Multi-target nucleic acid specificity detection method, equipment, medium and program product

Abstract

The invention provides a multi-target nucleic acid specificity detection method, equipment, a medium and a program product, and relates to the technical field of molecular biology. According to the method, the abundance of a specific sequence of a target to be detected in a system is increased through multiple PCR amplification in the first round, and then the target is specifically detected through nested PCR in the second round. Wherein the second round of nested PCR is detected through qPCR based on the Amplifluor principle, that is, a target specific primer of the nested PCR and a sequence at one end of a universal probe in an Amplifluor system jointly form a second round of amplification primer, so that quantitative detection of the target is realized.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology technology, and more specifically, to a multi-target nucleic acid specific detection method, device, medium and program product. Background Art

[0002] Polymerase Chain Reaction (PCR) is a molecular biology technique that simulates the natural replication process of DNA in vitro to amplify specific DNA fragments. Real-time PCR (RT-PCR), also known as quantitative PCR (qPCR), combines the amplification ability of PCR with fluorescence detection technology, and can monitor the process of DNA amplification in real time, thereby achieving quantitative analysis of target genes. It is widely used in gene expression research, clinical diagnosis, forensic identification and food testing. According to different chemical principles, qPCR can be divided into the following two categories. One is the fluorescent dye method, which uses fluorescent dyes that can be inserted into double-stranded DNA. After binding to DNA, the fluorescent dye will emit a fluorescent signal, and the fluorescence intensity is proportional to the amount of DNA, such as SYBRGreenI and EvaGreen. This method is simple and low-cost, but it may produce background signals due to non-specific amplification. The other is the fluorescent probe method, which uses specific fluorescent probes to detect PCR products. According to the different types of probes, it can be divided into the following subtypes. There are three common methods: (1) Primer-Probe, such as Scorpions and etc. The probe is used as a primer during PCR amplification to form a specific signal; (2) Hydrolysis probe method, such as TaqMan probe, the probe is hydrolyzed by DNA polymerase during PCR amplification to release a fluorescent signal. This is one of the most commonly used probe types; (3) Hybridization probe method, such as molecular beacon, the probe binds to the target DNA under specific conditions and emits a fluorescent signal.

[0003] With the continuous advancement of technology, various derivative technologies of PCR have emerged in an endless stream. For example, multiplex PCR (Multiplex PCR), a PCR technology that adds multiple pairs of primers to a reaction system to simultaneously amplify different gene fragments of the same DNA sample, has the same reaction principle, reaction reagents and operation process as general PCR, but the difference is that multiplex PCR adds more than two pairs of primers to the reaction system, and each pair of primers binds to the corresponding part of the template, and finally amplifies more than two target DNA fragments. Nested PCR (Nested PCR) is a variant PCR technology that uses two pairs of PCR primers to amplify complete fragments. Nested PCR uses two rounds of PCR reactions. The first pair of primers amplifies the fragment similar to ordinary PCR, and the second pair of primers (nested primers) bind to the inside of the first PCR product, making the second PCR amplification fragment shorter than the first amplification. The advantage of nested PCR is that if the first amplification produces an erroneous fragment, the probability of primer pairing and amplification on the erroneous fragment in the second amplification is extremely low, so the amplification of nested PCR is very specific. At present, there are methods that integrate multiplex PCR and nested PCR to detect multiple microorganisms in one step, such as CN110273014A, which discloses a method for detecting multiple microorganisms in one step by integrating multiplex nested PCR. Nested PCR primers are designed as universal primers based on the conserved regions of the DNA barcode genes of the species to be tested (such as bacterial 16s rRNA), and multiplex PCR primers are designed as specific primers in the variable regions for PCR amplification reactions. This method targets the conserved regions and cannot meet the detection requirements of high sensitivity, high specificity and low cost for non-conserved regions.

[0004] At present, the qPCR method based on the TaqMan probe method is widely used in the field of microbial detection. Compared with the fluorescent dye method, this method has higher specificity and can detect various microorganisms efficiently and accurately, but this method also has some limitations. For example, the cost of probe synthesis is high. Since TaqMan probes need to be specifically designed and synthesized according to different target microbial sequences, the cost is relatively high. In addition, although the TaqMan probe method has high specificity and sensitivity, in some cases, such as for the detection of certain complex samples or low-copy number target microorganisms, its detection sensitivity is limited, and additional pretreatment steps or optimization of experimental conditions may be required to improve the detection effect. Based on Amplifluor technology, a universal hairpin structure probe (Uniprimere) is used, which is incorporated into the amplification product by annealing with the "Z" type primer of the target, and opens the hairpin structure in a new round of amplification extension to emit fluorescence. For different targets, Amplifluor can share the same set of primer probes, so the development and use costs are low, and it is mostly used in SNP typing detection, but its amplification efficiency is slightly worse than that of the Taqman probe method. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention provides a multi-target nucleic acid specific detection method, device, medium and program product; the method of the present invention integrates multiple amplification, nested PCR and Amplifluor detection to develop a high-sensitivity, high-specificity and low-cost target-specific detection method (Multiplex Nested Amplifluor PCR, MNAP).

