1. Target fragment size 615bp. Marker: DL2000

[0012] Figure 2 .Tissue expression pattern of GmCLO1. N=3.

[0013] Figure 3 .GmCLO1 is induced in response to Spodoptera litura stress. Changes in the expression of GmCLO1 in soybean leaves at different time points after insect induction (N=3).

[0014] Figure 4.Positive identification of T3 generation overexpression transgenic plants and relative expression level of GmCLO1. (A) PCR detection of target genes in T3 generation transgenic soybean lines. Partial vector sequence and GmCLO1 CDS sequence were amplified using specific detection primers. Marker: DL2000. P: positive plasmid. (B) Expression level detection of GmCLO1 gene in different lines (n=3). The relative expression level is the expression level relative to the control after normalization with tubulin gene (relative expression level in CK=1). OE-2 and OE-17 represent two GmCLO1 gene overexpression lines, respectively. **: P<0.01 level is significant. ***: P<0.001 level is significant.

[0015] Figure 5 . Editing types of the GmCLO1 gene in homozygous and vector-lost knockout lines. CK: Jack, KO#2 and KO#6: 2 gmclo1 mutant lines.

[0016] Figure 6 .Identification of T2 generation gmclo1 mutant strains for resistance to Spodoptera litura. (A) Average larval weights of S. litura after feeding on control and transgenic leaves for 0, 2, 3, and 5 days (n=5). CK: Jack, KO#2 and KO#6: two T2 generation gmclo1 mutant strains. **: significant at the P<0.01 level. Error bars represent ±SD. (B) Representative photos of S. litura at 0d and 5d. Scale bar=1 cm. CK: wild type; KO#2 and KO#6: two T2 generation gmclo1 mutant strains.

[0017] Figure 7 .Oil content of T3 transgenic soybean seeds. N≥8. CK: wild type; KO#2 and KO#6: two gmclo1 mutant lines; OE-2 and OE-17 represent two GmCLO1 gene overexpression lines. *: significant at P<0.05; **: significant at P<0.01; ***: significant at P<0.001. Error bars represent ±SD. DETAILED DESCRIPTION

[0018] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0019] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0020] Example 1 Expression pattern of soybean GmCLO1 gene

[0021] 1) Cloning of the soybean caleosin gene GmCLO1

[0022] The leaves of soybean variety Jack were taken and ground with a mortar, added to a 1.5 mL EP tube containing lysis solution, and after sufficient shaking, total RNA was extracted (Total RNA Kit (Tiangen, Beijing, China), and the RNA quality and concentration were determined using a spectrophotometer. Total RNA was used as a template and reverse transcription was performed according to the instructions of the reverse transcription kit (HiScript III 1st Strand cDNA Synthesis Kit, Vazyme, Nanjing, R123-01) provided by Vazyme, Japan, to obtain the first strand of cDNA. According to Phytozome The gene mRNA sequence of GmCLO1 in the v12 soybean database (Glyma.09g123800) was used to design specific primers, and PCR amplification was performed using the cDNA obtained above as a template. The PCR program was as follows: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 15 seconds, 58°C annealing for 15 seconds, 72°C extension for 40 seconds, a total of 35 cycles, and finally 72°C incubation for 5 minutes, followed by constant temperature at 4°C. After the PCR product was cut and purified, connected to T vector and transformed into Escherichia coli, a positive single clone was selected for sequencing. After sequencing, the CDS sequence of the soybean GmCLO1 gene with a complete coding region was obtained, wherein the coding region sequence is shown in SEQ ID NO.1, with a length of 615bp ( Figure 1 The amino acid sequence is shown in SEQ ID NO.2. The primer sequences for amplifying the gene are F: atggcttcttcaccttcctcag and R: ctacttctctttgcctgaagagtg.

[0023] 2) Tissue expression analysis of GmCLO1

[0024] In order to identify the expression level of GmCLO1 in different tissues, roots, stems and leaves of Jack V3, flowers of R2, seeds and pods of R6 were collected, frozen in liquid nitrogen and stored in a -80℃ refrigerator for later use. Total RNA of each tissue was extracted and reversed into cDNA. GmCLO1 fluorescence quantitative primers were designed, with the sequences of F: ttttgctgtccgttggaggt and R: tgtttgccgcgttggatatt, and the expression of GmCLO1 gene in each tissue was detected. Soybean gene Tubulin was used as an internal reference, with the primer sequences of F: ggagttcacagaggcagag and R: cacttacgcatcacatagc. Real-time fluorescence quantitative PCR reaction was performed with cDNA of each tissue as template.

