Immunofluorescence detection reagent for HCR signal amplification

Abstract

The invention relates to the technical field of immunofluorescence detection, in particular to an immunofluorescence detection reagent for HCR signal amplification. According to the invention, a double-stranded DNA product carrying a large amount of biotin is formed by utilizing linear hybridization chain reaction, and is linked with fluorescent dye labeled streptavidin, so that a constant fluorescent signal is amplified, the detection sensitivity is greatly improved, and high-sensitivity detection of disease markers such as proteins and small molecules is realized.

Description

Technical Field

[0001] The invention relates to the technical field of immunofluorescence detection, in particular to an immunofluorescence detection reagent for amplifying HCR signals. Background Art

[0002] In the field of modern medicine, the diagnosis and treatment of many diseases rely on certain detection technologies. Whether it is nucleic acids and proteins at the molecular level or analysis at the cellular level, high-sensitivity and high-specificity technologies are required to improve the accuracy of detection. At present, the commonly used detection methods in clinical practice mainly include nucleic acid amplification, immunofluorescence, chemiluminescence, colorimetry, immunochromatography, enzyme immunoassay, direct microscopy, etc. Immunofluorescence detection technology, as an important technical means of immune diagnosis, is a technology established on the basis of immunology, biochemistry and microscopy. According to the principle of antigen-antibody reaction, immunofluorescence first labels the known antigen or antibody with fluorescein to make a fluorescent marker, and then uses this fluorescent antibody (or antigen) as a molecular probe to detect the corresponding antigen or antibody. Immunofluorescence technology was proposed in the 1940s. After years of research and development, it still has the following shortcomings:

[0003] ① The problem of non-specific staining has not been completely solved, the objectivity of the result judgment is insufficient, and the technical procedures are still relatively complicated. In the process of antibody labeling of fluorescent molecules, strict requirements are placed on the performance of fluorescent molecules, antibody purity, and labeling technology, and there are problems such as the binding reaction of fluorescent molecules with tissue proteins. The background in general fluorescence determination is high, so it is difficult to use fluorescent immunoassay for quantitative determination. ② In immunofluorescence technology detection, the intensity of the fluorescent signal depends on the performance of the fluorescent dye / molecule. The fluorescent dyes such as FITC, TRITC, and Huaqing series currently used in immunofluorescence have the disadvantages of low fluorescence brightness, poor light resistance, and poor stability, which to a certain extent limit the detection sensitivity of the immunofluorescence method and the stability of the reagents. ③ The current immunofluorescence technology has limited detection sensitivity because the fluorescent signal is constant. It is difficult to popularize or widely use.

[0004] As mentioned above, due to the limitations of fluorescent labeling technology and the improvement of fluorescence performance itself, there have always been many defects such as non-specific staining, lack of objectivity in result judgment, complex technical procedures, and low fluorescence performance, making it difficult to achieve high-sensitivity quantitative detection.

[0005] HCR reaction is an in vitro nucleic acid isothermal signal amplification technology proposed by Pierce and Dirks in 2004. HCR does not require the assistance of enzymes, avoiding the influence of nonspecific amplification on the analysis results. The reaction conditions are mild and easy to control. The amplification of short-chain DNA can be achieved through one-step reaction under isothermal conditions. If this reaction is applied to fluorescence signal amplification, the detection sensitivity can be greatly improved, and high-sensitivity detection of disease markers such as proteins and small molecules can be achieved. Summary of the invention

[0006] In view of this, the technical problem to be solved by the present invention is to provide an immunofluorescence detection reagent based on HCR signal amplification.

