Application of exosome long-chain non-coding RNA in lung cancer treatment

Abstract

The invention discloses an application of lncRNAROLLCSC serving as a target spot in screening of drugs for treating lung cancer, and an application of lncRNAROLLCSC and CDC42 serving as a combined target spot in screening of drugs for treating lung cancer. The research proves that the lncRNA ROLLCSC enters the exosome in a form of being combined with CDC42 protein to carry out heterogeneity tumor intercellular exchange for the first time; demethylase FTO and an m6A reader IGF2BP2 are used for stabilizing the expression of ROLLCSC, so that the occurrence and development of tumors are further promoted; the specific mechanism of the lncRNA ROLLCSC / Wnt / beta-Catenin / MYC / CDC42 axis for promoting the lung cancer cell metastasis is provided; the ROLLCSC / CDC42 positive feedback axis enhances the uptake of the recipient cells to the exosome. The invention provides a new target and a treatment strategy for the treatment of lung cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an application of exosome long-chain non-coding RNA in the treatment of lung cancer. Background Art

[0002] Lung cancer is the leading cause of cancer death, with the highest incidence and mortality. The development of molecular biology technology has promoted the study of the molecular mechanism of lung cancer, brought new diagnostic and therapeutic methods, and increased patient treatment options. Lung cancer is divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), of which NSCLC has a higher incidence, and the early symptoms of lung cancer are not obvious, and the survival rate is low, which is affected by many factors. Tumor heterogeneity is critical in advanced cancer, among which tumor stem cells play an important role in the tumor microenvironment. Tumor stem cells originate from gene mutations or stemness of normal cells. They were first discovered in acute myeloid leukemia, and then tumor stem cells were isolated from other cancers. Lung cancer stem cells were successfully screened and isolated in 2008. Tumor stem cells communicate with other components in the tumor microenvironment to maintain an environment that promotes tumor growth and progression. At present, the impact of tumor stem cells on non-stem cells and their further promotion of tumor development are still new areas to be explored.

[0003] Exosomes carry small molecules including proteins, lipids, DNA, etc. They are functional vesicles with a diameter of 40-160nm. Studies have shown that changes in the expression of specific components in exosomes are closely related to tumor metastasis and play an important role in all stages of metastasis. Various stromal cells in the tumor microenvironment (TME) can transmit non-coding RNA through exosomes, exchange information with tumor cells, and promote tumor spread. The non-coding RNA in the exosomes released by tumor cells can directly affect tumor cells, enhance their migration and invasiveness, and promote tumor metastasis. A 2014 study showed that breast cancer cells can transfer miR-200 molecules to breast cancer cells with weaker metastatic ability through exosomes, thereby enhancing the latter's metastatic ability.

[0004] Long noncoding RNA is a type of RNA molecule with more than 200 nucleotides. It can regulate gene expression at the epigenetic, transcriptional and post-transcriptional levels and has cell or tissue specific expression. Many studies have confirmed that the incidence and progression of lung cancer are closely related to the expression levels of various long noncoding RNAs (lncRNAs). Abnormal expression of lncRNA may become a potential biomarker for predicting lung cancer prognosis and disease progression, and help to evaluate and identify the survival of different subtypes of lung cancer. Studies have found that lncRNATP73-AS1 has a promoting effect on lung cancer cell metastasis, which is due to the activation of the Wnt / β-catenin signaling pathway in lung adenocarcinoma. In addition, it has been reported that HOTAIR is an upregulated lncRNA in lung cancer, which promotes cell proliferation, migration and invasion by regulating gene expression, including E-cadherin and N-cadherin; it is also involved in regulating the EMT process and cancer stem cell characteristics. Long noncoding RNA also plays an inhibitory role in lung cancer metastasis and invasion. For example, the expression of lncRNA NKILA in lung cancer tissue is significantly lower than that in adjacent tissues. It may inhibit the proliferation and metastasis of lung cancer through the IL-11 / STAT3 signaling pathway.

[0005] At present, the study of the interaction and mechanism between exosomes and lncRNA is still a hot topic in scientific research. There are many mechanisms for sorting cargo in exosomes, including the ESCRT (endosomal sorting complex)-dependent sorting mechanism, which acts synergistically on ubiquitinated proteins on the endosomal membrane to promote the sorting of these proteins into endosomal vesicles. In addition, there are ESCRT-independent pathways, including the melanosome pathway, the sphingomyelinase pathway, and the ATP racing box transporter (ABT) pathway, which may also be involved in the sorting of lncRNA. In addition, RNA binding proteins (RBPs) have a key function in the exosomal sorting of RNA. Many RBPs are involved in the exosomal sorting of miRNA in different cell models. For example, the FMR1 protein can bind to specific sequence motifs in miRNA and import miRNA into exosomes through interaction with the ESCRT pathway. In addition, RNA-binding proteins (RBPs) can also bind to specific sequences on lncRNA to form RBPs-lncRNA complexes, which may be directly loaded into exosomes, or the complexes may dissociate after RBPs are ubiquitinated, allowing lncRNA to be directly loaded into exosomes.

[0006] After exosomes carry functional small molecules into the recipient cells, they participate in regulating intercellular signal transduction by releasing their contents, thereby affecting the function and behavior of the recipient cells or changing the tumor microenvironment. For example, Chen et al. found that heterogeneous nuclear ribonucleoprotein A2B1 (hnRNPA2B1) can directly interact with long non-coding RNA LNMAT2, prompting LNMAT2 to enter the exosomes. After entering the recipient cells, by recruiting hnRNPA2B1, the H3K4 trimethylation level on the PROX1 promoter is increased, and the expression of PROX1 is upregulated, leading to lymphangiogenesis and lymphatic metastasis. Yi et al. found that lncRNAH19 is packaged into exosomes by hnRNPA2B1-specific mediators, secreted and transferred to non-resistant non-small cell lung cancer cells, thereby inducing gefitinib resistance. In addition, lncRNA in exosomes can affect gene expression by competitive binding with miRNA. For example, lncRNAH19 can affect the expression of KLF4 and VEGF by competitively binding with miR-7, thereby regulating the migration and invasion of lung adenocarcinoma cells. Kong et al. found that cancer cell-derived exosomes LINC00313 promoted the differentiation of M2 macrophages in non-small cell lung cancer by upregulating STAT6 as a miR-135a-3p sponge. At present, the interaction mechanism between lncRNA and exosomes in tumor stem cells and their transport to recipient non-stem cells remains uncertain, which will be one of the research focuses of this topic.