[0006] The first aspect of the present application discloses a multi-target nucleic acid specific detection method, the method comprising:

[0007] 101, determining at least one target to be detected, and designing multiple specific PCR primers and a first amplification sequence thereof according to the sequence of the target to be detected;

[0008] 102, designing a nested specific PCR primer and a second amplification sequence thereof based on a first amplification sequence of a single target to be detected;

[0009] 103, using the multiple specific PCR primers to perform a first round of amplification on the target nucleic acid sample to be detected to obtain a PCR product;

[0010] 104. Combining the nested specific PCR primer with the sequence at one end of the universal probe in Amplifluor to form a specific amplification primer, and using the specific amplification primer to detect the target to be detected to obtain a detection result.

[0011] In some embodiments, the method for obtaining the multiple specific PCR primers and the first amplified sequence thereof comprises: selecting the core gene or conserved region of the target to be detected, designing primers for the core gene or conserved region and filtering the primers to obtain the filtered first primers and amplified sequence; using the sequence of the target to be detected as a reference sequence, and using the first primer and amplified sequence that are only uniquely aligned to the source target and not aligned to other targets as the multiple specific PCR primers and the first amplified sequence respectively;

[0012] Optionally, the filtering criteria for the first primer include: amplification length of 170-250 bp; primer length range of 18-23 bp; annealing temperature range of 57-63° C.; GC content range of 40-60%.

[0013] In some embodiments, the method for obtaining the nested-specific PCR primer and its second amplification sequence includes: selecting a first amplification sequence of a single target to be detected, designing primers for the first amplification sequence and filtering the primers to obtain filtered second primers and amplification sequences; using the first amplification sequence of the target to be detected as a reference sequence, and using the second primer and amplification sequence that are only uniquely aligned to the first amplification sequence of its source target as the nested-specific PCR primer and the second amplification sequence, respectively.

[0014] In some embodiments, the filtering criteria for the second primer include: amplification length of 45-150 bp; primer length range of 18-23 bp; annealing temperature range of 57-63° C.; GC content range of 40-60%.

[0015] In some embodiments, after 103, the PCR product is purified by magnetic beads to obtain a purified PCR product.

[0016] In some embodiments, the target includes any one or more of the following microbial species: Acinetobacter baumannii (Aba), Staphylococcus aureus (Sau), Escherichia coli (Eco), and Klebsiella pneumoniae (Kpn).

[0017] The second aspect of the present application discloses a computer device, which includes: a memory and a processor; the memory is used to store a computer program; the processor executes the computer program to implement the steps of the method described in the first aspect of the present application.

[0018] The third aspect of the present application discloses a computer-readable storage medium having a computer program stored thereon, and when the computer program is executed by a processor, the steps of the method described in the first aspect of the present application are implemented.

[0019] The fourth aspect of the present application discloses a computer program product, including a computer program, which implements the steps of the method described in the first aspect of the present application when executed by a processor.

[0020] The fifth aspect of the present application discloses any of the following applications:

[0021] (1) Application of the method according to the first aspect of the present application in the design of target-specific primers and probes;

[0022] (2) Application of the method according to the first aspect of the present application in target sequence detection;

[0023] (3) Use of the method according to any one of claims 1 to 6 in the detection of microbial species.

[0024] This application has the following beneficial effects:

[0025] 1. The present application innovatively discloses a multi-target nucleic acid specific detection method (MNAP). The MNAP method first increases the abundance of the target-specific sequence to be detected in the system through the first round of multiplex PCR amplification, and then specifically detects the target through the second round of nested PCR. Among them, the second round of nested PCR is detected by qPCR based on the Amplifluor principle, that is, the specific primers of the nested PCR and the sequence at one end of the universal probe in the Amplifluor system together constitute the second round of amplification primers, thereby realizing quantitative detection of the target. This method improves the detection sensitivity through the first round of multiple amplification, improves the detection specificity through nested PCR, and adopts the Amplifluor detection strategy to reduce the detection cost, providing a high-sensitivity, high-specificity and low-cost target detection method. The MNAP process constructed by this application can quickly and massively detect the microbial contamination of clinical samples such as environmental water sources and food, with strong specificity and high throughput, greatly shortening the detection time and cost, and has broad application prospects in clinical diagnosis and microbial detection in the field of food.