[0007] The HCR reaction reagent provided by the present invention comprises: a trigger probe, an H1 probe and an H2 probe;

[0008] The trigger probe is linear and consists of fragment d and fragment c*;

[0009] The H1 probe is composed of fragment a, fragment b and fragment c, and its 5' end is labeled with biotin;

[0010] The H2 probe is composed of fragment a*, fragment c* and fragment b* and has a 3' end labeled with biotin;

[0011] in,

[0012] Fragment a is the reverse complement of fragment a* and has a length of 20 to 30 bp;

[0013] Fragment b is the reverse complement of fragment b* and has a length of 5 to 10 bp;

[0014] Fragment c is the reverse complement of fragment c*, with a length of 15 to 20 bp

[0015] Fragment d is ployA, with a length of 8 to 10 bp.

[0016] The present invention provides an immunofluorescence diagnostic reagent based on hybridization chain reaction (HCR) signal amplification. A linear hybridization chain reaction (HCR) system is used to amplify a constant immunofluorescence signal, thereby greatly improving the detection sensitivity and realizing high-sensitivity detection of disease markers such as proteins and small molecules. In the reagent, H1 and H2 probes are labeled with biotin, and a linear hybridization chain reaction forms a double-stranded DNA product carrying a large amount of biotin, which is linked to an excess of fluorescent dye-labeled streptavidin in the system, thereby amplifying the constant fluorescence signal, greatly improving the detection sensitivity, and realizing high-sensitivity detection of disease markers such as proteins and small molecules.

[0017] Specifically, in the HCR reaction reagent provided by the present invention,

[0018] The nucleic acid sequence of fragment a is CTAGGACCAATCGCGCGTTGGTCA (SEQ ID NO: 1);

[0019] The nucleic acid sequence of fragment b is AAGGCCT (SEQ ID NO: 2);

[0020] The nucleic acid sequence of fragment c is GCGCACTCGGATAGTTC (SEQ ID NO: 3).

[0021] More specifically, in the HCR reaction reagent provided by the present invention,

[0022] The nucleic acid sequence of the trigger probe is shown in SEQ ID NO:4;

[0023] The nucleic acid sequence of the H1 probe is shown in SEQ ID NO:5;

[0024] The nucleic acid sequence of the H2 probe is shown in SEQ ID NO:6.

[0025] The present invention also provides the use of the aforementioned HCR reaction reagent in preparing a signal reporting reagent for immune detection.

[0026] The present invention also provides an immunofluorescence detection reagent, which comprises reagent A, reagent B, reagent C and the HCR reaction reagent as described above;

[0027] The reagent A includes a solid phase carrier coated with a capture antibody;

[0028] The reagent B includes a biotin-labeled detection antibody;

[0029] The reagent C includes a conjugate of a fluorescent dye and streptavidin.

[0030] In the present invention, the capture antibody and the detection antibody both target the analyte in the sample, and the antibody may be a monoclonal antibody or a polyclonal antibody. Any antibody that can specifically bind to the target to be detected is within the protection scope of the present invention.

[0031] In the present invention, the solid phase carrier is magnetic beads. Preferably, the solid phase carrier is carboxyl magnetic beads.

[0032] In the present invention, the fluorescent dye is Alexa Series, DyLight TM Series, iFluor TM Series of dyes, among which, The dye introduces sulfonate groups into dyes such as coumarin, xanthene (such as fluorescein and rhodamine), cyanine, etc. through chemical synthesis methods, making Alexa dyes negatively charged and hydrophilic, so that Alexa has better optical stability, luminous intensity and pH adaptability. iFluorTM dyes are a series of fluorescent marker dyes that can cover the entire visible spectrum. All iFluor dyes have excellent water solubility. Their hydrophilicity minimizes the use of organic solvents. iFluor dyes also have better labeling performance than classic fluorescent marker dyes. DyLightTM series fluorescent dyes are a new type of fluorescent dye that has been widely used in recent years, with good spectral width, stronger fluorescence intensity, higher optical tolerance (anti-fading), insensitive to pH, smaller molecules and better permeability. In an embodiment of the present invention, Alexa Fluor 488 is used as a fluorescent dye.