[0025] GmCLO1 is expressed in all tissues, with the highest expression in flowers and the lowest expression in seeds. The expression levels in roots, stems, leaves, and pods are similar ( Figure 2 ).

[0026] 3) Expression analysis of GmCLO1 under the induction of Spodoptera litura stress

[0027] The Spodoptera litura was placed on the inverted three leaves of Jack V4, two at each plant. After biting for 2 hours, when the leaves showed obvious damage, the larvae were removed to complete the induction. Fresh leaves were picked at eight time points: 1h, 6h, 12h, 1d, 2d, 3d, 5d, and 7d after induction. The control group was leaves at the same time point that were not induced by Spodoptera litura. The leaves were quickly frozen in liquid nitrogen and stored at -80℃. (Total RNA extraction is the same as step 1). The total RNA obtained from the above-mentioned induced group and control group samples was used as a template, reversed into cDNA, and real-time fluorescence quantitative PCR reaction (Real-time RT-PCR) was performed. The GmCLO1 fluorescence quantitative primer sequence and the internal reference gene Tubulin primer sequence are the same as step 2.

[0028] After soybean leaves were treated with Spodoptera litura, the expression level of GmCLO1 increased significantly 1 hour after Spodoptera litura induction, and decreased significantly 1, 2, and 3 days after feeding. The expression levels at 5 and 7 days after feeding did not change much compared with the control ( Figure 3 ). These results indicate that GmCLO1 is induced by Spodoptera litura stress and may be involved in the plant's defense response to Spodoptera litura.

[0029] Example 2 Genetic Engineering Application of Gene GmCLO1

[0030] 1) Construction of plant overexpression vectors and knockout vectors

[0031] When constructing the overexpression vector, the CDS sequence of GmCLO1 was amplified from Jack cDNA with linker primers GmCLO1-pBA-F and GmCLO1-pBA-R (sequences of F: ccgggcccaggcctacgcgtatggcttcttcaccttcctcag and R: cgatcggggaaattcgagctcctacttctctttgcctgaagagtg), and the pBA002 vector was double-digested at the same time. The CDS sequence of GmCLO1 was integrated into the pBA002 vector by homologous recombination. The correctly sequenced plasmid was named pBA002-GmCLO1 and transformed into Agrobacterium EHA105. The sequencing primer sequences were F: gctcctacaaatgccatcattgc and R: gtataattgcgggactctaa. The plant transformation vector pBA002 contains the strong CaMV 35S promoter, which can strongly induce the expression of the target gene GmCLO1 in the recipient.

[0032] When constructing the knockout vector, three targeting sites of GmCLO1 were designed online through the website (http: / / cbi.hzau.edu.cn / crispr) according to the genomic sequence of GmCLO1, and the designed sgRNA target sites were inserted into the plant CRISPR / Cas9 expression vector pSC1. The sgRNA sequences were: sgRNA1: ggagagaaacccattccact; sgRNA2: aagatggtgtcatctaccca; sgRNA3: gttgcgtgaaatcgggactg. The intermediate vectors pGmU3 and pGmU6 were used to construct the sgRNA backbone: sgRNA1-sgRNA3-sgRNA2-sgRNA3, which was inserted between the NcoI and XbaI restriction sites of the pSC-M vector to construct a recombinant vector named pSC1-GmCLO1, and pSC1-GmCLO1 was transformed into Agrobacterium tumefaciens EHA105.

[0033] 2) Genetic transformation of soybean with plant overexpression vectors and knockout vectors

[0034] Jack seeds were sterilized with chlorine gas in a fume hood for 6 h, and then germinated in SG4 solid medium for one night. The seed coats of the beans that had germinated overnight were removed, the seeds were split in half, part of the hypocotyl was removed, and 7-8 wounds were made in the leaf axils.

[0035] At the same time, prepare the infection liquid. The Agrobacterium tumefaciens liquid containing the pBA002-GmCLO1 or pSC1-GmCLO1 recombinant vector is shaken at 28℃, 200rpm to an OD600 value of 0.8-0.9, centrifuged at 4000rpm for 10min, discarded the supernatant, and then resuspended in CCM solution to an OD600 value of about 0.5-0.6. The prepared explants are placed in the liquid, infected at 28℃, 140-150rpm for 30-40min, and then the explants are taken out and spread on CCM solid culture medium with the wound facing down, and placed at 25℃ for co-culture for 4-5d. Then the explants are washed with sterilized ultrapure water and Wish-Liquid, and then the explants are inserted obliquely at 45℃ into SIM culture medium without glufosinate, and cultured at 26℃ for 15d to induce germination. After 15 days, the large buds are cut off and replaced with SIM culture medium with 6mg / L glufosinate to induce germination. After two weeks, the cotyledons and yellow leaves were removed and replaced with SEM medium with 4 mg / L glufosinate. Then, subculture was performed in a 15-day cycle, and the dose of glufosinate was gradually reduced. When the buds of the explants grew to about 6 cm, the clustered buds were transferred to the rooting medium and cultured for about 10 days, and the induced roots were visible. After the root system grew well, it was transplanted into the sterilized mixed nutrient soil and placed in an artificial incubator (16h light / 8h dark, 25°C) for growth.