[0026] 2. This application develops a detection kit for detecting five microorganisms, namely Acinetobacter baumannii, Staphylococcus aureus, Escherichia coli and Klebsiella pneumoniae, based on the established MNAP process. The detection sensitivity reaches single copy / ml, and no cross-reaction is found between closely related species. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative work.

[0028] Figure 1 is a schematic diagram of a method flow chart provided by the first aspect of an embodiment of the present invention;

[0029] Figure 2 Schematic diagram of a multi-target nucleic acid specific detection system provided in the second aspect of an embodiment of the present invention;

[0030] Figure 3 is a schematic diagram of a computer device provided by an embodiment of the present invention;

[0031] Figure 4 is a schematic diagram of the architecture of an exemplary computing device provided by an embodiment of the present invention;

[0032] Figure 5 is a schematic diagram of a storage medium provided by an embodiment of the present invention;

[0033] Figure 6 is the amplification curve of the Escherichia coli MNAP process provided by the embodiment of the present invention;

[0034] Figure 7 is the amplification curve of the Escherichia coli Taqman-qPCR process provided in the embodiment of the present invention;

[0035] Figure 8 is the amplification curve of the Acinetobacter baumannii MNAP process provided in an embodiment of the present invention;

[0036] Fig. 9 is the amplification curve of the Acinetobacter baumannii Taqman-qPCR process provided in an embodiment of the present invention;

[0037] Fig.10 It is a schematic diagram of the MNAP process provided by an embodiment of the present invention. DETAILED DESCRIPTION

[0038] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0039] In some of the processes described in the specification and claims of the present invention and the above-mentioned figures, multiple operations that appear in a specific order are included, but it should be clearly understood that these operations may not be executed in the order in which they appear in this article or executed in parallel. The serial numbers of the operations, such as 101, 102, etc., are only used to distinguish different operations, and the serial numbers themselves do not represent any execution order. In addition, these processes may include more or fewer operations, and these operations may be executed in sequence or in parallel. It should be noted that the descriptions of "first", "second", etc. in this article are used to distinguish different messages, devices, modules, etc., do not represent the order of precedence, and do not limit the "first" and "second" to be different types.

[0040] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0041] Figure 1The present invention provides a schematic flow diagram of a multi-target nucleic acid specific detection method. Specifically, the method comprises the following steps: 101: determining at least one target to be detected, and designing multiple specific PCR primers and their first amplification sequences according to the sequences of the targets to be detected;

[0042] In some embodiments, the method for obtaining the multiple specific PCR primers and the first amplified sequence thereof comprises: selecting the core gene or conserved region of the target to be detected, designing primers for the core gene or conserved region and filtering the primers to obtain the filtered first primers and amplified sequence; using the sequence of the target to be detected as a reference sequence, and using the first primer and amplified sequence that are only uniquely aligned to the source target and not aligned to other targets as the multiple specific PCR primers and the first amplified sequence respectively;

[0043] In some embodiments, the filtering criteria of the first primer include: amplification length of 170-250 bp; primer length range of 18-23 bp; annealing temperature range of 57-63° C.; GC content range of 40-60%.

[0044] 102: designing a nested specific PCR primer and a second amplification sequence thereof based on a first amplification sequence of a single target to be detected;

[0045] In some embodiments, the method for obtaining the nested-specific PCR primer and its second amplification sequence includes: selecting a first amplification sequence of a single target to be detected, designing primers for the first amplification sequence and filtering the primers to obtain filtered second primers and amplification sequences; using the first amplification sequence of the target to be detected as a reference sequence, and using the second primer and amplification sequence that are only uniquely aligned to the first amplification sequence of its source target as the nested-specific PCR primer and the second amplification sequence, respectively.

[0046] In some embodiments, the filtering criteria for the second primer include: amplification length of 45-150 bp; primer length range of 18-23 bp; annealing temperature range of 57-63° C.; GC content range of 40-60%.

[0047] 103: performing a first round of amplification on the target nucleic acid sample to be detected using the multiple specific PCR primers to obtain a PCR product;

[0048] In some embodiments, after 103, the PCR product is purified by magnetic beads to obtain a purified PCR product.

[0049] 104: The nested specific PCR primer and the sequence at one end of the universal probe in Amplifluor are combined to form a specific amplification primer, and the target to be detected is detected using the specific amplification primer to obtain a detection result.

[0050] In some embodiments, the target includes any one or more of the following microbial species: Acinetobacter baumannii (Aba), Staphylococcus aureus (Sau), Escherichia coli (Eco), and Klebsiella pneumoniae (Kpn).