[0033] In the present invention,

[0034] The buffer of the reagent 1 [R1a] is a phosphate buffer solution (1×PBS, pH 7.4), containing a surfactant (0.05% Tween-20), a stabilizer bovine serum albumin (0.1% BSA), and a preservative (<0.1% ProClin300);

[0035] The buffer of the reagent 2 [R1b] is a phosphate buffer solution (1×PBS, pH 7.4), containing a stabilizer bovine serum albumin (0.2% BSA), and a preservative (<0.1% ProClin300);

[0036] The buffer of reagent 3 [R1c] is sodium phosphate buffer (0.01 M, pH 7.5), containing 0.1 M NaCl, 2 mM EDTA and preservative (<0.1% ProClin 300).

[0037] The present invention also provides an immunofluorescence detection method, which comprises: detecting a sample with the immunodetection reagent as described above.

[0038] In the present invention, the immunofluorescence detection method is a universal improvement on the fluorescent signal amplification system, and can be applied to immunodetection for diagnostic purposes or to immunodetection for non-diagnostic purposes, and the present invention does not limit this.

[0039] In the present invention, the detection step includes:

[0040] The detection antibody in reagent 1 [R1a] is brought into contact with the sample, and then specifically recognized by the detection antibody in reagent 2 [R1b]. A biotin-avidin bridge is established with reagent 3 [R1c] to link the detection antibody in reagent 2 [R1b]. The signal is then amplified with the trigger probe, H1 probe, and H2 probe as described above, and the fluorescence signal is detected.

[0041] The present invention adopts the indirect sandwich immunization principle. The specific antibody is connected to the solid phase carrier to form a solid phase antibody, and the unbound antibody and impurities are washed away. The specimen to be tested is added and allowed to contact and react with the solid phase antibody for a period of time, so that the antigen in the specimen is combined with the antibody on the solid phase carrier to form a solid phase antigen complex. Other unbound substances are washed away, and the detection antibody is added to allow the antigen on the solid phase immune complex to combine with the detection antibody. Then, the probe in the HCR signal amplification reagent is used to perform a linear hybridization chain reaction to form a double-stranded DNA product carrying a large amount of biotin, which is linked to the excess fluorescent dye-labeled streptavidin in the system, thereby amplifying the constant fluorescent signal.

[0042] The samples of the present invention include any samples that can be recognized by antibodies, including but not limited to samples from plants, animals or microorganisms. The samples from animals are samples from humans or other animals, including but not limited to blood, serum, plasma, and ex vivo tissues.

[0043] The present invention provides an immunofluorescence detection reagent for HCR signal amplification, which has at least one of the following advantages:

[0044] a. The present invention uses biotin to label the detection antibody and forms a fluorescent immune complex using a biotin-streptavidin bridge, replacing the method of directly labeling the antibody with fluorescence, avoiding a series of problems existing in the fluorescent labeling antibody method, thereby improving the specificity of the detection.

[0045] b. Improved sensitivity and stability of immunofluorescence technology. The present invention uses a new generation of fluorescent dyes as streptavidin markers, which have the advantages of stronger fluorescence brightness and lower sensitivity to the environment.

[0046] c. The present invention utilizes linear hybridization chain reaction to form a double-stranded DNA product carrying a large amount of biotin, which is linked to fluorescent dye-labeled streptavidin, thereby amplifying the constant fluorescent signal, greatly improving the detection sensitivity, and achieving high-sensitivity detection of disease markers such as proteins and small molecules. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The dose response curve of CEA calibrator is shown;

[0048] Figure 2Shows an OLR scatter plot (with the x-axis representing the reference method and the y-axis representing the method to be evaluated);

[0049] Figure 3 The relative deviation diagram is shown (the x-axis represents the concentration of the analyte and the y-axis represents the relative deviation between the method to be evaluated and the reference method. DETAILED DESCRIPTION

[0050] The present invention provides immunofluorescence detection reagents for HCR signal amplification, and those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described by preferred embodiments, and relevant personnel can obviously change or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.