[0036] QuickStix PAT / bar transgenic test strips were used for T0 generation positive detection. Overexpression positive seedlings were positively identified at the DNA level in the subsequent generations. The detection primers were F: gctcctacaaatgccatcattgc and R: ctacttctctttgcctgaagagtg. Real-time fluorescence quantitative PCR reaction (Real-time RT-PCR) results showed that compared with the control, the expression level of the GmCLO1 gene in the transgenic materials was significantly increased, among which the expression level of the OE-2 strain increased by about 700 times, and the expression level of the OE-17 strain increased by about 180 times ( Figure 4 ). The sequences of the fluorescent quantitative primers and the internal reference gene Tubulin primers are the same as those in step 2. A small amount of leaves were taken from the offspring of the knockout transgenic lines to extract DNA, and PCR was performed for sequencing analysis to detect the editing form of the target gene. The sequencing results of the individual plants tested in the T3 generation transgenic soybean KO#2 and KO#6 lines all showed a single peak and the sequence was changed, indicating that the target gene was homozygous edited, and individual plants with sequence changes and vector loss (Cas9-free) were screened in both lines. The editing forms were KO#2 (sgRNA1 (-1bp deletion) / sgRNA3 (-40bp deletion)), KO#6 (sgRNA1 (-1bp deletion) / sgRNA2 (-16bp deletion) / sgRNA3 (18-bp deletion)) ( Figure 5 ).

[0037] There are two pairs of sequencing primer sequences. The first pair of primer sequences are F: tggcttcttcaccttcctca and R: cagttcagtggtaacattccgc; the second pair of primer sequences are F: aggcttggccgctttatt and R: ggggataaagagagttacggga.

[0038] 3) Evaluation of insect resistance of transgenic soybean

[0039] The 3rd instar Spodoptera litura with the same growth status were selected, and the forced feeding test was carried out after starvation treatment for 2 hours. Leaves from the same period and the same part of the gmclo1 mutant and the recipient plant were placed in different plastic culture jars. Four worms were placed in each jar and fed for six days. The worms were weighed before feeding (0d) and 2d, 3d and 5d after feeding. The culture jar was cleaned and fresh leaves were put in each weighing. At least five independent replicates were set for each genotype. The average weight of single-headed worms was counted and calculated using Excel. The average worm weight of Spodoptera litura was used as the resistance identification index, and the two-tailed t-test was used for statistical analysis.

[0040] The results showed that compared with the control, the average insect weight of Spodoptera litura showed a decreasing trend after feeding on transgenic leaves for 3 days. After feeding on KO#2 and KO#6 leaves for 5 days, the average insect weight of Spodoptera litura was significantly reduced, indicating that knocking out the GmCLO1 gene improved the resistance of soybean plants to Spodoptera litura ( Figure 6 ).

[0041] 4) Determination of oil content in transgenic soybean seeds

[0042] T3 plants were planted in a net house and T4 seeds were harvested. The seeds were placed in a 28°C oven and the oil content of the seeds was measured using a near-infrared spectrometer one week later. Compared with the control, knocking out the GmCLO1 gene significantly reduced the oil content of soybean seeds, with the KO#2 line decreasing by 6.91%, while overexpressing the GmCLO1 gene significantly increased the oil content of soybean seeds, with the OE-17 line increasing by 7.48% ( Figure 7 ).

Claims

1. Application of soybean Caleosin encoding gene GmCLO1 in genetic engineering to modify soybean resistance to Spodoptera litura and / or soybean seed oil content.

2. Application of inhibiting the expression of soybean Caleosin encoding gene GmCLO1 in constructing soybean varieties with resistance to Spodoptera litura. The coding region sequence of the soybean Caleosin encoding gene GmCLO1 is shown in SEQ ID NO.

1.

3. Application of overexpression of soybean Caleosin encoding gene GmCLO1 in increasing the oil content of soybean seeds, wherein the coding region sequence of the soybean Caleosin encoding gene GmCLO1 is shown in SEQ ID NO.1.

Images