[0007] CDC42 protein is a member of the Rho GTPase family and plays an important role in a variety of biological processes. CDC42 plays an important role in cell adhesion, cytoskeleton structure formation and cell cycle regulation, affecting cell proliferation, transformation and homeostasis, as well as cell migration and invasion in tumor formation. However, there are few studies on the interaction between lncRNA and CDC42 protein and the mechanism by which CDC42 promotes the uptake of exosomes by receptor cells, which needs further exploration. Summary of the invention

[0008] The present invention studies the interaction between long non-coding RNA ROLLCSC and protein CDC42, and the effects of both on the occurrence and development of lung cancer, and finds that CDC42 protein can directly bind to long non-coding RNA ROLLCSC, carry lncRNA ROLLCSC into exosomes, and transfer from lung cancer stem cells (LLC-SD) to non-stem lung cancer cells (LLC). After reaching LLC, lncRNA ROLLCSC is released and binds to FTO. FTO acts as a demethylase to demethylate lncRNA ROLLCSC to increase its stability, which further promotes the metastatic ability of LLC. In addition, we also found that lncRNA ROLLCSC can enhance the transcription of the CDC42 gene by activating the transcription factor MYC in the Wnt signaling pathway, forming a ROLLCSC / CDC42 positive feedback loop, thereby promoting the absorption of exosomes by lung cancer cells LLC. Based on this, the present invention protects the following technical solutions:

[0009] The first aspect of the present invention provides the use of lncRNA ROLLCSC as a target in screening drugs for treating lung cancer.

[0010] The second aspect of the present invention provides the use of lncRNAROLLCSC and CDC42 as joint targets in screening drugs for treating lung cancer.

[0011] In the above-mentioned application technology solution, the lncRNAROLLCSC is the lncRNA in the exosomes.

[0012] In the above-mentioned application technology scheme, the exosomes shown are derived from lung cancer cells.

[0013] In the above-mentioned application technology scheme, lncRNA ROLLCSC and / or CDC42 are inhibited to inhibit the metastasis of lung cancer cells and the progression of tumors.

[0014] In the above-mentioned application technology scheme, CDC42 protein directly binds to lncRNAROLLCSC, carries lncRNAROLLCSC into exosomes, and transfers from lung cancer stem cells to non-stem lung cancer cells; inhibiting lncRNAROLLCSC and / or CDC42 inhibits the metastasis of non-stem lung cancer cells.

[0015] The third aspect of the present invention provides the use of an agent for inhibiting the expression of lncRNA ROLLCSC and / or CDC42 in the preparation of a drug for treating lung cancer.

[0016] The reagents include nucleic acid molecules, proteins, and compounds.

[0017] The nucleic acid molecule includes siRNA, and the sequence of the siRNA inhibiting lncRNA ROLLCSC is: AGGAGAGAAAGAGGAAGAAAGAATT; the sequence of the siRNA inhibiting CDC42 is: GCAGACAATTAAGTGTGTTGTTGTT.

[0018] In the above-mentioned application technology solution, the nucleotide sequence of the lncRNAROLLCSC is shown as SEQ ID NO.14.

[0019] The beneficial effects of the present invention are:

[0020] (1) It was revealed for the first time that lncRNA ROLLCSC enters exosomes by binding to CDC42 protein and communicates between heterogeneous tumor cells.

[0021] (2) For the first time, we confirmed that the demethylase FTO and the m6A reader IGF2BP2 stabilize the expression of ROLLCSCs, thereby further promoting the occurrence and development of tumors.

[0022] (3) For the first time, the specific mechanism by which the lncRNA ROLLCSC / Wnt / β-Catenin / MYC / CDC42 axis promotes lung cancer cell metastasis was elucidated.

[0023] (4) For the first time, we demonstrated that the ROLLCSC / CDC42 positive feedback axis enhanced the uptake of exosomes by recipient cells.

[0024] (5) It provides new targets and new treatment strategies for lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The results show the screening and identification of target lncRNAs and verification of their differential expression in LLC-SD and LLC cells and exosomes: A. Sequencing volcano plots of LLC-SD exosomes and LLC exosomes; B. Detection of lncRNA ROLLCSC expression in LLC-SD-exo and LLC-exo; C. Detection of lncRNA ROLLCSC expression in LLC-SD cells and LLC cells; D. Changes in lncRNA ROLLCSC expression after the addition of RNase and TritonX-100 to LLC-SD EVs.

[0026] Figure 2 Shown: A. Screening of EVs-related RBPs that specifically bind to the positive strand of ROLLCSC; B. Verification of siRNA knockdown efficiency; C. Knocking down the corresponding genes in LLC-SD to observe their effects on ROLLCSC.

[0027] Figure 3Showing that lncRNA ROLLCSC directly binds to CDC42 protein: A. RIP experiment of lncRNA ROLLCSC and CDC42; B. RNA pulldown experiment confirms that CDC42 directly binds to ROLLCSC.

[0028] Figure 4 It shows that DC42 protein carries lncRNA ROLLCSC into exosomes: A. After knocking down CDC42 in LLC-SD, the expression of ROLLCSC in LLC decreased; B. After knocking down CDC42 in LLC-SD, the migration ability of LLC decreased; C. After knocking down CDC42 in LLC-SD, the invasion ability of LLC decreased.

[0029] Figure 5 The results of screening m6A methylation-related proteins are shown: A. The m6A methylation level decreased after overexpression of lncRNA ROLLCSC; B. The secondary structure and potential methylation sites of lncRNA ROLLCSC.

[0030] Figure 6 The binding relationship between FTO, IGF2BP2 and ROLLCSC is shown: A. RIP experiment confirmed that FTO directly binds to ROLLCSC; RIP experiment (B) RNA pull-down experiment (C) confirmed that IGF2BP2 directly binds to ROLLCSC.

[0031] Figure 7 The effect of FTO on the stability and methylation expression of ROLLCSC is shown: A. After the addition of FTO inhibitor FB23, the expression of ROLLCSC decreased; B. Actinomycin D experiment showed that the stability of ROLLCSC decreased after FTO was inhibited; C. MeRIP experiment showed that after FTO was inhibited, the m6A enrichment ability of ROLLCSC was enhanced; D. WB detection of constructed lentiviral expression efficiency; E. Overexpression of FTO (Wt) lentivirus significantly increased the expression of ROLLCSC; F. Overexpression of FTO (mut) lentivirus had no positive effect on the stability of ROLLCSC; G. Overexpression of FTO (Wt) lentivirus significantly reduced the m6A enrichment ability of ROLLCSC.

[0032] Figure 8 The effects of IGF2BP2 on ROLLCSCs are shown: A. Detection of siIgf2bp2 efficiency; B. ROLLCSC expression decreased after knocking down Igf2bp2; C. ROLLCSC stability decreased after knocking down Igf2bp2.

[0033] Fig. 9The effects of FTO and IGF2BP2 on cell metastasis ability are shown: A. After overexpression of FTO, Igf2bp2 was knocked down, and the migration ability of LLC cells was reduced; B. After overexpression of FTO, Igf2bp2 was knocked down, and the invasion ability of LLC cells was reduced.