[0051] The present invention uses an HCR system as a signal amplification system. 488 labeled streptavidin excites the fluorescence signal to further amplify. Hybridization chain reaction (HCR) is an efficient nucleic acid probe signal amplification method that uses the competition between nucleic acid chains to achieve hybridization and uses this as an energy source to achieve signal amplification. The reaction has the characteristics of isothermal and enzyme-free. The HCR system includes a trigger chain Trigger, biotinylated hairpin structures H1 and H2, with biotin labeled at the 5' end of H1 and the 3' end of H2. Before adding the Trigger, the HCR is denatured and renatured, and the two biotinylated probes H1 and H2 are diluted to a certain concentration with buffer respectively, and heated to 95°C using a PCR amplification instrument, kept at a constant temperature for 5 minutes, and then cooled to room temperature at a rate of 1°C / min. When there is no primer (Trigger) in the HCR reaction system, H1 and H2 coexist stably in the solution; when the Trigger is added, the Trigger acts as a trigger chain and combines with the stem and sticky end of the hairpin probe H1, opening the hairpin structure for hybridization chain reaction, and the exposed part of H1 after the reaction is opened combines with the stem and sticky end of H2 by base complementary pairing, triggering H2 to start the reaction, and the exposed part of H2 after opening is consistent with the base sequence of the Trigger trigger chain, so that H1 can continue to open, resulting in a Trigger-H1-H2-H1-H2-cycle reaction. The reaction forms a double-stranded DNA product. Since both hairpin probes H1 and H2 are labeled with biotin, a large amount of biotin is contained in the double-stranded DNA product.

[0052] The present invention uses superparamagnetic, surface-modified carboxyl functional groups, and carboxyl magnetic beads with uniformity CV <4% as solid phase carriers. EDC / NHS is added for activation treatment, and the carboxylate (-COOH) may react with NHS or sulfo-NHS to form a semi-stable NHS or sulfo-NHS ester. An appropriate amount of capture antibody is dispersed in a MEST buffer of pH 6.0, and the magnetic beads are re-dispersed with this solution, and the solution is added to the completely washed magnetic beads. Incubate for 2 hours at room temperature, NHS or sulfo-NHS ester can continue to react with the primary amine (-NH2) on the antibody to form a stable amide bond to connect the magnetic beads to the capture antibody. After the coupling is completed, a sufficient amount of PBST solution is added for vortex washing. TBST buffer is added in sequence for quenching, and a PBS buffer containing 3% BSA is added as a blocking agent, and the magnetic beads are re-dispersed, and blocked overnight at 4°C to block the activated carboxyl groups that are not involved in the reaction.

[0053] The present invention adopts the sandwich immunity principle. The specific antibody is connected to the solid phase carrier to form a solid phase antibody, and the unbound antibody and impurities are washed away. The specimen to be tested is added and allowed to contact and react with the solid phase antibody for a period of time, so that the antigen in the specimen is combined with the antibody on the solid phase carrier to form a solid phase antigen complex. Other unbound substances are washed away, and the detection antibody is added to allow the antigen on the solid phase immune complex to combine with the detection antibody. The detection antibody is labeled with biotin, and biotin and N-hydroxysuccinamide are condensed under the action of carbodiimide to generate biotin N-hydroxysuccinimide ester (BNHS). The -C=O group in the ester bond of the BNHS molecule can be combined with the free amino group on the antibody, thereby covalently combining biotin and the antibody.

