Construction method and application of recombinant oncolytic vaccinia virus carrying IL-15 / R alpha sushi gene

Abstract

The invention discloses a construction method and application of a recombinant oncolytic vaccinia virus carrying an IL-15 / R [alpha] suushi gene, and the construction method comprises the following steps: constructing plasmids pcDNA3.1-IL-15 / R [alpha] suushi, constructing plasmids pBATK-IL-15 / R [alpha] suushi, constructing plasmids px459-TK-gRNA, and carrying out recombination to obtain an oncolytic vaccinia virus VV-delta BVT-IL-15 / R [alpha] suushi carrying the IL-15 / R [alpha] suushi gene, the application includes application in products such as drugs, pharmaceutical raw materials and targeted inhibitors, the construction method provides reference for research of solid tumors, especially provides a new thought and method for research of colon cancer, and the oncolytic vaccinia virus constructed by adopting the method can have a remarkable inhibition effect on colon cancer cells, and can be used for preparing a new oncolytic vaccinia virus. Therefore, a technical basis is provided for research on medicines for treating colon cancer.

Description

Technical Field

[0001] The present invention relates to a method for constructing a recombinant oncolytic vaccinia virus and an application thereof, and more specifically, to a method for constructing a recombinant oncolytic vaccinia virus carrying an IL-15 / Rαsushi gene and an application thereof, belonging to the technical field of molecular biology. Background Art

[0002] The application of vaccinia virus (VV) in tumor immunotherapy mainly depends on its biological characteristics and application history. It has a double-stranded DNA genome structure, can encode about 250 genes, and can accommodate up to 50kb of exogenous genes. Its huge viral structure provides more selection space and transformation potential for carrying exogenous genes. Vaccinia virus mainly replicates and assembles in the cytoplasm, which fundamentally avoids the behavior of viral DNA invading the cell nucleus and contaminating the host genome, making it a potential virus for oncolytic immunotherapy. Vaccinia virus has four special virus particle forms, including internal mature virus (IMV), internal encapsulated virus (IEV), cell-associated encapsulated virus (CEV) and external encapsulated virus (EEV). Among them, EEV has unique advantages in long-distance transmission and in vivo diffusion in the host body, fast transmission speed, and stronger resistance to neutralizing antibodies than IMV. Studies have shown that vaccinia virus is an improved virus with anti-tumor effects, which mainly exerts anti-tumor effects by activating and regulating immune cells and long-term anti-tumor immune responses. For example, VVLΔTKΔN1L-mIL21 can effectively activate CD4+T cells and improve the survival rate of mice in a mouse colon cancer tumor model after treatment. It also significantly increases the concentration of CD4+ and CD8+T cells in the colon cancer tumor model and regulates the tumor immune microenvironment. VVLΔTKΔN1L-mIL21 prevents the recurrence of CMT93 tumors by inducing the formation of neutral memory T cells and maintains long-term anti-tumor immune response. VG9-IL-24 also induces apoptosis by activating apoptosis signaling pathways, such as activating PKR (protein kinase R), thereby phosphorylating the downstream target p38 MAPK (mitogen-activated protein kinase), thereby stimulating the MAPK signaling pathway, and inhibiting the phosphorylation of STAT3 (signal transducer and activator 3). Summary of the invention

[0003] The purpose of the present invention is to combine IL-15 / Rαsushi and oncolytic vaccinia virus to provide a method for constructing a recombinant oncolytic vaccinia virus carrying the IL-15 / Rαsushi gene and its application, which has the technical characteristics of providing new ideas and methods for the study of colorectal cancer and providing a technical basis for the research of drugs for the treatment of colon cancer.

[0004] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0005] The present invention provides a method for constructing a recombinant oncolytic vaccinia virus carrying an IL-15 / Rαsushi gene, the construction method comprising the following steps:

[0006] Step 1): construct the plasmid pcDNA3.1-IL-15 / Rαsushi carrying the IL-15 / Rαsushi gene;

[0007] Specifically, step 1-1): synthesizing IL-15 / Rαsushi;

[0008] Step 1-2): connecting the IL-15 / Rαsushi to pcDNA3.1 to obtain the pcDNA3.1-IL-15 / Rαsushi;

[0009] Step 2): constructing a plasmid pBATK-IL-15 / Rαsushi carrying the IL-15 / Rαsushi; wherein the plasmid pBATK is a special plasmid, and its particularity lies in: a two-bit EGFP expression frame with loxP sites is inserted into the plasmid, so as to facilitate the observation during the screening of the target virus and delete the EGFP expression frame when the screening is completed for the preparation of anti-tumor drugs;

[0010] Step 3): px459-TK-gRNA, pBATK-IL-15 / Rαsushi, and pcDNA3.1-IL-15 / Rαsushi were transfected into HEK293A cells and infected with VV-ΔBV oncolytic vaccinia virus. After packaging, the recombinant oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi carrying the IL-15 / Rαsushi gene was obtained.

[0011] Among them, the plasmid px459-TK-gRNA is a plasmid constructed using CRISPR / Cas9 technology for knocking out the vaccinia virus genome J2R (TK) and subsequent C11R and B8R, and is a specially constructed plasmid in the technical means of this application.

