HPV whole genome stable strain and preparation method and application thereof

Abstract

The invention discloses an HPV whole genome stable strain as well as a preparation method and application thereof, and relates to the field of gene recombination. The invention provides a method for constructing an HPV (human papillomavirus) whole genome stable strain by utilizing a PiggyBac transposon system. The sequence of an HPV whole genome is shown as SEQ ID NO. 2. The HPV whole genome stable strain obtained by the method has high stability and high copy number, and can be used as an HPV genome cell quality control product.

Description

Technical Field

[0001] The present invention belongs to the field of gene recombination, relates to a full-genome HPV genome, and specifically relates to a full-genome stable HPV strain and a preparation method and application thereof. Background Art

[0002] Human Papilloma Virus (HPV) is a group of spherical, tiny, non-enveloped circular double-stranded DNA viruses belonging to the genus Papillomavirus of the family Papovaviridae. It mainly infects the skin and mucosal tissues and can cause warts, benign tumors and cancer. The diameter of HPV virus particles is about 55nm, the nucleocapsid is icosahedral symmetrical, and there are 72 capsomers. HPV is a small DNA virus with no envelope and a double-stranded closed circular DNA genome of 7.2-8kb. The genome is divided into three functional regions: ① Early region (E): about 4.5kb, containing 6 subregions of E1, E2, E4-E7: ② Late region (L), about 2.5kb containing two subregions of L1L2: Long regulatory region (LCR), located between the end of L region and the beginning of E region, generally 800-900bp. E1 is involved in viral replication, and its encoded protein has ATP-dependent helicase activity; E2 is involved in transcriptional regulation, and the protein encoded by E3 is the main viral transcription factor; E4 encodes a late cytoplasmic protein, which is related to viral maturation; E5 has weak transformation activity:

[0003] E6 and E7 are mainly related to cell transformation and tumorigenicity: the L region encodes two proteins, L1 is the main species-specific antigen, and L2 is the type-specific antigen. L1 or L1 / L2 can be assembled into virus-like particles in eukaryotic cells: LCR, also known as URR, contains DNA replication and expression regulatory elements. The expression of viral genes is regulated by transcription factors of the virus and host cells, including E2, LCR and intracellular trans-regulatory factors. Their changes can cause overexpression of transformation proteins and cause tumors. According to the latest statistics from the International Human Papillomavirus Reference Center, more than 200 HPV genotypes have been discovered. According to the carcinogenic potential of each subtype, HPV is usually divided into two categories: high-risk and low-risk. High-risk HPV infection can cause male and female genital cancer, cervical cancer, etc. Almost all cervical squamous cell carcinomas and more than 85% of cervical adenocarcinomas are caused by HPV infection. A large number of studies have confirmed that 18 subtypes, including HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82, are the most common high-risk HPVs.

[0004] The real-time fluorescence quantitative PCR method based on polymerase chain reaction technology is currently the most widely used technology for HPV-DNA detection. This technology refers to the addition of a specific fluorescent probe at the same time as a pair of primers during PCR amplification. The probe is an oligonucleotide with a reporter fluorescent group and a quencher fluorescent group labeled at both ends. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; during PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme will enzymatically degrade the probe, separating the reporter fluorescent group and the quencher fluorescent group, so that the fluorescence monitoring system can receive the fluorescent signal, that is, every time a DNA chain is amplified, a fluorescent molecule is formed, achieving complete synchronization between the accumulation of the fluorescent signal and the formation of the PCR product.

[0005] Compared with ordinary PCR, the experimental results of real-time fluorescence PCR are more intuitive and more real-time. Real-time fluorescence PCR is detected by adding fluorescent groups to the PCR system and relying on the accumulation of fluorescent signals. The experimental results are absolutely quantitative with standard curves and Ct values. A study compared the application of the second-generation hybrid capture method and fluorescent PCR in the clinical detection of human papillomavirus. According to the experimental results, the two different detection methods have a good correlation with high-risk cervical cancer lesions, but fluorescent PCR has more advantages in sensitivity and specificity. In addition, the total positive detection rate of real-time fluorescent PCR is also higher in the study. This suggests that fluorescent PCR can be used as an effective detection method for clinical detection, providing a basis for the effective detection of human papillomavirus.