[0054] The present invention adopts Alexa 488 labeled streptavidin as a fluorescent signal. 488 Streptavidin is composed of a biotin-binding protein (streptavidin) and a fluorescent marker (Alexa It is a green fluorescent dye covalently bonded to a fluorescent group with an Amax (maximum excitation wavelength) of 493nm and an Emax (maximum emission wavelength) of 519nm. It has high fluorescence quantum yield and high photostability. Alexa Fluor 488 dye molecules can be attached to proteins at a high molar ratio to achieve brighter conjugates and more sensitive detection. 488 labeled streptavidin was diluted in the buffer of reagent 3 [R1c] (sodium phosphate buffer (0.01M, pH 7.5), containing 0.1M NaCl, 2mM EDTA and preservative (<0.1% ProClin300)), and an appropriate amount was added to the solid phase immune complex. Streptavidin was linked to the biotin labeled on the detection antibody to release the fluorescent signal.

[0055] When Alexa Fluor is added to the immune complex (carboxyl magnetic beads-capture antibody-test sample-detection antibody) 488 labeled streptavidin and HCR reaction system are combined to form a complete immunoassay process: carboxyl magnetic beads-capture antibody-test sample-detection antibody-Alexa 488 labeled streptavidin-HCR system. HCR starts a hybridization chain reaction under the action of the trigger chain, forming a long double-stranded DNA carrying a large amount of biotin, Alexa 488-labeled streptavidin is in excess, so a large amount of biotin on the double-stranded DNA will bind to Alexa Fluor The fluorescent signal was amplified and detected by flow cytometry.

[0056] The present invention provides the following HCR sequence:

[0057] Table 1 HCR sequences

[0058]

[0059] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0060] The present invention will be further described below in conjunction with embodiments:

[0061] Example 1 Preparation of detection reagents using human carcinoembryonic antigen (CEA) as an example

[0062] The reagent preparation method of the present invention and the reagents used in the embodiments of the present invention can be purchased on the market or obtained by synthesis.

[0063] 1) Prepare reagent 1 [R1a] paramagnetic microparticles coated with CEA monoclonal capture antibody.

[0064] use MagCOOH carboxyl magnetic beads (Suzhou Zhiyi Microspheres, catalog number 20210623), preferably, particle size 3 μm; particle size uniformity: CV <4%; surface functional group: carboxyl (-COOH); carboxyl density: 200 μmol / g.

[0065] After mixing the magnetic beads in the solution, take an appropriate amount into a centrifuge tube, remove the supernatant, and wash the magnetic beads 3 times with the prepared MEST buffer (50mM MES, pH6.0, 0.05% Tween 20). Take an appropriate amount of newly prepared EDC (1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride) solution and an equal volume of NHS (N-hydroxysuccinimide) solution to disperse the magnetic beads (preferably, the concentration of EDC solution is 50mg / mL, and the concentration of NHS solution is 50mg / mL), and activate for 40min at 25°C.

[0066] Disperse an appropriate amount of capture antibody in MEST buffer, and use this solution to disperse the activated magnetic beads, and couple at 25°C for 3 hours or at 4°C overnight. After coupling, magnetic separation was performed and the supernatant was discarded, and TBST buffer (0.1MTris-HCl buffer, PH 7.4, 0.05% Tween 20) was added, and the excess carboxyl groups were quenched by rotation mixing for 30 minutes at 25°C. The supernatant was discarded after magnetic separation, 3% BSA buffer was added, and the magnetic beads were re-dispersed, and the unreacted activated carboxyl groups were rotated and mixed for 1 hour at 25°C. After blocking, the supernatant was removed by magnetic separation, and the magnetic beads were washed 3 times with PBST buffer (1×PBS, PH 7.4, 0.05% Tween20), and the preservation solution (1×PBS, PH7.4, 0.05% Tween-20, 0.1% BSA, <0.1% ProClin300) was added and re-dispersed, with a final concentration of 0.72mg / mL. Store at 2-8°C.

[0067] 2) Prepare reagent 2 [R1b] biotinylated CEA detection antibody.