[0051] Figure 3 is a schematic diagram of a computer device provided by an embodiment of the present invention, such as Figure 3 As shown, the device may include: one or more processors, and one or more memories; wherein the memories store computer-readable codes, and when the computer-readable codes are run by the one or more processors, the method described above may be executed.

[0052] The processor in this embodiment can be an integrated circuit chip with signal processing capabilities. The above processor can be a general-purpose processor, a digital signal processor (DSP), an application-specific integrated circuit (ASIC), a field-programmable gate array (FPGA) or other programmable logic devices, discrete gates or transistor logic devices, discrete hardware components. The disclosed methods, operations and logic block diagrams in the embodiments of the present disclosure can be implemented or executed. The general-purpose processor can be a microprocessor or the processor can also be any conventional processor, etc., which can be an X86 architecture or an ARM architecture.

[0053] In general, various example embodiments of the present disclosure may be implemented in hardware or dedicated circuits, software, firmware, logic, or any combination thereof. Certain aspects may be implemented in hardware, while other aspects may be implemented in firmware or software that may be executed by a controller, microprocessor, or other computing device. When various aspects of the disclosed embodiments are illustrated or described as block diagrams, flow charts, or using some other graphical representation, it will be understood that the blocks, devices, systems, techniques, or methods described herein may be implemented in hardware, software, firmware, dedicated circuits or logic, general purpose hardware or controllers or other computing devices, or some combination thereof as non-limiting examples.

[0054] For example, the method or device according to the embodiment of the present disclosure may also be implemented by Figure 4 The architecture of the computing device 3000 shown in FIG. Figure 4As shown, the computing device 3000 may include a bus 3010, one or more CPUs 3020, a read-only memory (ROM) 3030, a random access memory (RAM) 3040, a communication port 3050 connected to a network, an input / output component 3060, a hard disk 3070, etc. The storage device in the computing device 3000, such as ROM 3030 or hard disk 3070, may store various data or files used for processing and / or communication of the method provided by the present disclosure and program instructions executed by the CPU. The computing device 3000 may also include a user interface 3080. Of course, Figure 4 The architecture shown is only exemplary and can be omitted according to actual needs when implementing different devices. Figure 4 One or more components of a computing device are shown.

[0055] The embodiment of the present invention also provides a computer-readable storage medium, such as Figure 5 As shown, it is a schematic diagram of a storage medium provided by an embodiment of the present invention, and a computer readable instruction 4010 is stored on the computer storage medium 4020. When the computer readable instruction 4010 is executed by the processor, the method according to the embodiment of the present disclosure described with reference to the above figures can be executed. The computer readable storage medium in the embodiment of the present disclosure can be a volatile memory or a non-volatile memory, or can include both volatile and non-volatile memories. The non-volatile memory can be a read-only memory (ROM), a programmable read-only memory (PROM), an erasable programmable read-only memory (EPROM), an electrically erasable programmable read-only memory (EEPROM) or a flash memory. The volatile memory can be a random access memory (RAM), which is used as an external cache. By way of example and not limitation, many forms of RAM are available, such as static random access memory (SRAM), dynamic random access memory (DRAM), synchronous dynamic random access memory (SDRAM), double data rate synchronous dynamic random access memory (DDRSDRAM), enhanced synchronous dynamic random access memory (ESDRAM), synchronous link dynamic random access memory (SLDRAM), and direct memory bus random access memory (DR RAM). It should be noted that the memory of the methods described herein is intended to include, but is not limited to, these and any other suitable types of memory. It should be noted that the memory of the methods described herein is intended to include, but is not limited to, these and any other suitable types of memory.

[0056] The embodiments of the present disclosure also provide a computer program product or system, including a computer program, which implements the steps of the above method when executed by a processor.

[0057] In some embodiments, this embodiment also discloses a multi-target nucleic acid specific detection system, such as Figure 2As shown, the system comprises:

[0058] A multiple specific primer design module 201 is used or configured to determine at least one target to be detected, and to design multiple specific PCR primers and a first amplification sequence thereof according to the sequence of the target to be detected;

[0059] A nested specific primer design module 202, used for or configured to design a nested specific PCR primer and a second amplification sequence thereof based on a first amplification sequence of a single target to be detected;

[0060] An amplification module 203 is used for or configured to perform a first round of amplification on the target nucleic acid sample to be detected using the multiple specific PCR primers to obtain a PCR product;

[0061] The target detection module 204 is used for or configured to combine the nested specific PCR primer with the sequence at one end of the universal probe in Amplifluor to form a specific amplification primer, and use the specific amplification primer to detect the target to be detected to obtain a detection result.