[0034] Fig.10 The results show the verification that ROLLCSC regulates the Wnt signaling pathway: A. WB verifies that ROLLCSC regulates the Wnt signaling pathway; B. Immunofluorescence results show that overexpression of ROLLCSC promotes the nuclear translocation of β-catenin; C. After overexpression of ROLLCSC, the expression of important genes in the Wnt pathway increases; D. When SKL2001 is added to LLC-oeNC cells, the cell migration ability increases; E. When SKL2001 is added to LLC-oeNC cells, the cell invasion ability increases, while when FH535 is added to LLC-oeROLLCSC cells, the cell invasion ability decreases; F. When SKL2001 is added to LLC-oeNC cells, the cell cloning ability increases, while when FH535 is added to LLC-oeROLLCSC cells, the cell cloning ability decreases.

[0035] Fig.11 The regulatory relationship between lncRNA ROLLCSC and CDC42 in LLC is shown: A. RT-qPCR (left) and WB (right) results show that overexpression of ROLLCSC promotes CDC42 expression; B. Actinomycin D experiment shows that oeROLLCSC stabilizes CDC42 expression; C. After adding the Wnt signaling pathway promoter SKL2001, CDC42 expression increased; D. After adding the Wnt signaling pathway inhibitor FH535, CDC42 expression decreased.

[0036] Fig.12 Shown is a CHIP experiment indicating that MYC can bind to the CDC42 promoter.

[0037] Fig.13 It shows: A. After knocking down CDC42 in LLC and co-cultured with LLC-SD-EVs, the expression of ROLLCSC in LLC decreased; B. Immunofluorescence results showed that knocking down CDC42 in LLC significantly reduced LLC's uptake of exosomes.

[0038] Fig.14 In vivo and in vitro experiments verified that exosome-derived CDC42 affects the metastatic ability of LLC cells: A. Exosomes produced after knocking down CDC42 in LLC-SD could not enhance the migration and invasion ability of LLC cells; B. Dissection results showed that oeROLLCSC promoted tumor development, while LL-SD-shCdc42 could reverse this result; C. H&E staining of mouse lung tissue. DETAILED DESCRIPTION

[0039] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0040] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0041] Example 1

[0042] 1 Materials and methods

[0043] 1.1 Materials

[0044] 1.1.1 Cells

[0045] The original strain of mouse Lewis lung cancer cell line (LLC) used in this study was generously provided by Dr. Robert Hoffman (University of California, San Diego, USA). In addition, this project also used the mouse Lewis lung cancer stem cell symmetrical division subpopulation cell line (LLC-SD), which originated from previous research in the laboratory. By using innovative stem cell isolation and purification technology, a cell line with higher stemness and stronger tumor formation and progression ability was successfully obtained.

[0046] 1.1.2 Experimental animals

[0047] Male C57 mice, aged 7-8 weeks and weighing approximately 20 g, were used in this study. C57 mice were purchased and maintained at the Animal Experiment Center of Chongqing Medical University. All in vivo animal experiments involved in this study were formally approved by the Animal Experiment Center of Chongqing Medical University and strictly followed relevant guidelines and regulations.

[0048] 1.1.3 Lentivirus construction

[0049] The lentivirus for knocking down CDC42 and the lentivirus products for overexpressing lncRNA ROLLCSC, overexpressing FTO (Wt) and overexpressing FTO (Mut) were all constructed and produced by Shanghai Genechem Co., Ltd.

[0050] 1.1.4 Transient transfection of siRNA and mimics vector construction

[0051] The siRNA products for knocking down lncRNA ROLLCSC, Cdc42, Igf2bp2, and Myc were all constructed and produced by Shanghai Jima Pharmaceutical Technology Co., Ltd. (China), and the sequences are as follows:

[0052]

[0053] 1.1.5 Main experimental reagents

[0054]

[0055]

[0056] 1.2 Experimental methods

[0057] 1.2.1 Preparation of cell culture medium

[0058] The formula of LLC cell culture medium is as follows: 1% double antibody solution, 10% fetal bovine serum (FBS), 89% DMEM high glucose medium, and it is stored in a 4°C environment after preparation. The formula of LLC-SD cell culture medium is as follows: 1% double antibody solution, 2% b27 reagent, 97% DMEM / F12 medium, and it is stored in a 4°C environment after preparation.

[0059] 1.2.2 Cell recovery

[0060] Conventional method.

[0061] 1.2.3 Adherent cell culture

[0062] Conventional method.

[0063] 1.2.4 Suspension cell culture

[0064] Conventional method.

[0065] 1.2.5 Cell cryopreservation

[0066] Conventional method.

[0067] 1.2.6 Cell migration and invasion assay

[0068] Conventional method.

[0069] 1.2.7 Cell clone formation assay

[0070] Conventional method.

[0071] 1.2.8 Exosome collection and purification

[0072] (1) Collect cells: When the cell density of the 10 mm culture dish reaches about 90%, collect the cell culture medium into a 50 mL centrifuge tube. If the exosomes are not to be extracted immediately, the sample should be quickly stored in a -80°C freezer. Before the extraction operation, the sample needs to be taken out of the freezer and thawed in a refrigerated environment at 4°C.

[0073] (2) Gradient centrifugation: Use a centrifuge to perform centrifugation in the following order: first, centrifuge the supernatant at 800 g / min for 5 minutes, then centrifuge at 2000 g / min for 10 minutes at 4°C, and finally centrifuge at 10000 g / min for 10 minutes at the same low temperature. After centrifugation, remove the sediment at the bottom of the tube and retain the supernatant for subsequent use.

[0074] (3) Filtering the supernatant: The supernatant obtained in step (2) is filtered using a filter membrane with a pore size of 0.22 μm to ensure that only particles smaller than 0.22 μm, such as exosomes, can penetrate the filter membrane.

[0075] (4) Ultrahigh-speed centrifugation: Transfer the concentrated liquid into a sterilized ultrahigh-speed centrifuge tube, ensuring that the amount of liquid in each centrifuge tube does not exceed 38.5 mL, and mark it. Centrifuge at 100,000 g / min for 120 minutes at 4°C to effectively separate the exosomes.

[0076] (5) Re-centrifugation: In order to improve the purity of exosome extraction, the exosomes need to be resuspended. After balancing the centrifuge tube, centrifuge again at 100,000 g / min for 60 minutes at 4°C to further purify the exosomes.

[0077] (6) Washing exosomes: Rinse the exosomes with 200 μl of PBS solution and collect them again. Keep the rinsed liquid in a 1.5 mL EP tube and mark it accordingly.