[0012] Preferably, IL-15 / Rαsushi is a fusion protein gene sequence, which connects the human IL-15 sequence (synthetic) to the sushi domain (IL-15Rαsushi) sequence (synthetic) of the human IL-15 receptor α subunit through the designed flexible linker protein (GGGGS) 3, and adds a His tag protein sequence before the terminator at the end of IL-15Rαsushi, denoted as IL15-Linker-IL15Rαsushi-His.

[0013] The base sequence of the IL-15 / Rαsushi gene is SEQ ID NO: 1:

[0014] .

[0015] Preferably, the step 2) further comprises the following sub-steps (wherein each parameter is a necessary technical feature for constructing the plasmid clone and the recombinant virus, and if it is separated from the numerical parameter, the technical effect will inevitably not be achieved):

[0016] Step 2-1): performing high-fidelity PCR on the pcDNA3.1-IL-15 / Rαsushi to amplify IL-15 / Rαsushi;

[0017] Step 2-2): digest the pBATK vector with EcoRI and XhoⅠ;

[0018] Step 2-3): At 40-55°C, the amplified IL-15 / Rαsushi was connected to the enzyme-cut pBATK for 10-20 min, and then transformed into the competent DH5α to obtain the plasmid pBATK-IL-15 / Rαsushi carrying IL-15 / Rαsushi.

[0019] Preferably, the high-fidelity PCR reaction system in step 2-1) includes: KOD Newbuffer (5 μL), 2 mM dNTPs (5 μL), 25 mM MgSO 4 (3 μL), upstream primer (1.5 μL), downstream primer (1.5 μL), template (2 μL), KOD enzyme (1 μL), ddH 2 O to add volume to 50 μL; high-fidelity PCR reaction program is: 94℃~96℃2~3min; 96~98℃10~30s, 55~60℃15~30s, 65~70℃20~30s, a total of 35~40 cycles, and finally 68℃7min.

[0020] In step 2-3), two PCR amplification products and the enzyme-cut pBATK vector were first recovered by gel electrophoresis at a concentration of 0.5-2% for 20-35 min, and then the two gel-cutting recovered products were connected by a seamless cloning kit according to a preset molar mass ratio, and then the connection products were transformed into competent DH5α, cultured, and extracted to obtain pBATK-IL-15 / Rαsushi carrying the IL-15 / Rαsushi plasmid.

[0021] Preferably, the molar mass ratio of the two rubber tapping recovery products is pBATK:IL-15 / Rαsushi=1:3.

[0022] Preferably, the step 3) further comprises the following sub-steps:

[0023] Step 3-1): transfect px459-TK-gRNA into HEK293A cells;

[0024] Step 3-2): Infect HEK293A cells with VV-ΔBV oncolytic vaccinia virus;

[0025] Step 3-3): pBATK-IL-15 / Rαsushi and pcDNA3.1-IL-15 / Rαsushi were then transfected into the HEK293A cells in step 3-2), and VV-ΔBVT-IL-15 / Rαsushi was obtained after culture.

[0026] Preferably, the transfection reagent for px459-TK-gRNA in step 3-1) and pBATK-IL-15 / Rαsushi in step 3-3) can be any one of lipo3000, lipo8000, and PEI; wherein, the ratio of the transfection reagent to the px459-TK-gRNA in step 3-1) and step 3-3) is any one of 5:1, 4:1, 3:1, and 2:1, and the transfection time is 3-6h; the ratio of the transfection reagent to the px459-TK-gRNA in step 3-3) is any one of 5:1, 4:1, 3:1, and 2:1, and the transfection time is 3-6h; the MOI of the VV-ΔBV oncolytic vaccinia virus in step 3-2) is 0.1-10, and the infection time of the VV-ΔBV oncolytic vaccinia virus is 1-6h.

[0027] The present invention discloses a method for constructing a recombinant oncolytic vaccinia virus carrying an IL-15 / Rαsushi gene and its application in preparing an anti-colon cancer product. The product includes a drug, a pharmaceutical raw material or a targeted inhibitor.

[0028] Preferably, the medicament comprises an oncolytic vaccinia virus vaccine.

[0029] Preferably, the medicament comprises pharmaceutically acceptable excipients.

[0030] Preferably, the auxiliary material may be any one or more of an osmotic pressure regulator, a lyoprotectant, a surfactant, a buffer, and an excipient.

[0031] Beneficial effects: The method for constructing an oncolytic vaccinia virus carrying IL-15 / Rαsushi of the present invention provides a reference for the study of solid tumors, especially provides new ideas and methods for the study of colon cancer. According to the specific embodiments, VV-ΔBVT-IL-15 / Rαsushi constructed by the method described in the present application can have a significant inhibitory effect on colon cancer cells, thereby providing a technical basis for the research on drugs for the treatment of colon cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Schematic diagram of the genome structure of oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi carrying the IL-15 / Rαsushi gene.

[0033] Figure 2 This is a diagram of the high-fidelity PCR reaction results in Example 1.

[0034] Figure 3 This is one of the verification result diagrams of pBATK-IL-15 / Rαsushi in Example 1.

[0035] Figure 4This is the second figure of the verification results of pBATK-IL-15 / Rαsushi in Example 1.

[0036] Figure 5 This is one of the results of identification of the recombinant oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi and wild-type virus in Example 1.