[0062] Example:

[0063] Experiment 1: MNAP process development, the principle is as follows Fig.10 As shown, the target sequence in the following process is a sequence from a microbial species, but in actual operation, the source of the target sequence is not limited to a microbial species sequence, and theoretically it can be from any species;

[0064] 1. Experimental materials:

[0065] Samples: Acinetobacter baumannii (Aba), Staphylococcus aureus (Sau), Escherichia coli (Eco), and Klebsiella pneumoniae (Kpn).

[0066] Reagents: Microbial genome extraction kit, Amplifluor amplification system, Taqman amplification system, PCRmix, AMPure XP magnetic beads, etc.

[0067] 2. Experimental methods:

[0068] Step 1: Design the first round of species-specific multiplex amplification PCR primers for four microorganisms, namely, Acinetobacter baumannii, Staphylococcus aureus, Escherichia coli and Klebsiella pneumoniae. The design method is as follows: select the core genes in each species, design primers using primer3, select the primer set that meets the following filtering criteria, and then evaluate the species specificity of the amplified sequences and their primers, retain the amplified sequences and their primers with species specificity, and select 1-3 pairs of primers and their amplified sequences with the smallest primer3 penalty as input for step 2. The filtering criteria are: amplification length of 170-250bp; primer length range of 18-23bp; annealing temperature range of 57-63℃; GC content range of 40-60%. The specificity evaluation method is: using the NCBI nt library as the reference database, if an amplified sequence or primer is only uniquely aligned to its source species, it is considered to be species-specific. The primer sequences are shown in Table 1: Table 1 Names and sequences of multiplex specific PCR primers

[0069] Primer name Primer sequences Aba-mF1 ATCAACACACGGCCTAAGCTAA Aba-mR1 CCCAATCTGGAACGACCTACAA Aba-mF2 TCAGGATTTCCACCATGATGCA Aba-mR2 AGTCGCTTGATGGGGTGTATTT Sau-mF CGACGTACGCTAGCAAAAGAAG Sau-mR TCAAGTCGACGCTCTTCAATGA Eco-mF1 TCGCCGTGATTAACATCGGA Eco-mR1 ACGAGCGCGACGAATTTGTT Eco-mF2 CGTTATGCCGCGAATATGCT Eco-mR2 TCCATCCGCTGCATGTGATA Eco-mF3 AAGCCTTCGCACATATCGGT Eco-mR3 GGCTTCACCTTAATTTCCGTGT Kpn-mF1 GGGTAGTTGGTCAGCATTACCA Kpn-mR1 TTGAGAGCTAATCGCCCCTTTT Kpn-mF2 TTGTGGGCCTTTTATCTCTCCC Kpn-mR2 TACATCGGCAAAATTACGACGC Kpn-mF3 GAGCAGAACAATGACCCCAGTA Kpn-mR4 TCATTGCAACTCGTAAGCCTCT

[0070] Step 2: Use the multiple amplification regions in step 1 to design primers for the second round of nested PCR. The design method is as follows: select the amplified sequence of the first round of amplification of each species, use primer3 to design primers, and select 1-3 pairs of primers that meet the following filtering criteria and have the smallest primer3 penalty as the primer pairs to be tested. The filtering criteria are: amplification length is 45-150bp; primer length range is 18-23bp; annealing temperature range is 57-63℃; GC content range is 40-60%; specificity within the first round of target amplification range, that is, the first round of amplification sequences of all species to be tested are used as the reference database. If a certain amplification sequence or primer is only uniquely aligned to the first round of amplification sequence of its source species, it is considered to be specific. Primer sequences are shown in Table 2:

[0071] Table 2 Names and sequences of multiple specific PCR primers

[0072] Primer name Primer sequences Aba-nF1 GAAGGTGACCAAGTTCATGCTTGACGAACATGGTGTACACGA Aba-nR1 CCCAATCTGGAACGACCTACA Aba-nF2 GAAGGTCGGAGTCAACGGATTCTGCCCGCCCTTTTGACTTT Aba-nR2 CAGCTAGCCACCCAGCTAAT Sau-nF GAAGGTGACCAAGTTCATGCTTGCTAAAGCTGGATCGGATGT Sau-nR AGCGAATCGTCAGCACATCT Eco-nF1 GAAGGTGACCAAGTTCATGCTATCGGATTACGCAGCTTTGC Eco-nR1 GGTTTGCTGGCGCTTTGTAG Eco-nF2 GAAGGTCGGAGTCAACGGATTCCTGGTTTCCATCTCACCGG Eco-nR2 GGTTTGCTGGCGCTTTGTAG Eco-nF3 GAAGGTGACCAAGTTCATGCTCCGCATCCGACATTGATTGC Eco-nR3 TGCGTCGTCAGGTGAATGAA Kpn-nF1 GAAGGTGACCAAGTTCATGCTCGGCATGCCTTTATCGAGGA Kpn-nR1 CGCAGCCGAGTTTATCAAGC Kpn-nF2 GAAGGTGACCAAGTTCATGCTTTTATCTCTCCCTGCTGCCC Kpn-nR2 ATGATCTTCCACTCTGGCCG Kpn-nF3 GAAGGTCGGAGTCAACGGATTTTTGCAGCTAGCTTTGGTGG Kpn-nR3 TTGACTCAGCTACGTCACCC