[0078] (7) Determination of exosome concentration: Take a small amount of exosome sample and add an appropriate amount of PBS diluent (dilution ratio ranges from 50 to 200 times) to it, and then determine the exosome concentration according to the instructions of the micro BCA kit provided by the manufacturer.

[0079] (8) Re-filtration and storage: In an ultra-clean workbench, the exosome suspension was filtered using a filter with a pore size of 0.22 μm. After sealing the tube mouth, the sample was stored in a refrigerator at -80 °C.

[0080] 1.2.9 Protein extraction and Western blot experiment

[0081] Conventional method.

[0082] 1.2.10 Total RNA extraction experiment

[0083] Conventional method.

[0084] 1.2.11 Reverse transcription of total RNA (cDNA synthesis)

[0085] Conventional method.

[0086] 1.2.12 Real-time fluorescence quantitative RT-qPCR experiment

[0087] The primer sequences are as follows:

[0088]

[0089] 1.2.13 Exosome labeling experiment

[0090] (1) Sample preparation: Following the instructions of the PKH26 staining kit, transfer a certain amount of purified exosomes into a light-protected EP tube and add diluent C or PBS to a total volume of 1 mL.

[0091] (2) Staining: Add 4 μl of PKH26 red fluorescent dye to 1 mL of diluent C, mix it thoroughly with the exosome dilution solution, and incubate the staining at room temperature in the dark for 10 minutes.

[0092] (3) Stop staining: Add 15 mL of pre-refrigerated PBS solution to the reaction system to stop the staining process.

[0093] (4) Concentration: Use a 100KD ultrafiltration concentrator to centrifuge to remove the PKH26 dye, collect the liquid above the filter membrane, and then add 15mL of PBS to mix. This process needs to be repeated three times, and finally the liquid is concentrated to a volume of 100 to 200mL, and the concentrated liquid is collected.

[0094] (5) Dilution: Dilute the concentrate with 1 mL of pre-chilled PBS solution.

[0095] (6) Filtration and storage: In a clean bench, use a 0.22 μm filter to sterile filter the extracted exosomes. After completion, seal the tube with a sealing film. If not used immediately, store the sample in a -80°C refrigerator to maintain its activity.

[0096] 1.2.14 Confocal experiment of cell uptake of exosomes

[0097] Conventional method.

[0098] 1.2.15 lncRNA full-length amplification experiment

[0099] (1) Extract the desired RNA according to the above method for extracting total RNA samples (overexpression cell lines can be used), and its purity should be between 1.8 and 2.2.

[0100] (2) Primer design: Primers were designed on the official website of primer3plus. For example, the target sequence for lncRNAROLLCSC was 785 base pairs long.

[0101] The primer sequences for the full-length amplification of ROLLCSC are as follows:

[0102]

[0103] 1.2.16 RNA Immunoprecipitation (RIP) experiment

[0104] This experiment was carried out using GISAID RNA Immunoprecipitation Kit, the experimental steps were carried out strictly according to the instructions.

[0105] 1.2.17 Methylated RNA Immunoprecipitation (MeRIP) experiment

[0106] The experimental steps are consistent with the RIP experiment, but MeRIP uses a specific antibody against m6A methylated RNA to enrich and detect methylation modifications on RNA.

[0107] 1.2.18 Chromatin immunoprecipitation (ChIP) assay

[0108] This experiment used the Biotech ChIPAssay Kit, and the experimental steps were carried out strictly according to the instructions.

[0109] 1.2.19 siRNA transfection

[0110] Conventional method.

[0111] 1.2.20 Lentivirus infection experiment

[0112] Conventional method.

[0113] 1.2.2 In vivo metastasis experiment in 1C57 mice

[0114] Conventional method.

[0115] 1.2.22 Data Statistical Analysis

[0116] In this study, we repeated each experiment at least three times to ensure the accuracy and validity of the data obtained. All data analysis was completed using GraphPad Prism 8 software, and the experimental results were presented in the form of bar graphs and line graphs. The results of three independent repetitions of each experiment were presented in the form of mean ± standard error. We used independent sample t-test or one-way ANOVA to statistically process the experimental results. The significance level of the results was divided according to the following standards: p-value less than 0.05 was represented by * (significance level 0.05), p-value less than 0.01 was represented by ** (significance level 0.01), and p-value less than 0.001 was represented by *** (significance level 0.001).

[0117] 1.3 Bioinformatics methods

[0118] 1.3.1 Data Source

[0119] LLC-SD and LLC cell culture fluid and purified exosomes were collected, and three replicates were set up for each experiment. The construction, sequencing and analysis of the exosomal lncRNA database were carried out by BGI.

[0120] 1.3.2GO and KEGG analysis

[0121] This study used web tools to predict potential downstream target genes of long noncoding RNA (lncRNA). In order to deeply analyze the functions and action pathways of these genes, we selected an online analysis platform to perform Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. GO analysis covers three main aspects: biological process (BP), cellular component (CC), and molecular function (MF). KEGG analysis focuses on identifying and enriching specific signal transduction pathways. Through these analyses, the study can reveal the biological significance of genes regulated by lncRNA and their action networks in cells.

[0122] 1.3.3 Transcription factor prediction

[0123] The online predicted transcription factor database was used to predict and screen the transcription factors related to the Wnt signaling pathway and CDC42 protein. The online databases used in this study include: JASPER database (https: / / jaspar.elixir.no / ), GTRD database (http: / / gtrd.biouml.org) and PROMO database (http: / / alggen.lsi.upc.es / cgi-bin / promo_v3 / promo / promoinit.cgi?dirDB=TF_8.3).

[0124] 2 Results

[0125] 2.1CDC42 protein binds to lncRNAROLLCSC and carries it into LLC-SD exosomes

[0126] 2.1.1 Isolation and identification of LLC-SD and LLC exosomes

[0127] During tumor development, tumor stem cells can communicate with non-stem tumor cells through paracrine, autocrine, and release of exosomes. Exosomes are important molecules for intercellular communication, and contain a variety of small molecules such as RNA, proteins, and lipids. We first separated exosomes from LLC-SD and LLC using high-speed centrifugation, then observed the exosome lipid bilayer structure using scanning electron microscopy, identified LLC and LLC-SD exosome markers using protein immunoprecipitation experiments, and identified LLC and LLC-SD exosome particle sizes using NTA. Through transmission electron microscopy, it can be observed that LLC-SD and LLC exosomes have typical bilayer membrane structures and there is no significant difference in the exosome morphology between the two. Then we used WB to detect LLC-SD and LLC exosome marker proteins Alix and CD63, while the negative control ALB protein was only expressed in cells. The NTA results showed that the exosome particle size was in the exosome particle size range of 50-150nm. Therefore, the structure, size, morphology, and purity of the exosomes (LLC-SD-exo, LLC-exo) we isolated and extracted from LLC-SD and LLC cell culture fluids were consistent with the characteristics of exosomes and could be used for subsequent experiments.