[0037] Figure 6 This is the second figure of the identification results of the recombinant oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi and the wild virus identification results in Example 1.

[0038] Figure 7 This is the third figure of the identification results of the recombinant oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi and the wild virus identification results in Example 1.

[0039] Figure 8 This is a graph showing the survival rate of colon cancer cell line SW480 after virus infection detected by the MTT method in Example 1.

[0040] Fig. 9 This is a graph showing the survival rate of colon cancer cell line HCT-116 after virus infection detected by the MTT method in Example 1.

[0041] Fig.10 This is a graph showing the results of the MTT method test of the toxicity of oncolytic vaccinia virus and PBMC cells co-incubated with colon cancer cells in Example 1.

[0042] Fig.11 This is a graph showing the effect of injection of VV-ΔBVT-IL-15 / Rαsushi on the volume of colon cancer-bearing mice in Example 1.

[0043] Fig.12 This is a graph showing the effect of VV-ΔBVT-IL-15 / Rαsushi injection on the body weight of mice in Example 1.

[0044] Fig.13 This is a diagram showing the HE staining results of various tissues of mice after virus infection in Example 1.

[0045] Fig.14 This is a diagram showing the CD4 immunohistochemical staining results of mouse tumors after virus infection in Example 1.

[0046] Fig.15 This is a comparison chart of the GFP staining results of mouse tumors after virus infection in Example 1.

[0047] Figure 2 The middle is the PCR product of IL-15 / Rαsushi sequence; Figure 3 The middle is the result of double digestion with EcoRⅠ and XhoⅠ; Figure 4The middle is the PCR result diagram; Figure 5 The middle is the PCR product of IL-15 / Rαsushi sequence; Figure 6 The middle is the identification result of TK, VGF, and B8R of the vaccinia virus genome. VV-ΔBVT-IL-15 / Rαsushi was successfully deleted at the above vaccinia virus genome sites; Figure 7 The middle is the fluorescence identification result.

[0048] The experimental data of each group in the above figure were statistically analyzed using GraphPadPrism 9 software to compare the data differences between different groups. The experimental data are expressed in the form of mean ± SD. If p < 0.05, a significant difference is marked, where p < 0.05 is marked with *, p < 0.01 is marked with **, p < 0.001 is marked with ***, and p < 0.0001 is marked with ****. All experiments were repeated three times. DETAILED DESCRIPTION

[0049] The present invention will be further described below in conjunction with the accompanying drawings of the specification, but the present invention is not limited to the following embodiments. In the present application, the left endpoint value, the middle value, the right endpoint value and any value within the range of the range value can be used in the specific embodiments. However, it should be understood that the embodiments are only exemplary and do not limit the scope of the present invention.

[0050] The present invention creatively combines IL-15 / Rαsushi and oncolytic vaccinia virus to achieve a strong anti-tumor ability against tumor cells, providing a reference for the study of solid tumors, especially providing new ideas and methods for the study of colon cancer. The oncolytic vaccinia virus constructed using the technical solution of the present application has a significant inhibitory effect on colon cancer cells, thereby providing a technical basis for the research of drugs for the treatment of colon cancer.

[0051] The content involving the use of VV-ΔBVT in this application is one of the creative technical points of this application. According to actual needs, experimental data on the killing of pancreatic cancer, liver cancer and lung cancer cells by VV-ΔBVT can be obtained experimentally. This application will not provide a detailed description here.

[0052] like Figure 1-15 The figure shows a specific embodiment of a method for constructing a recombinant oncolytic vaccinia virus carrying an IL-15 / Rαsushi gene and its application. The embodiment shows a method for constructing a recombinant oncolytic vaccinia virus carrying an IL-15 / Rαsushi gene and its application. The construction method comprises the following steps:

[0053] Step 1): synthesize IL-15 / Rαsushi, and connect IL-15 / Rαsushi to pcDNA3.1 to obtain plasmid pcDNA3.1-IL-15 / Rαsushi;

[0054] The base sequence of the IL-15 / Rαsushi gene in this application is SEQ ID NO:1:

[0055] ATGAGAATTTCGAAACCACATTTGAGAAGTATTTCCATCCAGTGCTACTTGTGTTTACTTCTAAACAGTCATTTTCTAACTGAAGCTGGCATTCATGTCTTCATTTTGGGCTGTTTCAGTGCAGGGCTTCCTAAAACAGAAGCCAACTGGGTGAATGTAATAAGTGATTTGAAAAAAATTGAAGATCTTATTCAATCTATGCATATTGATGCTACTTTATATACGGAAAGTGATGTTCACCCCAGTTGCAAAGTAACAGCAATGAAGTGCTTTCTCTTGGAGTTACAAGTTATTTCACTTGAGTCCGGAGATGCAAGTATTCATGATACAGTAGAAAATCTGATCATCCTAGCAAACAACAGTTTGTCTTCTAATGGGAATGTAACAGAATCTGGATGCAAAGAATGTGAGGAACTGGAGGAAAAAAATATTAAAGAATTTTTGCAGAGTTTTGTACATATTGTCCAAATGTTCATCAACACTTCTCAAGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCATCACGTGCCCTCCCCCCATGTCCGTGGAACACGCAGACATCTGGGTCAAGAGCTACAGCTTGTACTCCAGGGAGCGGTACATTTGTAACTCTGGTTTCAAGCGTAAAGCCGGCACGTCCAGCCTGACGGAGTGCGTGTTGAACAAGGCCACGAATGTCGCCCACTGGACAACCCCCAGTCTCAAATGCATTAGATGA。