[0006] Transposition is a phenomenon of genetic material rearrangement mediated by mobile elements. In the chromosomes of bacteria, viruses and eukaryotic cells, there is a DNA fragment that can move in the genome. This phenomenon is called transposition. The transposase encoded on the transposon controls the transposition process, and transposition does not require extensive homology between the transposon and its target site. Transposition can be divided into two categories: replicative transposition and non-replicative transposition. In replicative transposition, the entire transposon is replicated and then transferred to a new location in the genome. Two enzymes are involved: transposase and resolvase. Transposase acts on the end of the original transposon, and resolvase processes the replicated copy. For example, TnA-type transposition is mainly of this form. In non-replicative transposition, the original transposon is directly moved as a mobile entity without the need for a replication process. Only the action of the transposase is required, and the transposon at the original position is excised and inserted into the new position. For example, IS, Mu and Tn5 all transpose in this way. The biological significance of transposition includes causing insertion mutations, generating new genes, causing chromosome aberrations, and promoting biological evolution.

[0007] HPV testing samples are usually collected from the human cervix to extract the genome and then use DNA testing to identify whether there is HPV infection. When conducting DNA testing experiments, the positive standard is mostly HPV genome plasmid or genome, which cannot normally monitor the process of HPV sample genome extraction. Therefore, it is very necessary to introduce cell genome quality control products, which can monitor the entire process of HPV sample extraction and subsequent DNA testing experiments.

[0008] Prior art CN116286982A discloses a positive reference for HPV genotyping detection, and its preparation method and application, wherein the positive reference for HPV genotyping detection is obtained by co-transducing a recombinant expression vector containing the full genome sequence of HPV and a FLP recombinase vector into HEK293T-FRT cells containing a single copy of a FRT site sequence, and then by drug screening and single cell cloning screening, and the resulting monoclonal stable transfection cell line containing the full genome sequence of HPV is the positive reference for HPV genotyping detection. The disadvantage of this technology is that two recombinant vectors are required to co-transduce the target cells, the steps are cumbersome, and the transformation efficiency is low.

[0009] Prior art CN117625845A discloses a method for preparing a quality control product of a full-length human papillomavirus genome. This technology constructs the HPV full genome into a recombinant plasmid, and transfects the recombinant plasmid into a human cervical cancer cell line by electrofection; then single clones are selected and identified to obtain a human cervical cancer cell line that has been successfully transfected with the recombinant plasmid. The disadvantages of this technology are that electrofection easily causes mutations, resulting in cytotoxicity, the instrument operation is complicated, and the conversion efficiency is low. Summary of the invention

[0010] The present invention aims to solve the problems of complicated steps and low transformation efficiency in the prior art, and provides a stable HPV whole genome strain and its preparation method and application. The present invention uses the PiggyBac transposon system to construct a stable HPV whole genome strain. The HPV whole genome stable strain obtained by the method has high stability and high copy number, and can be used as a quality control product for HPV genome cells.

[0011] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0012] In one aspect, the present invention provides a method for preparing a stable HPV full genome strain, comprising the following steps:

[0013] S1, expression plasmid construction, cloning the HPV full genome into the vector plasmid;

[0014] S2, cell transfection, co-transfecting the expression plasmid and the auxiliary plasmid constructed in step S1 into the host cells;

[0015] S3, screening and identification, drug screening step S2 transfected host cells, obtain HPV full genome stable strains;

[0016] The sequence of the HPV complete genome is shown in SEQ ID NO.2.

[0017] Specifically, the vector plasmid in step S1 can be a PiggyBac transposon plasmid.

[0018] Preferably, the PiggyBac transposon plasmid may further include a marker gene.

[0019] Further preferably, the marker gene is the Puro gene.

[0020] More preferably, the sequence of the Puro gene is as shown in SEQ ID NO.1.

[0021] Specifically, the auxiliary plasmid in step S2 is a Super PiggyBac Transposase plasmid.

[0022] Specifically, the host cells in step S2 include but are not limited to: HEK293 cells, BHK21 cells, CHO cells, Hela cells or Vero cells.

[0023] Preferably, the host cell may be a HEK293 cell.

[0024] Further preferably, the host cell may be a HEK293T cell.

[0025] Specifically, the HPV full genome is one of the following HPV subtype full genomes: HPV6, HPV11, HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV42, HPV43, HPV44, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, HPV CP8304 and HPV82.

[0026] In another aspect, the present invention provides a stable HPV full genome strain obtained by the aforementioned preparation method.

[0027] In yet another aspect, the present invention provides a kit comprising the aforementioned HPV full genome stable strain.

[0028] Specifically, the kit is a kit for detecting HPV nucleic acid or a kit for preparing HPV genotyping.

[0029] More specifically, the kit also includes a DNA extraction reagent and an amplification reagent.

[0030] In yet another aspect, the present invention provides the use of the aforementioned HPV whole genome stable strain or kit in the preparation of cell genome quality control products.

[0031] Specifically, the application is a non-disease diagnosis or treatment application.

[0032] In yet another aspect, the present invention provides a method for detecting HPV in vitro for purposes other than disease diagnosis, wherein the method utilizes the aforementioned HPV full genome stable strain or kit for detection.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] 1. The piggyBac transposon system was used for the first time to construct a stable HPV full-genome strain, achieving stable expression and high copy number with simple steps and high efficiency.