[0128] 2.1.2 Screening and identification of target lncRNAs and verification of their differential expression in LLC-SD and LLC cells and exosomes

[0129] A large number of studies have shown that non-coding RNA in exosomes released by tumor cells can directly affect tumor cells and enhance their migration and invasion capabilities. Therefore, this study focuses on the screening of lncRNA. We performed high-throughput sequencing on LLC-SD and LLC cell exosomes, screened out differentially expressed lncRNAs, and for the first time discovered a new lncRNA ROLLCSC ( Figure 1 A). We then used q-PCR to verify the differential expression of lncRNAROLLCSC between LLC-SD and LLC cells and their exosomes ( Figure 1 BC). It was found that the amount of lncRNAROLLCSC in LLC-SD was much higher than that in LLC, both in cells and in exosomes. We then co-cultured LLC-SD exosomes with non-ionic surfactant Triton X-100 and RNase to destroy the lipid structure of the exosome membrane and change the permeability of the membrane, and found that the content of lncRNAROLLCSC decreased significantly ( Figure 1 D), this result indicated that ROLLCSCs were mainly encapsulated in exosomes.

[0130] The nucleotide sequence of lncRNAROLLCSC is shown in SED ID NO.14.

[0131] 2.1.3 Screening and identification of target protein

[0132] EVs-associated RBPs that specifically bind to the plus strand were selected (including CDC42, NAMPT, GSTM2, NUCB1, and SFN; peptides > 3) ( Figure 2 A). Subsequently, we designed corresponding siRNAs to knock down these target RBPs ( Figure 2 B). After verifying the effectiveness of siRNA, we transfected siRNA into LLC-SD cells to observe its effect on the expression of lncRNAROLLCSC ( Figure 2 C). RT-qPCR results showed that knocking down CDC42 significantly affected the level of ROLLCSC in LLCSD exosomes, while knocking down other genes did not change significantly or even showed an upward trend. Therefore, we selected protein CDC42 as the target protein for subsequent research.

[0133] 2.1.4 lncRNA ROLLCSC directly binds to CDC42 protein

[0134] After successfully screening the target protein, we decided to study its interaction with the long non-coding RNA ROLLCSC in depth. To verify the direct binding between them, we first performed an RNA immunoprecipitation (RIP) experiment. This experiment uses a specific antibody to capture the target protein and then detects the RNA molecules bound to it, thereby revealing the interaction between protein and RNA. The results of the RIP experiment ( Figure 3 A) indicates that there is a direct binding between the target protein CDC42 and lncRNA ROLLCSC. To further verify this finding, we then performed an RNA pull-down experiment. The RNA pull-down experiment is to capture the protein bound to it through specific interactions. In this experiment, we found that the CDC42 protein directly binds to the positive strand of lncRNA ROLLCSC ( Figure 3 B). Both experiments above confirmed the direct binding relationship between CDC42 protein and lncRNA ROLLCSC.

[0135] 2.1.5CDC42 protein carries lncRNAROLLCSC into exosomes

[0136] CDC42 has been shown to enter exosomes in previous reports, but there are few reports on its interaction with lncRNA and the mechanism of carrying it into exosomes. The direct binding of CDC42 protein to lncRNA ROLLCSC prompted us to further speculate whether CDC42 protein brought ROLLCSC into exosomes and then transferred from LLC-SD cells to LLC cells. First, we constructed a co-culture model of LLC-SD-EVs and LLC, extracted exosomes from the collected LLC-SD culture medium by ultracentrifugation, and then measured the concentration of exosomes, filtered bacteria, and added 5μg to co-culture with LLC cells. After the co-culture system was established, we first knocked down CDC42 in LLC-SD cells by transient transfection of siRNA, then extracted LLC-SD exosomes, and co-cultured the exosomes with LLC cells. After 3 days of culture, LLC cells were collected and RT-qPCR was performed. It was found that after knocking down CDC42 in LLC-SD, the expression of lncRNA ROLLCSC in LLC cells co-cultured with LLC-SD exosomes decreased significantly, while the ROLLCSC content in the control group, i.e. the group without knocking down CDC42, was much higher than that in the blank control group ( Figure 4 A). We then performed a migration and invasion assay (Transwell) ( Figure 4BC), firstly, lncRNAROLLCSC and CDC42 were knocked down in LLC-SD by transient transfection, and then the exosomes of the treated LLC-SD were extracted. The Transwell chamber we used had a pore size of 8μm, which was used to simulate the cell migration experiment. The in vitro invasion experiment was carried out by paving Matrigel matrix gel in the chamber to simulate the extracellular matrix in vivo, and finally the exosomes were added to the culture medium and co-cultured with LLC cells. The results showed that compared with the blank control group, the migration and invasion ability of LLC cells increased significantly after the addition of LLC-SD exosomes. On the contrary, after the addition of LLC-SD exosomes with knockdown of CDC42 and knockdown of lncRNAROLLCSC, the migration and invasion ability of LLC cells decreased significantly compared with the simple addition of exosomes. The above results all indicate that CDC42 protein can carry lncRNAROLLCSC into exosomes, and lncRNAROLLCSC can affect the migration and invasion ability of LLC cells.

[0137] 2.2FTO-mediated m6A modification enhances the stability of lncRNA ROLLCSC

[0138] 2.2.1 Screening of m6A methylation-related proteins

[0139] Earlier, we explored how lncRNA ROLLCSC is delivered to LLC. Next, we will continue to explore the specific mechanism by which ROLLCSC plays a role in LLC. RNA molecules are difficult to maintain stability due to their easily degradable nature. Therefore, when exosomes deliver RNA molecules to target cells, how to ensure their stability and effectively function becomes one of the key factors in the efficiency of exosomes in regulating the tumor microenvironment. Previous studies have shown that m6A methylation modification can affect the stability of lncRNA. In order to further explore whether m6A methylation modification can regulate the expression of lncRNA ROLLCSC, we first overexpressed ROLLCSC in LLC cells. RT-qPCR results showed that the intracellular m6A methylation level decreased after overexpression of ROLLCSC ( Figure 5 A). This result indicates that ROLLCSC is methylated. We then used the SRAMP online platform to analyze the secondary structure of ROLLCSC and identified potential m6A methylation sites ( Figure 5 B). In addition, RNA pull-down experiments combined with LC-MS / MS mass spectrometry analysis showed that lncRNA ROLLCSC may have specific binding effects with methylation-related proteins (FTO, IGF2BP2).