[0056] Step 2): Construct the plasmid pBATK-IL-15 / Rαsushi carrying the said IL-15 / Rαsushi;

[0057] Specifically comprising: step 2-1) performing high-fidelity PCR on pcDNA3.1-IL-15 / Rαsushi to amplify IL-15 / Rαsushi; the high-fidelity PCR reaction system includes: KOD Newbuffer (5μL), 2mM dNTPs (5μL), 25mM MgSO 4 (3 μL), upstream primer (1.5 μL), downstream primer (1.5 μL), template (2 μL), KOD enzyme (1 μL), ddH 2 O was added to the volume to 50 μL; the high-fidelity PCR reaction program was as follows: 94°C-96°C for 2-3 min; 96-98°C for 10-30 s, 55-60°C for 15-30 s, 65-70°C for 20-30 s, for a total of 35-40 cycles, and finally 68°C for 7 min;

[0058] Step 2-2) digest the pBATK vector with EcoRI and XhoⅠ;

[0059] Step 2-3) at 40-55°C (e.g., any one of 40°C, 43°C, 45°C, 47°C, 50°C, 52°C, and 55°C), the amplified IL-15 / Rαsushi is connected to the digested pBATK for 10-20 min (e.g., any one of 10 min, 12 min, 15 min, 17 min, and 20 min), and then transformed into competent DH5α to obtain the plasmid pBATK-IL-15 / Rαsushi carrying IL-15 / Rαsushi;

[0060] Specifically, the method comprises: firstly performing electrophoresis on agarose gel at a concentration of 0.5-2% (such as any one of 0.5%, 0.7%, 1.0%, 1.3%, 1.5%, 1.7%, and 2.0%) for 20-35 minutes (such as any one of 20 minutes, 25 minutes, 30 minutes, and 35 minutes) to recover two PCR amplification products and the pBATK vector cut by enzymes by gel tapping, and then connecting the two gel tapping recovery products by a seamless cloning kit according to a preset molar mass ratio, and then transforming the connection products into competent DH5α, culturing, extracting, and obtaining pBATK-IL-15 / Rαsushi carrying the IL-15 / Rαsushi plasmid; the molar mass ratio of the two gel tapping recovery products is pBATK:IL-15 / Rαsushi=1:3;

[0061] Step 3): px459-TK-gRNA, pBATK-IL-15 / Rαsushi, and pcDNA3.1-IL-15 / Rαsushi are transfected into HEK293A cells, and infected with VV-ΔBV oncolytic vaccinia virus, and the recombinant oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi carrying the IL-15 / Rαsushi gene is obtained after packaging;

[0062] Specifically comprising: step 3-1) transfecting px459-TK-gRNA into HEK293A cells;

[0063] Step 3-2) Infect HEK293A cells with VV-ΔBV oncolytic vaccinia virus;

[0064] In step 3-3), pBATK-IL-15 / Rαsushi was transfected into the HEK293A cells in step 3-2), and VV-ΔBVT-IL-15 / Rαsushi was obtained after culture.

[0065] In the above, the transfection reagent for px459-TK-gRNA in step 3-1) and pBATK-IL-15 / Rαsushi in step 3-3) can be any one of lipo3000, lipo8000, and PEI (preferably PEI); the ratio of transfection reagent to px459-TK-gRNA in step 3-1) and step 3-3) is any one of 5:1, 4:1, 3:1, and 2:1 (preferably 4:1), and the transfection time is 3-6h (such as 3h, 4h, 5h, and 6h can be used); The ratio of the transfection reagent to px459-TK-gRNA in step 3-3) is any one of 5:1, 4:1, 3:1, and 2:1 (preferably 4:1), and the transfection time is 3-6h (such as 3h, 4h, 5h, and 6h); in step 3-2), the MOI of the VV-ΔBV oncolytic vaccinia virus is 0.1-10 (such as 0.1, 0.5, 1, 2, 5, and 10), and the infection time of the VV-ΔBV oncolytic vaccinia virus is 1-6h (such as 1h, 2h, 3h, 4h, 5h, and 6h).

[0066] The present invention discloses a method for constructing a recombinant oncolytic vaccinia virus carrying an IL-15 / Rαsushi gene and its application in preparing an anti-colon cancer product. The product includes a drug, a pharmaceutical raw material, a drug intermediate, or a targeted inhibitor.

[0067] Preferably, the medicament comprises an oncolytic vaccinia virus vaccine.

[0068] Preferably, the medicament comprises pharmaceutically acceptable excipients.

[0069] Preferably, the auxiliary material can be any one or more of an osmotic pressure regulator, a lyoprotectant, a surfactant, a buffer, and an excipient. Among them, the osmotic pressure regulator includes sucrose, trehalose, mannitol, and sorbitol; the lyoprotectant includes trehalose and sucrose; the buffer includes histidine, citric acid, succinic acid, acetate, or phosphate; the surfactant includes polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350.