[0035] 2. The constructed HPV whole genome stable strain can be used for HPV whole genome cell quality control products, realizing the full process quality control of HPV sample extraction and subsequent DNA detection experiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Plasmid map of PB-MCS-puro.

[0037] Figure 2 PB-HPV33-gDNA plasmid map.

[0038] Figure 3 HPV33-L1 gene standard copy number standard curve.

[0039] Figure 4 HPV33-E7 gene standard copy number standard curve.

[0040] Figure 5 HPV whole genome cell quality control product stability test. DETAILED DESCRIPTION

[0041] It is worth noting that the raw materials used in the present invention are all common commercial products, and their sources are not specifically limited. In order to make the technical means, creative features, purpose and efficacy of the present invention easy to understand, the present invention is further explained in conjunction with specific embodiments below, but the following embodiments are only preferred embodiments of the present invention, not all. Based on the embodiments in the implementation mode, other embodiments obtained by those skilled in the art without making creative work belong to the protection scope of the present invention. In the following embodiments, unless otherwise specified, the operating methods used are all conventional operating methods, the equipment used are all conventional equipment, and the equipment and materials used in each embodiment are the same.

[0042] Example 1: Construction of HPV full genome plasmid

[0043] (1) The sequences shown in Table 1 were obtained by whole genome synthesis.

[0044] Table 1 Synthetic sequences

[0045] Synthetic sequence name Sequence Description Sequence number Puro Puro Gene SEQ ID NO.1 HPV33-gDNA HPV33 full genome SEQ ID NO.2

[0046] SEQ ID NO.1 (Puro gene):

[0047] ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCCGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGACCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTAG;

[0048] SEQ ID NO.2 (HPV33 full genome):

[0049]

[0050] (2) Using piggyBac target gene plasmid as a vector (purchased from Miaoling, catalog number P44092), a linearized vector was obtained by PCR and the Neo gene (SEQ ID NO. 3) was removed. The linearized piggyBac target gene vector plasmid was connected to the Puro gene (SEQ ID NO. 1) by homologous recombination to obtain the PB-MCS-puro plasmid. The map is shown in Figure 1 shown.

[0051] SEQ ID NO.3:

[0052]

[0053] (3) The PB-MCS-Puro plasmid was double-digested with XbaI and BamHI to obtain a linearized vector. The linearized PB-MCS-Puro was connected to the HPV33 genome (SEQ ID NO. 2) by homologous recombination to obtain the PB-HPV33-gDNA plasmid. The map is shown in Figure 2 shown.

[0054] Example 2: Construction of a stable HPV full genome strain

[0055] (1) Cultivate 293T cells (purchased from ATCC, catalog number CRL-3216). Observe the status of 293T cells under a microscope before transfection. If the density is about 90%, there is no mycoplasma and the growth status is good, the cells can be plated in 2 wells of a 12-well plate. 2 wells are used as the control group, and 1 well is used for transfection of the experimental group.

[0056] (2) Before transfection, each well of the 12-well plate was replaced with 1 mL of DMEM medium (purchased from Gibco, catalog number 11965092) containing 2% FBS serum (purchased from Gibco, catalog number 26010074) to reduce the effect of serum on plasmid transfection;

[0057] (3) Experimental groups and plasmid dosage Table 2 (the Super PiggyBac Transposase plasmid in Table 2 was purchased from Miaoling Biotechnology Co., Ltd., with a catalog number of P0179):

[0058] Table 2 Transfection system

[0059]

[0060]

[0061] (4) Add the required amount of plasmids and 1×PEI (purchased from HARVEYBIO, catalog number 49553-93-7) listed in Table 2 into the corresponding 1.5 mL EP tube containing 200 μL 1×PBS, add the plasmid first and mix well, then add 1×PEI and mix well, let stand for 15 min to obtain the transfection mixture;

[0062] (5) The transfection mixture was added dropwise to a 12-well plate, and the medium was replaced with 1 mL of DMEM medium containing 2% FBS serum 8 hours after transfection;

[0063] (6) 24 hours after transfection, the cells of the experimental group and the control group were subcultured to six-well plates for culture. At 48 hours after transfection, a control group was selected and not subjected to drug killing. The cells of this group were collected and stored at -80°C. At the same time, 3.5ug / mL of puro (puromycin) was added to the experimental group and another control group for drug killing. The drug killing was repeated for three rounds of 48h each. After three rounds of drug killing, the cells of the experimental group were collected and stored at -80°C (the addition of puro to the cells of the control group for screening is mainly used to indicate whether the screening drug has failed).