[0140] 2.2.2 Binding relationship between FTO, IGF2BP2 and ROLLCSC

[0141] FTO is a demethylase, while IGF2BP2 is an m6A reader protein that can recognize m6A methylation modification. Based on this, we speculated that ROLLCSC may undergo m6A methylation modification mediated by the FTO / IGF2BP2 pathway. Next, we performed RIP experiments and RNA pull-down experiments to explore the binding relationship between FTO, IGF2BP2 and ROLLCSC. Figure 6 A RIP experiment showed that FTO directly binds to ROLLCSC. Figure 6 RIP experiment of B. Figure 6 The results of RNA pull-down experiments in C confirmed the direct binding relationship between IGF2BP2 and ROLLCSC.

[0142] 2.2.3 Effect of FTO on ROLLCSC stability and methylation expression

[0143] As a demethylase, FTO has been shown to regulate the stability of lncRNA. In previous experiments, we knew that FTO directly binds to ROLLCSC. Next, we wanted to continue to explore how FTO affects lncRNA ROLLCSC. We added FB23, an FTO inhibitor, to LLC cells. RT-qPCR results showed that after inhibiting FTO expression, ROLLCSC expression also decreased ( Figure 7 A). We then used FB23 to reduce FTO expression and performed actinomycin D experiments to observe changes in ROLLCSC stability ( Figure 7 B). The results showed that knocking down FTO reduced the stability of ROLLCSC. Then, in order to explore the effect of FTO on m6A modification, we performed a methylated RNA immunoprecipitation experiment (MeRIP) ( Figure 7 C), as shown in the figure, after inhibiting FTO expression, the methylation enrichment ability of ROLLCSC was enhanced.

[0144] To further confirm this conclusion, we constructed wild-type and mutant (m6A site mutation) FTO overexpression lentiviruses and detected the lentiviral efficiency by WB experiment ( Figure 7 D). After the lentivirus was successfully constructed, it was transfected into LLC cells, and RT-qPCR was also performed ( Figure 7 E), actinomycin D ( Figure 7 F) MeRIP Figure 7G) Three experiments. The experimental results showed that FTO (Wt) lentivirus significantly increased the expression and stability of ROLLCSC, while reducing its methylation level. In contrast, FTO (Mut) lentivirus failed to produce these effects. All of the above results indicate that FTO, as a demethylase, can demethylate ROLLCSC and thus stabilize the expression of ROLLCSC.

[0145] 2.2.4 Effect of IGF2BP2 on ROLLCSCs

[0146] Numerous studies have shown that m6A reader proteins play an important role in determining the fate of m6A-modified RNA, affecting gene expression by regulating its stability and degradation. It has been reported that, compared with other m6A readers that promote RNA degradation, IGF2BP2 tends to enhance the stability of its target RNA, thereby affecting gene expression. We constructed siRNA targeting IGF2BP2 and tested its efficiency by RT-qPCR ( Figure 8 A). We then transfected LLC with si-Igf2bp2 and found that when IGF2BP2 expression decreased, ROLLCSC expression also decreased ( Figure 8 B). We then performed an actinomycin D experiment and found that knocking down Igf2bp2 reduced the stability of ROLCSCs ( Figure 8 C). The above results indicate that IGF2BP2 can enhance the expression and stability of ROLLCSCs as an m6A reader.

[0147] 2.2.5 Effects of FTO and IGF2BP2 on cell metastasis

[0148] We know that FTO and IGF2BP2 can promote the expression of ROLLCSC and increase its stability. Next, we want to further explore the effect of the two on the metastatic ability of LLC cells. We transfected siIgf2bp2 and siROLLCSC into LLC cells that had been overexpressed with FTO (Wt) lentivirus and performed corresponding migration and invasion experiments ( Fig. 9 AB). The results showed that after overexpression of FTO, the migration and invasion abilities of LLC cells increased significantly, but after knockdown of IGF2BP2 and ROLLCSC, the migration and invasion abilities decreased. This result combined with the previous results showed that FTO and IGF2BP2-mediated demethylation modification can enhance the expression of ROLLCSC, thereby promoting its metastatic efficiency in lung adenocarcinoma.

[0149] 2.3 ROLLCSCs activate Wnt / β-Catenin signaling pathway to regulate CDC42 expression

[0150] 2.3.1 Screening pathway

[0151] After exploring the relationship between m6A methylation and ROLLCSC, we wanted to explore which signaling pathway ROLLCSC further affects the metastatic ability of LLC. We first performed high-throughput transcriptome sequencing. As shown in the volcano plot, RNA sequence analysis identified 479 differentially expressed genes (DEGs) associated with ROLLCSC in LLC cells. We then performed GO analysis, and the results showed that this gene set was significantly involved in the canonical Wnt signaling pathway. Next, we used GSEA enrichment analysis and found that DEGs were significantly enriched in biological processes (BP) and Reactome related to the Wnt / β-Catenin pathway. In summary, we screened out the signaling pathway regulated by ROLLCSC, namely the Wnt signaling pathway.

[0152] 2.3.2 Experimental verification of ROLLCSC regulation of Wnt signaling pathway

[0153] To further verify the regulatory effect of ROLLCSC on the Wnt signaling pathway, we performed a protein immunoblotting experiment. The results showed that overexpression of ROLLCSC activated the protein expression of phosphorylated β-catenin and β-catenin ( Fig.10 A). We then overexpressed ROLLCSC in LLC cells, stained the cell nuclei and β-catenin, and observed their localization under a confocal microscope. Immunofluorescence results showed that overexpression of ROLLCSC promoted the nuclear translocation of β-catenin ( Fig.10 B). We also performed RT-qPCR experiments on important genes in the Wnt pathway after overexpression of ROLLCSC ( Fig.10 C), and found that after ROLLCSC was overexpressed, the expression of important genes related to the Wnt pathway increased, which further indicated that lncRNA ROLLCSC successfully activated the Wnt / β-Catenin signaling pathway. We then conducted functional experiments ( Fig.10 DE), the results showed that after adding the Wnt signaling pathway promoter (SKL2001), the migration and invasion ability of cells was enhanced; similarly, after overexpression of ROLLCSC, the migration and invasion ability of cells was enhanced, while after adding the Wnt signaling pathway inhibitor (FH535), the migration and invasion ability of cells was weakened. The subsequent clonal spot experiment also obtained the same result ( Fig.10 F). In summary, lncRNAROLLCSC activated the Wnt signaling pathway, which further affected the metastatic ability of LLC cells. 2.3.3 Regulatory relationship between lncRNAROLLCSC and CDC42 in LLC

[0154] Previous studies have shown that activation of the Wnt / β-Catenin pathway can increase the expression of CDC42. For example, the transcription factor Wnt5a can promote the transcription of CDC42. Therefore, we hypothesized that ROLLCSC can further affect the expression of CDC42 by regulating the Wnt / β-Catenin pathway. First, we overexpressed lncRNA ROLLCSC in LLC and then detected its effect on the expression of CDC42 at the RNA and protein levels. RT-qPCR and WB results showed that ( Fig.11 A), overexpression of ROLLCSC promoted CDC42 expression. Subsequent actinomycin D experiments ( Fig.11 B) showed that oeROLLCSC can stabilize CDC42 expression. We then added Wnt signaling pathway promoter (SKL2001) and Wnt signaling pathway inhibitor (FH535) to LLC-oeROLLCSC, and the results showed that Wnt signaling pathway positively regulates CDC42 expression ( Fig.11 CD). In summary, in LLC cells, lncRNA ROLLCSC further promotes the expression of CDC42 by activating the Wnt / β-Catenin pathway.