[0070] Example 1

[0071] Construction of oncolytic vaccinia virus VV-ΔBVT-IL-15 / 15 / Rαsushi carrying IL-15 / Rαsushi

[0072] 1.1 Construction of plasmid pBATK-IL-15 / Rαsushi

[0073] 1.1.1 Construction of plasmid pcDNA3.1-IL-15 / Rαsushi

[0074] IL-15 / Rαsushi was synthesized according to IL-15 / Rαsushi (SEQ ID NO: 1), and then ligated into plasmid pcDNA3.1 to obtain pcDNA3.1-IL-15 / Rαsushi.

[0075] The base sequence of the IL-15 / Rαsushi gene is SEQ ID NO: 1:

[0076] ATGAGAATTTCGAAACCACATTTGAGAAGTATTTCCATCCAGTGCTACTTGTGTTTACTTCTAAACAGTCATTTTCTAACTGAAGCTGGCATTCATGTCTTCATTTTGGGCTGTTTCAGTGCAGGGCTTCCTAAAACAGAAGCCAACTGGGTGAATGTAATAAGTGATTTGAAAAAAATTGAAGATCTTATTCAATCTATGCATATTGATGCTACTTTATATACGGAAAGTGATGTTCACCCCAGTTGCAAAGTAACAGCAATGAAGTGCTTTCTCTTGGAGTTACAAGTTATTTCACTTGAGTCCGGAGATGCAAGTATTCATGATACAGTAGAAAATCTGATCATCCTAGCAAACAACAGTTTGTCTTCTAATGGGAATGTAACAGAATCTGGATGCAAAGAATGTGAGGAACTGGAGGAAAAAAATATTAAAGAATTTTTGCAGAGTTTTGTACATATTGTCCAAATGTTCATCAACACTTCTCAAGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCATCACGTGCCCTCCCCCCATGTCCGTGGAACACGCAGACATCTGGGTCAAGAGCTACAGCTTGTACTCCAGGGAGCGGTACATTTGTAACTCTGGTTTCAAGCGTAAAGCCGGCACGTCCAGCCTGACGGAGTGCGTGTTGAACAAGGCCACGAATGTCGCCCACTGGACAACCCCCAGTCTCAAATGCATTAGATGA。

[0077] 1.1.2 Amplify the IL-15 / Rα sushi sequence

[0078] High-fidelity PCR amplify the IL-15 / Rα sushi sequence from the plasmid pcDNA3.1-IL-15 / Rα sushi. The specific PCR reaction procedure is as follows:

[0079] High-fidelity PCR reaction system: KOD New buffer (5 μL), 2 mM dNTPs (5 μL), 25 mM MgSO 4(3 μL), upstream primer IR-F (1.5 μL), downstream primer IR-R (1.5 μL), template (2 μL), KOD enzyme (1 μL), ddH 2 HO to make up the volume to 50 μL.

[0080] IR-F sequence: CGGAATTCATGAGAATTTCGAAACCACATTTGAGAAGT (SEQ ID NO: 2)

[0081] IR-R sequence: ccgCTCGAGTCAAGAAGTGTTGATGAACATTTGGACAAT (SEQ ID NO: 3).

[0082] PCR reaction program: 94℃ pre-denaturation for 2min, 98℃ denaturation for 10s, 56℃ annealing for 30s, 68℃ extension for 30s, and 68℃ extension for 7min after 35 cycles. PCR reaction results are shown in Figure 2 .

[0083] Depend on Figure 2 As can be seen, the IL-15 / Rαsushi sequence 493bp was successfully amplified by high-fidelity PCR reaction.

[0084] 1.1.3 Obtaining pBATK-IL-15 / Rαsushi

[0085] First, the pBATK vector was double-digested with EcoRⅠ and XhoⅠ. Then, the pBATK vector after digestion and the IL-15 / Rαsushi sequence amplified by high-fidelity PCR were electrophoresed by 1% agarose gel at 120v for 30min, and the PCR fragment and the digested vector were recovered by a gel tapping recovery kit (Youkang Biological Product No.: YK00A2). The two gel tapping recovery products were connected by a seamless cloning kit (Quanshijin, Product No.: CU101-01) according to the molar mass ratio of pBATK:IL-15 / Rαsushi=1:3, and then 50℃ for 15min. The ligation product was then transformed into competent DH5α, spread on a solid LB plate containing ampicillin, cultured at 37°C for 10-16h, and then a single clone plaque was picked and transferred to a liquid LB medium containing ampicillin. The culture was shaken at 220rpm for 10-16h, and then the recombinant vector was extracted using a plasmid extraction kit. The pBATK-IL-15 / Rαsushi was verified by double restriction enzymes NheⅠ and MluⅠ and by PCR target gene verification. The results are shown in Figure 3-4 .

[0086] Depend on Figure 3It can be seen that the corresponding two bands cut out by double digestion of NheⅠ and MluⅠ on pBATK-IL-15 / Rαsushi are 2570bp (pBATK vector) and 3262bp (carried IL-15 / Rαsushi fragment), and the band sizes are correct. Figure 4 It can be seen that the PCR result is consistent with the expected 493bp.