[0068] CEA monoclonal antibody Anti-CEAMcAb (labeling) (Shanghai Lingchao Biotechnology, catalog number L1C00205) was used as the detection antibody to be labeled. Use an analytical balance to weigh a certain amount of biotin and dissolve it in dimethyl sulfoxide (DMSO) to prepare a 10mM biotin reagent solution. Add an appropriate amount of biotin reagent solution to the detection antibody to be labeled, and incubate for 30 minutes at 25°C in the dark. Add an appropriate amount of 1mol / L ammonium chloride solution, rotate and mix at 25°C for 10 minutes to terminate the labeling reaction. Use a dialysis bag with a suitable molecular weight cutoff to fully dialyze the biotin-labeled detection antibody reaction solution at 4°C. Add preservation solution (1×PBS, PH7.4, 0.2% BSA, <0.1% ProClin300) to a final concentration of 6mg / L. Store at 2-8°C.

[0069] 3) Preparation of reagent 3[R1c]Alexa 488 labeled with streptavidin.

[0070] Using Alexa 488 labeled streptavidin (Shanghai Yisheng Biotechnology Co., Ltd., catalog number 35103ES60), added to the preservation solution (0.01M sodium phosphate, pH 7.5, 0.1M NaCl, 2mM EDTA, <0.1% ProClin300), the final concentration is 9mg / L. Store at 2-8°C.

[0071] 4) Prepare reagent 4 [R1d] HCR reagent. HCR reagents are divided into HCR-A (Trigger reagent) and HCR-B (H1, H2 synthesis reagent). Centrifuge each primer of the HCR reagent (Shanghai Sangon Biotechnology) using a desktop centrifuge (4000rpm, 30-60s). Add appropriate amount of buffer to Trigger, H1, and H2 respectively (the recommended components are sodium phosphate buffer (0.01M, PH7.5), containing 0.1MNaCl, 2mMEDTA and preservatives (<0.1% ProClin300), and fully dissolve and dilute to 10uM solution. After protecting the H1 probe and H2 probe from light, put them in a constant temperature water bath oscillator, keep the temperature at 90°C for 5 minutes, then turn off the constant temperature water bath oscillator, and let it cool freely to about 37°C at room temperature. Store in the dark at 2-8°C.

[0072] Example 2: Detection using human carcinoembryonic antigen (CEA) as an example

[0073] The detection effect of the reagent described in Example 1 was verified using CEA as the object.

[0074] 1) Prepare the concentration gradient solution of CEA antigen calibrator. The gradient concentration calibrator contains 0, 5, 20, 40, 60, 100 ng / mL of CEA antigen (Shanghai Lingchao Biotechnology, catalog number L2C01001), and the solution used is 1×PBS PH7.4, containing 1% BSA, 5% trehalose, 0.5% Tween 20, 1% EDTANa2, and 0.1% Proclin 300. Store at 2-8°C.

[0075] 2) Take 50 μL of serum sample (source: Laboratory Department, Xiangya Third Hospital, Central South University), add 20 μL of reagent 1 [R1a], 50 μL of reagent 2 [R1b], and 20 μL of reagent 3 [R1c], and incubate for 30 minutes at 37°C in the dark. Separate the reaction mixture by magnetic separation, and wash once with PBST (PH 7.4, 0.05% Tween 20) buffer. Add 10 μL of reagent HCR-A and 20 μL of reagent HCR-B, and incubate for 18 minutes at 37°C in the dark. Separate the reaction mixture by magnetic separation, and wash once with PBST (PH 7.4, 0.05% Tween 20) buffer. Add PBS (1×, PH 7.4) to resuspend the magnetic beads.

[0076] 3) Using flow cytometer (model BD LSRFortessa TM , FITC channel) measurement results, and the fluorescence intensity value was obtained by flow analysis software.

[0077] 4) The average fluorescence intensity of each concentration gradient of CEA calibrator is shown in Table 2. The dose-response curve is drawn according to the polynomial curve fitting based on the signal value and concentration value of the calibrator, as shown in Figure 1 As shown, in the linear range of [0.2, 100] ng / mL concentration interval, the linear correlation coefficient (r) of the dose-response curve was ≥ 0.9900.