[0155] 2.3.4 Screening of relevant transcription factors and verification of their effects on CDC42 expression

[0156] Next, we wanted to further explore the effects of Wnt / β-Catenin pathway transcription factors on CDC42 transcription. First, we used the JASPAR, GTRD, and PROMO databases to predict Wnt / β-Catenin pathway transcription factors that may bind to the CDC42 promoter region and took the intersection. We then performed PCR verification on several transcription factors in the intersection, and the results showed that knocking down MYC significantly reduced the expression of CDC42. Therefore, we selected the transcription factor MYC as the target gene for subsequent studies. We predicted possible binding sites in the CDC42 promoter region, and based on this, we designed and constructed three specific fragment primers. By performing ChIP experiments, we found that MYC can specifically bind to the #2 promoter fragment of CDC42 ( Fig.12 ). We then overexpressed ROLLCSC and knocked down MYC in LLC cells and found that CDC42 expression also decreased. Subsequent actinomycin D experiments also showed that after MYC was knocked down, CDC42 stability decreased. In summary, the transcription factor MYC can bind to the CDC42 promoter region, and the transcription factor MYC plays a positive regulatory role on CDC42.

[0157] 2.4 ROLLCSC / CDC42 positive feedback axis enhances the uptake of cellular exosomes

[0158] 2.4.1CDC42 affects further uptake of exosomes by recipient cells

[0159] As mentioned in the introduction, studies have found that after CDC42 protein enters the recipient cells through exosomes, it can further stimulate the uptake of exosomes by the recipient cells, forming a positive feedback loop. In order to verify whether CDC42 in this study can also affect the uptake of exosomes by the recipient cells, we knocked down CDC42 in LLC cells and co-cultured them with LLC-SD exosomes. Then, we used RT-qPCR experiments to observe that after knocking down CDC42, the expression of ROLLCSC decreased ( Fig.13 A). To further verify that knocking down CDC42 would affect the uptake of exosomes by receptor cells, we performed an immunofluorescence experiment. The confocal results showed that knocking down CDC42 significantly reduced LLC's uptake of exosomes ( Fig.13 B). The above experimental data indicate that CDC42 protein entering LLC cells through exosomes will further enhance the ability of recipient cells LLC to take up exosomes.

[0160] 2.4.2 In vitro and in vivo experiments verified that exosome-derived CDC42 affects the metastatic ability of LLC cells

[0161] Finally, we further explored the effect of the ROLLCSC / Wnt / β-Catenin / CDC42 axis on the metastatic ability of LLC cells. We transfected LLC-SD cells with shCDC42 lentivirus, co-cultured its exosomes with LLC, and then performed functional experiments. The experimental results showed that LLC-SD exosomes significantly enhanced the migration and invasion ability of LLC, while after knocking down CDC42, the promoting effect was greatly weakened. We then conducted in vivo experiments and performed orthotopic implantation in the lungs of mice. The anatomical results confirmed that overexpression of ROLLCSC in vivo promoted tumor development, while knocking down CDC42 reversed the cancer-promoting effect ( Fig.14 AB). We then fixed and stained the lung tissues with H&E ( Fig.14 C), further verified this conclusion.

[0162] 3 Analysis

[0163] Previous studies by our research group have confirmed that lncRNA can affect the metastasis of lung cancer. In this study, we focused on long noncoding RNA (lncRNA) carried by exosomes, aiming to explore the mechanism of lncRNA's influence on tumor occurrence and development in lung cancer. From the research results, we found that lncRNA ROLLCSC can be demethylated to stabilize its own expression, while activating the Wnt / β-Catenin signaling pathway, promoting CDC42 transcription, and allowing receptor cells to take in more exosomes, thereby promoting tumor metastasis. Our research work provides a theoretical basis for understanding the mechanism of lung cancer metastasis and the formulation of subsequent treatment strategies.

[0164] The main mechanisms by which tumor stem cells participate in tumor development are as follows: (1) Tumor stem cells are considered to be a key cell population for the origin and spread of cancer; (2) Compared with non-stem cell tumor cells, tumor stem cells show a stronger ability to resist radiotherapy and chemotherapy; (3) The "metastatic tumor stem cell" hypothesis emphasizes the core role of tumor stem cells in cancer spread. This hypothesis points out that during the metastasis of tumor cells, they often undergo epithelial-mesenchymal transition (EMT) to generate cells with self-renewal ability. After arriving in new tissues, these cells can develop from one or a small group of cells into a new tumor. Although the role of tumor stem cells in the metastasis process may lead to treatment resistance and poor prognosis, the interaction between tumor stem cells and non-stem cells is a key link in the success of metastasis during tumor metastasis and colonization. However, there are relatively few studies on the transmission of signals between tumor stem cells and non-stem tumor cells by exosomes, and this area still needs further exploration.

[0165] As key mediators of intercellular communication, exosomes not only play the role of biomarkers in the diagnosis, treatment and prognosis of cancer, but also affect various mechanisms of cancer development by regulating the expression of miRNA, lncRNA, circRNA and proteins. In general, current research on the effects of exosomes on tumor metastasis can be summarized as follows: (1) Tumor cells release exosomes containing non-coding RNA, which affects stromal cells in the distant tumor microenvironment (TME). This process promotes angiogenesis, epithelial-mesenchymal transition and the induction of M2 macrophages, which helps to form or transform the pre-metastatic tumor microenvironment. These changes create a favorable environment for the colonization and proliferation of circulating tumor cells at distant sites. (2) Non-coding RNAs in exosomes derived from stromal cells are also involved in the communication between tumor cells and stromal cells. They can promote the stem cell characteristics of tumor cells or enhance their proliferation, invasion and epithelial-mesenchymal transition, thereby promoting the metastatic process of tumors.