[0064] Example 3: Determination of the copy number of HPV whole genome cell quality control

[0065] (1) The genome of the non-drug-killing control group and the experimental group in Example 2 was extracted according to the process of the blood / cell / tissue genomic DNA extraction kit (purchased from Tiangen, catalog number DP304), and the ddH20 elution volume was 55 μL.

[0066] (2) Genome and copy number standard curves qPCR was performed using a one-step qPCR kit (purchased from Novozymes, AceQ Universal SYBR qPCR Master Mix, catalog number: Q511-01).

[0067] (3) The qPCR primer sequences used to detect HPV33 genome L1 and E7 are as follows:

[0068] Table 3 Primer sequences

[0069]

[0070] (4) The concentration of the copy number standard curve is set as follows:

[0071] Table 4 Standard curve copy number

[0072]

[0073]

[0074] (5) The 20 μL reaction system for qPCR is as follows:

[0075] Table 5 Reaction system

[0076] name Dosage 2×AceQ Universal SYBR GPCR Master Mix 10μL Forward primer (10 μM) 0.4μL Reverse primer (10 μM) 0.4μL Template RNA 2μL Double distilled water 7.2μL

[0077] Prepare the reaction system of the test sample and the standard curve on ice according to the reaction system in Table 5 and mix well.

[0078] (6) The qPCR reaction procedure is as follows:

[0079] Table 6 qPCR reaction procedure

[0080]

[0081] According to the program in Table 6, set up the qPCR reaction program to perform qPCR reaction, and export the data for analysis to obtain the standard curve for the copy number of the HPV33-L1 gene standard (see Figure 3 ) and the standard curve for the copy number of HPV33-E7 gene standard (see Figure 4 ). The genome extracted from the experimental group was subjected to qPCR assay, and the results were calculated in combination with the standard curve and the formula as shown in Table 7, indicating that the copy number of the HPV33 whole genome in the HPV whole genome stable strain prepared in Example 2 was 2.72E+7 copies / mL.

[0082] Table 7 qPCR detection of stable HPV whole genome strains

[0083]

[0084]

[0085] Example 4: HPV Whole Genome Cell Quality Control Stability Test

[0086] After the three-round drug-killed stable strain in Example 2 was constructed, its stability from 12 days to 28 days of passage was tested. The stable strain was plated in a six-well plate. When the passage reached 12 days, 1 / 2 of the cells in the six-well plate were collected and stored in a -80°C refrigerator. Thereafter, the cells were passaged every 4 days and 1 / 2 of the cells were collected and stored in a -80°C refrigerator until the cells were received for 28 days. The genomes of the cells at 12 days, 16 days, 20 days, 24 days, and 28 days were extracted according to the method in Example 3, and then the expression of the L1 gene was detected by qPCR, and the fluctuation of the Ct value from 12 days to 28 days was observed. Figure 5 The fluctuation of Ct value shown is not large, indicating that the cell quality control product has good stability within one month.

[0087] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A method for preparing a stable HPV full genome strain, characterized in that: The following steps are involved: S1, expression plasmid construction, cloning the HPV full genome into the vector plasmid; S2, cell transfection, co-transfecting the expression plasmid and the auxiliary plasmid constructed in step S1 into the host cells; S3, screening and identification, drug screening step S2 transfected host cells, obtain HPV full genome stable strains; The sequence of the HPV complete genome is shown in SEQ ID NO.

2.

2. The preparation method according to claim 1, characterized in that: The vector plasmid in step S1 is a PiggyBac transposon plasmid.

3. The preparation method according to claim 1, characterized in that: The auxiliary plasmid in step S2 is the SuperPiggyBac Transposase plasmid.

4. The preparation method according to claim 1, characterized in that: The host cells in step S2 include HEK293 cells, BHK21 cells, CHO cells, Hela cells or Vero cells.

5. The preparation method according to any one of claims 1 to 4, characterized in that: The HPV full genome is one of the following HPV subtype full genomes: HPV6, HPV11, HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV42, HPV43, HPV44, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, HPV P8304 and HPV82.

6. A stable HPV full genome strain, characterized in that: The method is obtained by the preparation method according to any one of claims 1 to 5.

7. A kit, characterized in that: Including the HPV full genome stable strain as described in claim 6.

8. The kit according to claim 7, characterized in that The kit is an HPV nucleic acid detection kit or an HPV genotyping kit.

9. Use of the HPV full genome stable strain according to claim 6 or the kit according to any one of claims 7 to 8 in preparing cell genome quality control products, characterized in that: The application is non-disease diagnosis or treatment application.

10. A method for detecting HPV in vitro for non-disease diagnosis purposes, characterized in that: The method uses the HPV full genome stable strain described in claim 6 or the kit described in any one of claims 7-8 for detection.

Images