[0073] Step 3: Use the multiplex amplification PCR primer set designed in step 1 that is specific to the microbial species to be detected to perform the first round of amplification on the nucleic acid of the sample to be detected. The amplification system is shown in the following table:

[0074] Element 40μl reaction system PCRMix 20μl Multiplex Amplification Primer Set 4μl Nucleic acid to be tested 1μl Nuclease-free water 15μl Total volume 40μl

[0075] The amplification conditions are shown in the following table:

[0076]

[0077]

[0078] Step 4: Purify the PCR product using magnetic beads.

[0079] After the reaction, the PCR product was purified by magnetic beads. The purification steps are as follows: Take 40μl AMPure XP magnetic beads and place them in the PCR product. Mix thoroughly and let it stand for 5 minutes. Place the PCR tube in a magnetic rack to separate the magnetic beads and liquid. After the solution is clear, carefully remove the supernatant. Keep the PCR tube in the magnetic rack, add 200μl of 80% ethanol freshly prepared with nuclease-free water to rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Repeat the rinse once. Keep the PCR tube in the magnetic rack and open the lid to dry the magnetic beads at room temperature. Add 22μl nuclease-free water, pipette until fully mixed, and let it stand at room temperature for 5 minutes. Centrifuge the PCR tube briefly and place it in a magnetic rack to stand. After the solution is clear, carefully transfer 20μl of supernatant to a new PCR tube. Use Qubit to measure the concentration of the recovered product.

[0080] Step 5: Use the nested PCR primers designed in step 2 to perform Amplifluor detection, and the detection instrument is ABI7500. The amplification system is shown in the following table:

[0081] Element 20 μl reaction system AmplifluorMix 10μl Nested amplification primer pairs 2μl Nucleic acid to be tested 1μl Nuclease-free water 7μl Total volume 20μl

[0082] The amplification conditions are shown in the following table:

[0083]

[0084]

[0085] Step 6: Analyze the amplification curve and Ct value to determine whether the target is successfully detected.

[0086] Step 7: Extraction and testing of nucleic acid of strains to be tested: Extract nucleic acid of each strain of Acinetobacter baumannii, Staphylococcus aureus, Escherichia coli and Klebsiella pneumoniae and prepare 10 copies / rxn of simulated samples to verify and screen the primer combinations designed in steps 1-2.

[0087] 3. Experimental results:

[0088] This experiment used 10 copies / rxn simulated samples to verify and screen the primer combinations obtained in step 1-2. The test results are shown in the following table:

[0089] Primer combinations Strain test concentration (copies / rxn) MNAP average Ct value Aba-mF1 / Aba-mR1+Aba-nF1 / Aba-nR1 10 8.6 Aba-mF2 / Aba-mR2+Aba-nF2 / Aba-nR2 10 9.6 Sau-mF / Sau-mR+Sau-nF / Sau-nR 10 9.1 Eco-mF1 / Eco-mR1+Eco-nF1 / Eco-nR1 10 11.5 Eco-mF2 / Eco-mR2+Eco-nF2 / Eco-nR2 10 24.6 Eco-mF3 / Eco-mR3+Eco-nF3 / Eco-nR3 10 NoC Kpn-mF1 / Kpn-mR1+Kpn-nF1 / Kpn-nR1 10 8.9 Kpn-mF2 / Kpn-mR2+Kpn-nF2 / Kpn-nR2 10 10.6 Kpn-mF3 / Kpn-mR3+Kpn-nF3 / Kpn-nR3 10 21.3

[0090] According to the above test results, the primer pairs with the smallest Ct value (i.e., the most sensitive detection) for each species to be detected (Aba-mF1 / Aba-mR1+Aba-nF1 / Aba-nR1, Sau-mF / Sau-mR+Sau-nF / Sau-nR, Eco-mF1 / Eco-mR1+Eco-nF1 / Eco-nR1 and Kpn-mF1 / Kpn-mR1+Kpn-nF1 / Kpn-nR1) were selected as the final primer combination for performance testing to evaluate the minimum detection limit and specificity of MNAP.