[0078] Table 2

[0079] Concentration (ng / mL) 0 5 20 40 60 100 Fluorescence intensity (au) 59.3 2035 5396 8717 11634 14671

[0080] 5) Substitute the fluorescence intensity value of the serum sample in step 2) into the standard curve of the calibrator in step 4) to calculate the human CEA concentration in the sample to be tested, which is basically consistent with the test result using the chemiluminescence immunoassay method (the method used by the laboratory), see Table 3.

[0081] Table 3

[0082] Sample No. Measured fluorescence intensity (au) Measured concentration (ng / mL) Concentration measured in hospital (ng / mL) C100214 1806.52 5.4 5.37 C100221 4808.24 18.5 18.16 C100230 13,121.03 73.64 72

[0083] Example 3 Taking human carcinoembryonic antigen (CEA) as an example, the method described in the present invention is used to evaluate the analytical performance.

[0084] 1) Sensitivity. Using a flow cytometer detection system, two reagent batches were tested in the same laboratory by the same operator (group) on the same instrument on three working days on five blank samples and five low-concentration samples. Each sample was tested four times. The test results were statistically analyzed. The results are shown in Table 4 below.

[0085] Table 4

[0086] parameter Reagent Batch 1 Reagent Batch 2 LoB 0.051 0.064 LoD 0.093 0.091

[0087] The blank limit of the reagent prepared by this method is 64ρg / mL, and the detection limit is 93ρg / mL.

[0088] 2) Linear range. In the same laboratory, by the same operator (group) on the same instrument, each level sample is tested 3 to 4 times. All samples can be measured in one run or randomly measured in several runs with very short intervals. The test process is completed within 1 day. 11 concentration levels are selected within the expected measurement range. The results are shown in Table 5 below.

[0089] Table 5

[0090] Concentration level Dilution Measured mean Best-fit equation estimate Measurement bias Linear Sample 1 0.0000 0.21 0.21 0.90％ Linear Sample 2 0.0125 5.08 4.91 3.44％ Linear Sample 3 0.0250 12.30 12.56 -2.07％ Linear Sample 4 0.0500 50.00 49.62 0.76％ Linear Sample 5 0.1000 114.64 109.22 4.96％ Linear Sample 6 0.2000 220.31 208.65 5.59％ Linear Sample 7 0.3000 310.02 300.35 3.22％ Linear Sample 8 0.4000 417.36 418.63 -0.30％ Linear Sample 9 0.5000 528.32 527.35 0.18％ Linear Sample 10 0.6000 651.92 667.92 -2.40％ Linear Sample 11 0.7000 795.75 791.86 0.49％ Linear Sample 12 0.8000 906.12 879.79 2.99％ Linear Sample 13 0.9000 1025.35 998.13 2.73％ Linear Sample 14 1.0000 1247.82 1217.56 2.49％

[0091] Through data analysis, the absolute bias or relative bias of each dilution result was <8%, the regression coefficient r>0.99, and the linear range (measurement range) established by the reagent of this method was 0.21-1247.82 ng / mL.

[0092] 3) Stability. Each reagent was placed in a 37°C constant temperature incubator, and the original unopened reagent was taken for testing on the 1st, 3rd, 5th and 7th day. The results are shown in Table 6 below. The reagents of this method have good stability.

[0093] Table 6

[0094]

[0095] 3) Accuracy. 120 human serum samples with analyte concentrations ranging from 0 to 300 ng / mL (within the linear range) were used, and each sample was tested once on both the comparison method and the product to be evaluated. The test results were statistically analyzed as follows: Figure 3 The results show that the method and the reference method (electrochemiluminescence method) can determine samples of different concentrations within the linear range, the OLR linear regression equation is y=1.0401x-1.0838, the correlation coefficient is r>0.99, and the relative deviation is <±10%.