[0087] 1.2 Construction and packaging of VV-ΔBVT-IL-15 / Rαsushi

[0088] 2 μg of px459-TK-gRNA plasmid extracted with endotoxin-free medium was diluted with PEI in a mass ratio of plasmid: PEI = 1:3, and then slowly dripped into the mixture of plasmid and serum-free medium, gently mixed, and allowed to stand at room temperature for 15 minutes. After standing, the mixture was added with 3×10 5 / well HEK293A 6-well plate, fresh 10% FBS cell culture medium was added to the 6-well plate. Place in 37℃ 5% CO 2 Cell culture incubator, after 8 hours of culture, discard the cell supernatant, replace with fresh 5% FBS cell culture medium, discard the cell supernatant after 24 hours, infect VV-ΔBV oncolytic virus according to 1MOI thin layer, discard the virus liquid after 2 hours, dilute and mix PEI with serum-free medium according to the mass ratio of plasmid: PEI = 1:3, and then slowly drip into the mixture of plasmid and serum-free medium, gently mix, and stand at room temperature for 15 minutes. After standing, add the mixture to a 6-well plate containing 3×105 / well HEK293A, and add fresh 10% FBS cell culture medium to the 6-well plate. Place the cells in a 37°C 5% CO2 cell culture incubator. After culturing for 8 hours, discard the cell supernatant and replace with fresh 5% FBS cell culture medium. Continue culturing for 3 days and observe cell lesions and fluorescence. After lesions, collect the supernatant and cells to obtain the first-generation virus P1, i.e., oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi.

[0089] Example 2

[0090] Screening and identification of wild-type recombinant oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi

[0091] The first generation virus was repeatedly frozen and thawed at -80℃ / 37℃ for three times, and then thin-layer infected HEK293A was amplified and fluorescently screened. 3×10 5HEK293A cell line was plated on a six-well plate / well. Virus P1 was diluted 500, 1000, and 2000 times, and then added to the six-well plate in a thin layer at 700 μl / well for infection. After 2 hours, the virus solution was discarded, 3 ml of low-melting point glue was added, and the solution was placed in the incubator after it was completely solidified.

[0092] Preparation method of low-melting point gel: weigh 1g of low-melting point agarose gel in a 50mL centrifuge tube, add 20mL PBS, sterilize under high pressure and place at 4℃ for later use. 5% low-melting point gel: complete culture medium = 1:3. The first preparation of 5% low-melting point gel needs to be sterilized. It needs to be placed in an 80℃ water bath 1h in advance before subsequent use. The complete culture medium needs to be placed at 37℃ for 30 minutes in advance. After the temperature of 5% low-melting point gel and complete culture medium is suitable, add 5% low-melting point gel to the complete culture medium, mix it upside down, and add 3ml / well to the six-well plate. Observe the cell state 24, 48, and 72h after the thin layer, and use a fluorescence microscope to observe whether there are fluorescent labeled plaques and mark them. After 72h, use a gun tip to select fluorescent plaques, add 700μl FBSDMEM without FBSDMEM, and quickly freeze and thaw three times at 37℃ and liquid nitrogen to release the virus in the cells. Place it at -80 degrees Celsius for use, which is recorded as P1 virus liquid. The P2 virus solution was screened 3-4 times repeatedly to obtain a monoclonal oncolytic vaccinia virus strain.

[0093] The virus liquid was extracted with a DNA virus genome extraction kit (Solebo, catalog number: D2400) to extract the recombinant oncolytic adenovirus genome. The viral genome was PCR-generated using primers IL-15 / Rαsushi, TK, VGF, and B8R, and positive controls and experimental groups were set up for observation by agarose gel electrophoresis. The results are shown in Figure 5-7 .

[0094] Depend on Figure 5 It can be seen that the IL-15 / Rαsushi sequences were successfully amplified; Figure 6 It showed that none of the TK, VGF, and B8R sequences of VV-ΔBVT-IL-15 / Rαsushi were amplified, indicating that it was a triple-deficient strain with no wild-type strain contamination; Figure 7 The viral infection status of VV-ΔBVT-IL-15 / Rαsushi under visible light and fluorescence is shown, indicating that the screening fluorescence EGFP completely overlaps with the bright field and mCherry fluorescence, and there is no wild-type strain contamination.

[0095] Example 3

[0096] Effects of recombinant oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi on the growth of colon cancer cell lines

[0097] 3.1 MTT assay to detect cell survival rate of colon cancer cells after virus infection

[0098] 3.1.1 MTT assay

[0099] At the sampling time point, 20 μL MTT (5 mg / mL) was added to each well of the cell culture plate. After incubation in the cell culture incubator for 4 hours, the cell supernatant was aspirated, 150 μL DMSO was added to each well, and after mixing on a shaker for 10 minutes, the OD value was measured at 490 nm on a microplate reader, and the cell survival rate was calculated based on the OD value. The specific formula is as follows:

[0100] Cell viability (%) = (OD of virus-infected wells - OD of blank wells) / (OD of control wells - OD of blank wells) × 100%.

[0101] 3.1.2 Cell survival rate detection of colon cancer cell lines

[0102] Colon cancer cell lines SW480 and HCT-116 were used as experimental cell lines, and each cell line was plated in a 96-well plate (3000 / well, 100 μL / well). After the cells adhered to the wall, 1 MOI of recombinant oncolytic vaccinia virus VV-ΔBVT (without the target gene) and VV-ΔBVT-IL-15 / Rαsushi were added to the 96-well plate. Three replicate wells were set for each MOI group, and then samples were taken at 6h, 24h, 48h, 72h, and 96h to determine the cell survival rate of each cell line. The results are shown in Figure 8-9 .