[0091] Experiment 2: High-sensitivity detection of Acinetobacter baumannii, Staphylococcus aureus, Escherichia coli and Klebsiella pneumoniae; 1. Experimental materials:

[0092] Samples: Acinetobacter baumannii (Aba), Staphylococcus aureus (Sau), Escherichia coli (Eco), and Klebsiella pneumoniae (Kpn).

[0093] Reagents: Microbial genome extraction kit, Amplifluor amplification system, Taqman amplification system, PCRmix, AMPure XP magnetic beads, etc.

[0094] 2. Experimental methods:

[0095] The experimental steps were the same as those in Experiment 1, except for the test samples.

[0096] Using the quantitative strains of the four species, simulated samples with concentrations of 100, 10, 5, 1 and 0.5 copies / ml for each strain of Acinetobacter baumannii, Staphylococcus aureus, Escherichia coli and Klebsiella pneumoniae were prepared by dilution in proportion, and then nucleic acid was extracted and tested for this series of samples.

[0097] 3. Experimental results:

[0098] The results are shown in the following table. This experiment used simulated samples of different concentrations to test the MNAP process, and used the Taqman-qPCR method as a control. It can be seen from the table that the MNAP method of the present invention has a higher detection sensitivity, and can detect a single copy of Bauman, Staphylococcus aureus, Escherichia coli and Pneumococcus at the lowest, and can achieve stable detection of 5 copies / ml of Bauman, Escherichia coli and Pneumococcus samples, which is 20 times higher than the conventional Taqman probe method. It is worth noting that Figure 6 , Figure 7 , Figure 8 and Fig. 9From the amplification curves (taking the amplification curves of Bowman's and large intestine as examples, the curves from the upper left corner to the lower right corner are 100, 10, 5, 1 copies / ml and NC samples respectively;), it can be seen that MNAP has a more complete and clear amplification curve, which helps to accurately determine the presence or absence of the target.

[0099]

[0100]

[0101] Experiment 3: MNAP specificity test

[0102] 1. Experimental Materials

[0103] Samples: Closely related strains of Acinetobacter baumannii, Staphylococcus aureus, Escherichia coli and Klebsiella pneumoniae were selected for specificity testing, see the table below for details.

[0104] Serial number Closely related species abbreviation 1 Acinetobacterjunii Aju 2 Staphylococcus epidermidis Sep 3 Staphylococcus haemolyticus Sha 4 Serratia marcescens Sma 5 Salmonella enterica Sen 6 Shigella flexneri Sf 7 Klebsiella aerogenes Kae 8 Klebsiella oxytoca Kox

[0105] Reagents: Microbial genome extraction kit, Amplifluor amplification system, Taqman amplification system, PCRmix, AMPure XP magnetic beads, etc.

[0106] 2. Experimental methods

[0107] The experimental steps were the same as those in Experiment 1, except for the test samples.

[0108] 3. Experimental results

[0109] The results are shown in the table below. It can be seen from the table that no amplification and Ct value detection were found for closely related strains, indicating that this method has good detection specificity for Acinetobacter baumannii, Staphylococcus aureus, Escherichia coli and Klebsiella pneumoniae, and there is no cross-reaction between closely related strains.

[0110]

[0111]

[0112] It should be noted that the flowcharts and block diagrams in the accompanying drawings illustrate the possible architecture, functions and operations of the systems, methods and computer program products according to various embodiments of the present disclosure. In this regard, each box in the flowchart or block diagram can represent a module, a program segment, or a part of a code, and the module, program segment, or a part of the code contains one or more executable instructions for implementing the specified logical function. It should also be noted that in some alternative implementations, the functions marked in the box can also occur in a different order from the order marked in the accompanying drawings. For example, two boxes represented in succession can actually be executed substantially in parallel, and they can sometimes be executed in the opposite order, depending on the functions involved. It should also be noted that each box in the block diagram and / or flowchart, and the combination of boxes in the block diagram and / or flowchart can be implemented with a dedicated hardware-based system that performs a specified function or operation, or can be implemented with a combination of dedicated hardware and computer instructions.

[0113] In general, various example embodiments of the present disclosure may be implemented in hardware or dedicated circuits, software, firmware, logic, or any combination thereof. Certain aspects may be implemented in hardware, while other aspects may be implemented in firmware or software that may be executed by a controller, microprocessor, or other computing device. When various aspects of the disclosed embodiments are illustrated or described as block diagrams, flow charts, or using some other graphical representation, it will be understood that the blocks, devices, systems, techniques, or methods described herein may be implemented in hardware, software, firmware, dedicated circuits or logic, general purpose hardware or controllers or other computing devices, or some combination thereof as non-limiting examples.