[0096] As can be seen from the above test results, the method and reagent of the present invention have good sensitivity, accuracy and stability. Not only do they have better effects than reagents in the prior art (such as reagents that rely on electrochemiluminescence), the method and reagent of the present invention achieve improved sensitivity, accuracy and stability through optimization of probe design and adjustment of reagents, and compared with other reagents, the analytical performance is greatly improved and has stronger clinical applicability.

[0097] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. HCR reaction reagent, comprising: tr igger probe, H1 probe, and H2 probe; The trigger probe is linear and consists of fragment d and fragment c*; The H1 probe is composed of fragment a, fragment b and fragment c, and its 5' end is labeled with biotin; The H2 probe is composed of fragment a*, fragment c* and fragment b* and has a 3' end labeled with biotin; in, Fragment a is the reverse complement of fragment a* and has a length of 20 to 30 bp; Fragment b is the reverse complement of fragment b* and has a length of 5 to 10 bp; Fragment c is the reverse complement of fragment c*, with a length of 15 to 20 bp Fragment d is ployA, with a length of 8 to 10 bp.

2. The HCR reaction reagent according to claim 1, characterized in that The nucleic acid sequence of fragment a is shown in SEQ ID NO: 1; The nucleic acid sequence of fragment b is shown in SEQ ID NO: 2; The nucleic acid sequence of fragment c is shown in SEQ ID NO:

3.

3. The HCR reaction reagent according to claim 1 or 2, characterized in that The nucleic acid sequence of the trigger probe is shown in SEQ ID NO:4; The nucleic acid sequence of the H1 probe is shown in SEQ ID NO:5; The nucleic acid sequence of the H2 probe is shown in SEQ ID NO:

6.

4. Use of the HCR reaction reagent according to any one of claims 1 to 3 in the preparation of a signal reporting reagent for immunoassay.

5. An immunofluorescence detection reagent, characterized in that: It comprises reagent 1 [R1a], reagent 2 [R1b], reagent 3 [R1c] and the HCR reaction reagent according to any one of claims 1 to 3; The reagent 1 [R1a] includes a solid phase carrier coated with a capture antibody; The reagent 2 [R1b] includes a biotin-labeled detection antibody; The reagent 3 [R1c] includes a conjugate of a fluorescent dye and streptavidin.

6. The immunofluorescence detection reagent according to claim 5, characterized in that: The solid phase carrier is magnetic beads.

7. The immunofluorescence detection reagent according to claim 5, characterized in that: The fluorescent dye is Series, DyLight TM Series, iFluor TM Series of dyes.

8. The immunofluorescence detection reagent according to claim 5, characterized in that: The buffer of the reagent 1 [R1a] is a phosphate buffer solution (1×PBS, pH 7.4), containing a surfactant (0.05% Tween-20), a stabilizer bovine serum albumin (0.1% BSA), and a preservative (<0.1% ProClin300); The buffer of the reagent 2 [R1b] is a phosphate buffer solution (1×PBS, pH 7.4), containing a stabilizer bovine serum albumin (0.2% BSA), and a preservative (<0.1% ProClin300); The buffer of the reagent 3 [R1c] is sodium phosphate buffer (0.01 M, pH 7.5), containing 0.1 M NaCl, 2 mM EDTA and preservative (<0.1% ProClin 300).

9. Immunofluorescence detection method, characterized in that, include: The sample is tested using the immunoassay reagent according to any one of claims 5 to 8.

10. The immunofluorescence detection method according to claim 9, characterized in that: The steps of the detection include: The detection antibody in reagent 1 [R1a] is brought into contact with the sample, and then detection is performed with the detection antibody in reagent 2 [R1b]. The detection antibody in reagent 2 [R1b] is then specifically recognized by reagent 3 [R1c]. The signal is then amplified with the trigger probe, H1 probe, and H2 probe described in any one of claims 5 to 8, and then the fluorescent signal is detected.

Images