[0103] Depend on Figure 5 It can be seen that VV-ΔBVT and VV-ΔBVT-IL-15 / Rαsushi have a significant inhibitory effect on colon cancer cell lines SW480 and HCT-116, and the killing effect is also enhanced with time, indicating that the treatment effect of the virus is time-dependent.

[0104] Example 4

[0105] Toxic effects of oncolytic vaccinia virus and PBMC cells on colon cancer cells

[0106] 4.1MTT assay for the survival rate of PBMC cells after infection with oncolytic adenovirus

[0107] PBMCs were isolated from whole blood of healthy subjects and plated in 96-well plates (7.5×10 4 cells / well, 100 μL / well), and after adherence, 1 MOI of VV-ΔBVT and VV-ΔBVT-IL-15 / Rαsushi virus were added, and 20 μL MTT was added to each well after co-culture for 72 h. The cells were incubated at 37°C with 5% CO 2After culturing in the cell culture incubator for 4 hours, the cell supernatant was aspirated, 150 μL DMSO was added to each well, and the mixture was mixed on a shaker for 10 minutes. The OD value was measured at 490 nm on an ELISA reader. The cell viability was calculated according to the following formula. Fig.13 .

[0108] Among them, the blank wells are the wells with only PBS added, the control wells are the cells without virus added, and the virus treatment group is: cells with virus added.

[0109] Cell viability (%) = (OD of virus-infected wells - OD of blank wells) / (OD of control wells - OD of blank wells) × 100%.

[0110] Depend on Fig.10 It can be seen that compared with the VV-ΔBVT group, the addition of VV-ΔBVT-IL-15 / Rαsushi has a stronger killing ability on colon cancer cells, indicating that IL-15 / Rαsushi combined with PBMC cells can better inhibit the growth of colon cancer cells.

[0111] Example 5

[0112] Animal experiments

[0113] 5.1 Inhibitory effect of recombinant oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi on colon cancer cells in vivo

[0114] 6-8 week old NOD-SCID female mice were used and housed under SPF conditions. Each mouse was injected subcutaneously with 5×10 6 SW480 cells and 1×10 6 PBMC cells. Tumors formed in more than one week, with a size of 100 mm 3 The mice were randomly divided into 3 groups: PBS control group, VV-ΔBVT treatment group, and VV-ΔBVT-IL-15 / Rαsushi group, with 8 mice in each group. PBS, VV-ΔBVT, or VV-ΔBVT-IL-15 / Rαsushi virus (4×10 7 VP / mice). Tumor volume and mouse weight were measured every two days for more than 30 days. When the tumor size reached 2000mm 3 Euthanize the mice when ethically necessary and calculate the tumor volume according to the following formula.

[0115] On day 14, one mouse in each group was euthanized. The mice were dissected and various organs were taken: heart, liver, spleen, lung, kidney, and tumor. Some of them were fixed with 4% paraformaldehyde tissue fixative and used for HE staining for toxicity testing. The results are shown in Fig.15 .

[0116] Tumor volume (mm3 ) = length (mm) × width (mm) 2 ×0.5.

[0117] The test results are shown in Fig.11 and Fig.12 ,like Fig.11 It can be seen that as time goes by, the VV-ΔBVT-IL-15 / Rαsushi injection group significantly inhibits tumor growth compared with the PBS group; and the effect of inhibiting tumor growth is also better than that of the VV-ΔBVT injection group. Therefore, it shows that the VV-ΔBVT-IL-15 / Rαsushi injection group has the best effect in inhibiting tumor growth and can significantly inhibit tumor growth, which has a certain reference value for the treatment of colon cancer.

[0118] Fig.13 The results showed that the hearts of mice in the VV-ΔBVT-IL-15 / Rαsushi group showed no obvious degeneration of myocardial cells, no inflammatory cell infiltration between cells, no obvious swelling and shedding of capillaries, and no obvious increase in valve thickness; the liver cells in the liver were intact in morphology, the nuclei were not significantly enlarged, the hepatic lobules were intact in morphology, and there was no obvious inflammatory response; the spleen had no obvious changes, and spleen cells showed obvious inflammatory cell infiltration; the alveolar structure was intact, with no obvious pathological changes; the glomerular tubules in the kidneys were clear, without obvious major and vacuolar degeneration, and no obvious inflammatory response. The VV-ΔBVT-IL-15 / Rαsushi virus treatment group caused less damage to the mouse body, and no significant lesions and functional damage were found in the heart, liver, spleen, lungs, and kidneys.

[0119] Fig.15 The results showed that after intratumoral injection, oncolytic viruses were mainly concentrated in the tumor infiltration environment. The outer membrane of the tumor had a blocking effect on the virus and had a strong resistance to oncolytic viruses. Once the virus invaded into the tumor, the tumor cells had a weak resistance to oncolytic viruses. + T cells have difficulty entering the tumor and are mainly concentrated near the tumor blood vessels. After infecting tumor cells, the VV-ΔBVT-IL-15 / Rαsushi strain can release IL-15 / Rαsushi to further promote the activation of tumor-infiltrating immune cells and CD4 + T cells accumulate inside tumor cells and inhibit their growth.