[0114] Those skilled in the art can clearly understand that, for the convenience and brevity of description, the specific working processes of the systems, devices and units described above can refer to the corresponding processes in the aforementioned method embodiments and will not be repeated here.

[0115] In the several embodiments provided in the present application, it should be understood that the disclosed systems, devices and methods can be implemented in other ways. For example, the device embodiments described above are only schematic. For example, the division of the units is only a logical function division. There may be other division methods in actual implementation, such as multiple units or components can be combined or integrated into another system, or some features can be ignored or not executed. Another point is that the mutual coupling or direct coupling or communication connection shown or discussed can be an indirect coupling or communication connection through some interfaces, devices or units, which can be electrical, mechanical or other forms.

[0116] The units described as separate components may or may not be physically separated, and the components shown as units may or may not be physical units, that is, they may be located in one place or distributed on multiple network units. Some or all of the units may be selected according to actual needs to achieve the purpose of the solution of this embodiment.

[0117] In addition, each functional unit in each embodiment of the present invention may be integrated into one processing unit, or each unit may exist physically separately, or two or more units may be integrated into one unit. The above-mentioned integrated unit may be implemented in the form of hardware or in the form of software functional units.

[0118] The exemplary embodiments of the present disclosure described in detail above are merely illustrative and not restrictive. It should be understood by those skilled in the art that various modifications and combinations may be made to these embodiments or their features without departing from the principles and spirit of the present disclosure, and such modifications should fall within the scope of the present disclosure.

Claims

1. A multi-target nucleic acid specific detection method, characterized in that: The method comprises: 101, determining at least one target to be detected, and designing multiple specific PCR primers and a first amplification sequence thereof according to the sequence of the target to be detected; 102, designing a nested specific PCR primer and a second amplification sequence thereof based on a first amplification sequence of a single target to be detected; 103, using the multiple specific PCR primers to perform a first round of amplification on the target nucleic acid sample to be detected to obtain a PCR product; 104. Combining the nested specific PCR primer with the sequence at one end of the universal probe in Amplifluor to form a specific amplification primer, and using the specific amplification primer to detect the target to be detected to obtain a detection result.

2. The multi-target nucleic acid specific detection method according to claim 1, characterized in that: The method for obtaining the multiple specific PCR primers and the first amplification sequence thereof comprises: selecting the core gene or conserved region of the target to be detected, designing primers for the core gene or conserved region and filtering the primers to obtain the filtered first primers and amplification sequence; taking the sequence of the target to be detected as the reference sequence, and using the first primer and amplification sequence that are only uniquely aligned to the source target and not aligned to other targets as the multiple specific PCR primers and the first amplification sequence, respectively.

3. The multi-target nucleic acid specific detection method according to claim 1, characterized in that: The method for obtaining the nested-specific PCR primer and the second amplification sequence thereof comprises: selecting the first amplification sequence of a single target to be detected, designing primers for the first amplification sequence and filtering the primers to obtain the filtered second primers and amplification sequence; taking the first amplification sequence of the target to be detected as a reference sequence, and using the second primer and the amplification sequence that are only uniquely aligned to the first amplification sequence of its source target as the nested-specific PCR primer and the second amplification sequence, respectively.

4. The multi-target nucleic acid specific detection method according to claim 3, characterized in that: The filtering criteria of the second primer include: amplification length of 45-150 bp; primer length range of 18-23 bp; annealing temperature range of 57-63° C.; GC content range of 40-60%.

5. The multi-target nucleic acid specific detection method according to claim 1, characterized in that: After 103, the PCR product is purified by magnetic beads to obtain a purified PCR product.

6. The multi-target nucleic acid specific detection method according to any one of claims 1 to 5, characterized in that: The targets to be detected include any one or several of the following microbial species: Acinetobacter baumannii, Staphylococcus aureus, Escherichia coli and Klebsiella pneumoniae.

7. A computer device, characterized in that: The device comprises: a memory and a processor; the memory is used to store a computer program; the processor executes the computer program to implement the steps of the method according to any one of claims 1 to 6.

8. A computer-readable storage medium, characterized in that: A computer program is stored thereon, and when the computer program is executed by a processor, the steps of the method according to any one of claims 1 to 6 are implemented.

9. A computer program product, comprising a computer program, characterized in that When the computer program is executed by a processor, the steps of the method according to any one of claims 1 to 6 are implemented.

10. Any of the following applications: (1) Use of the method according to any one of claims 1 to 6 in the design of target-specific primers and probes; (2) Use of the method according to any one of claims 1 to 6 in target sequence detection; (3) Use of the method according to any one of claims 1 to 6 in the detection of microbial species.

Images