[0120] Finally, it should be noted that the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. A method for constructing a recombinant oncolytic vaccinia virus carrying the IL-15 / Rαsushi gene, characterized in that The construction method includes the following steps: Step 1): construct the plasmid pcDNA3.1-IL-15 / Rαsushi carrying the IL-15 / Rαsushi gene; Step 2): constructing a plasmid pBATK-IL-15 / Rαsushi carrying the IL-15 / Rαsushi; Step 3): construct plasmid px459-TK-gRNA, and transfect px459-TK-gRNA, pcDNA3.1-IL-15 / Rαsushi, and pBATK-IL-15 / Rαsushi into HEK293A cells, infect VV-ΔBV oncolytic vaccinia virus, and obtain the recombinant oncolytic vaccinia virus VV-ΔBVT-IL-15 / Rαsushi carrying the IL-15 / Rαsushi gene after packaging.

2. The method for constructing a recombinant oncolytic vaccinia virus carrying the IL-15 / Rαsushi gene according to claim 1, characterized in that: The base sequence of the IL-15 / Rαsushi gene is SEQ ID NO: 1: .

3. A method for constructing a recombinant oncolytic vaccinia virus carrying the IL-15 / Rαsushi gene according to claim 1 or 2, characterized in that: The step 2) also includes the following sub-steps: Step 2-1): performing high-fidelity PCR on the pcDNA3.1-IL-15 / Rαsushi to amplify IL-15 / Rαsushi; Step 2-2): digest the pBATK vector with EcoRI and XhoⅠ; Step 2-3): At 40-55°C, the amplified IL-15 / Rαsushi was connected to the enzyme-cut pBATK for 10-20 min, and then transformed into the competent DH5α to obtain the plasmid pBATK-IL-15 / Rαsushi carrying IL-15 / Rαsushi.

4. The method for constructing a recombinant oncolytic vaccinia virus carrying the IL-15 / Rαsushi gene according to claim 3, characterized in that: The high-fidelity PCR reaction system in step 2-1) includes: KOD Newbuffer (5μL), 2mM dNTPs (5μL), 25mM MgSO4 (3μL), upstream primer (1.5μL), downstream primer (1.5μL), template (2μL), KOD enzyme (1μL), and ddH2O to make up the volume to 50μL; the high-fidelity PCR reaction program is: 94℃~96℃2~3min; 96~98℃10~30s, 55~60℃15~30s, 65~70℃20~30s, a total of 35~40 cycles, and finally 68℃7min. Step 2-3): First, use 0.5-2% agarose gel electrophoresis for 20-35 minutes to cut the gel to recover the two PCR amplification products and the enzyme-digested pBATK vector, then connect the two cut gel recovery products through a seamless cloning kit according to the preset molar mass ratio, and then transform the connection product into competent DH5α, culture, and extract to obtain pBATK-IL-15 / Rαsushi carrying the IL-15 / Rαsushi plasmid.

5. The method for constructing a recombinant oncolytic vaccinia virus carrying the IL-15 / Rαsushi gene according to claim 4, characterized in that: The molar mass ratio of the two rubber tapping products is pBATK:IL-15 / Rαsushi=1:

3.

6. The method for constructing a recombinant oncolytic vaccinia virus carrying the IL-15 / Rαsushi gene according to claim 1, characterized in that: The step 3) also includes the following sub-steps: Step 3-1): transfect px459-TK-gRNA into HEK293A cells; Step 3-2): Infect HEK293A cells with VV-ΔBV oncolytic vaccinia virus; Step 3-3): pBATK-IL-15 / Rαsushi and pcDNA3.1-IL-15 / Rαsushi were then transfected into the HEK293A cells in step 3-2), and VV-ΔBVT-IL-15 / Rαsushi was obtained after culture.

7. The method for constructing a recombinant oncolytic vaccinia virus carrying the IL-15 / Rαsushi gene according to claim 6, characterized in that: In step 3-1), the transfection reagent for px459-TK-gRNA and in step 3-3), pBATK-IL-15 / Rαsushi can be any one of lipo3000, lipo8000, and PEI; wherein, in step 3-1) and step 3-3), the ratio of the transfection reagent to px459-TK-gRNA is any one of 5:1, 4:1, 3:1, and 2:1, and the transfection time is 3-6 hours; in step 3-3), the ratio of the transfection reagent to px459-TK-gRNA is any one of 5:1, 4:1, 3:1, and 2:1, and the transfection time is 3-6 hours; in step 3-2), the MOI of the VV-ΔBV oncolytic vaccinia virus is 0.1-10, and the infection time of the VV-ΔBV oncolytic vaccinia virus is 1-6 hours; Application of the construction method in the preparation of anti-colon cancer products, wherein the products include drugs, pharmaceutical raw materials or targeted inhibitors.

8. The use according to claim 7, characterized in that: The medicament includes an oncolytic vaccinia virus vaccine.

9. The use according to claim 7 or 8, characterized in that: The drug includes pharmaceutically acceptable excipients.

10. The use according to claim 9, characterized in that: The auxiliary material can be any one or more of an osmotic pressure regulator, a lyophilization protectant, a surfactant, a buffer, and an excipient.

Images