[0166] In this study, we explored the intercellular communication between lung cancer stem cells LLC-SD and lung cancer non-stem cells LLC mediated by exosomes during metastasis and colonization. We demonstrated that lncRNAROLLCSC can enter LLC-SD exosomes under the action of CDC42 protein, and further transport to LLC to affect the metastatic ability of non-stem lung cancer cells. This finding highlights the biological importance of signaling between tumor stem cells and non-stem cells through exosomes, and provides profound insights into how exosomes affect cancer development. CDC42 protein plays an important role in malignant tumors. It is involved in the regulation of cytoskeleton and microtubule dynamics, transcription, cell cycle progression, cell polarity, apoptosis, phagocytosis, vesicle transport and cell adhesion, leading to tumorigenesis and invasion and metastasis. However, there are few studies on its vesicle transport. This invention explores the binding relationship between CDC42 and lncRNAROLLCSC, and confirms that CDC42 protein can carry lncRNA into exosomes. This finding provides strong evidence and inspiration for the study of CDC42 vesicle transport.

[0167] RNA molecules themselves are very unstable. How they reach recipient cells and maintain their functions under the protection of exosomes is one of the key mechanisms of exosomes in effectively regulating the tumor microenvironment. Therefore, we further explored how ROLLCSC further affects the metastatic ability of cells in LLC. m6A methylation is a reversible modification involving the participation of methyltransferases, demethylases, and methylation reader proteins. FTO (obesity-associated protein) is a gene related to obesity. It plays an important role in the m6A demethylation process of RNA. It is not limited to regulating RNA stability and translation, but also involves multiple processes such as RNA splicing, transport, translation or degradation. IGF2BP2 (insulin-like growth factor 2 mRNA binding protein 2) is a newly discovered m6A "reader" that can recognize and bind to m6A modification sites on mRNA to enhance the stability and translation efficiency of mRNA. We confirmed through bioinformatics analysis, RIP experiments, ActD experiments, functional experiments, etc. that both the demethylase FTO and the m6A reader IGF2BP2 contribute to the demethylation and stabilization of ROLLCSC expression. Our study revealed for the first time the role of FTO and IGF2BP2 in stabilizing the expression of lncRNA ROLLCSC, which not only provided new strong evidence for the role of m6A demethylation in delaying RNA degradation, but also clarified how lncRNA maintains its stability and exerts its function after being transported to recipient cells by exosomes.

[0168] We then further explored which signaling pathways lncRNAROLLCSC regulates to affect LLC development. Through website prediction and bioinformatics analysis, we screened out the Wnt / β-Catenin pathway. The Wnt signaling pathway plays a key role in the initiation and progression of a variety of tumors. Abnormal activation of the Wnt signaling pathway in cancer cells promotes their unlimited proliferation ability, which is often associated with resistance to treatment. The activated Wnt signaling pathway can enhance the self-renewal and proliferation ability of tumor stem cells and simultaneously reduce the apoptosis process of tumor cells. For example, Dsh protein, as a positive regulator of the Wnt signaling pathway, is prevalent in non-small cell lung cancer (NSCLC) and is closely related to the occurrence and development of NSCLC. There are also literature reports that lncRNAJPX activates Wnt signaling to regulate miRNA to regulate lung cancer tumorigenesis. However, the regulation of the Wnt signaling pathway by lncRNA-protein interaction remains largely unexplored.

[0169] We conducted a series of experiments using Wnt signaling pathway inhibitors and promoters and found that ROLLCSC can activate the Wnt signaling pathway, and the Wnt signaling pathway can also affect the expression of CDC42. Then we screened out the transcription factor MYC that is related to the Wnt pathway and can bind to the CDC42 transcription region. The experiment showed that MYC plays a positive regulatory role on CDC42. So far, our research has shown that lncRNA can promote the expression of related transcription factors by activating the Wnt pathway, thereby promoting the transcription of related proteins and further promoting the occurrence and development of tumors. This discovery provides strong evidence to support in-depth research on the role of the lncRNA / Wnt / β-Catenin / protein axis in the occurrence and development of other cancers.

[0170] Finally, we confirmed through immunofluorescence experiments and in vitro and in vivo experiments that CDC42 would further promote the uptake of exosomes by receptor cells to form a positive feedback, thereby enhancing the metastatic ability of LLC. Our study revealed for the first time that CDC42 protein promotes the uptake of exosomes in lung cancer cells, thereby promoting the occurrence and development of tumors, which opens up new horizons for future exploration of the mechanism of action of exosomes in other cancers.

[0171] Overall, our study has laid a foundation for studying the functional role of lncRNA in heterogeneous tumor cell communication in lung cancer progression. These results are expected to promote the development of diagnostic technologies based on exosomal lncRNA in the tumor microenvironment and provide assistance in the formulation of customized treatment plans for lung cancer patients. In addition, the analysis of small molecule components such as lncRNA and proteins in exosomes may help monitor treatment effects, detect minimal residual lesions, and identify potential targets for treatment. Integrating these molecular markers with conventional clinical indicators can enhance our ability to detect and treat lung cancer, and ultimately help improve patients' clinical prognosis.

[0172] Combining all the above experimental results, we know that LncRNA ROLLCSC binds to CDC42 protein and enters exosomes, and is transported from LLC-SD cells to LLC cells. In LLC cells, the released lncRNA ROLLCSC is demethylated under the action of demethylase FTO and m6Areader IGF2BP2 to stabilize its RNA expression. In addition, lncRNA ROLLCSC activates the Wnt / β-Catenin signaling pathway and promotes the transcription of CDC42 through the transcription factor MYC. The upregulated CDC42 further enhances the uptake of EVs by recipient LLC cells, forming a positive feedback loop in the tumor microenvironment and promoting the metastasis of lung adenocarcinoma.

Claims

1. Application of lncRNA ROLLCSC as a target in screening drugs for the treatment of lung cancer.

2. Application of lncRNA ROLLCSC and CDC42 as joint targets in screening drugs for the treatment of lung cancer.

3. The use according to claim 1 or 2, characterized in that: The lncRNAROLLCSC is a lncRNA in exosomes.

4. The use according to claim 3, characterized in that: The exosomes shown are from lung cancer cells.

5. The use according to claim 3, characterized in that: Inhibiting lncRNA ROLLCSC and / or CDC42 inhibits the metastasis of lung cancer cells and tumor progression.

6. The use according to claim 5, characterized in that: CDC42 protein directly binds to lncRNA ROLLCSC, carrying lncRNA ROLLCSC into exosomes and transferring from lung cancer stem cells to non-stem lung cancer cells; inhibiting lncRNA ROLLCSC and / or CDC42 inhibits the metastasis of non-stem lung cancer cells.

7. Use of an agent for inhibiting the expression of lncRNA ROLLCSC and / or CDC42 in the preparation of a drug for treating lung cancer.

8. The use according to claim 7, characterized in that: The reagents include nucleic acid molecules, proteins, and compounds.

9. The use according to claim 7, characterized in that: The nucleic acid molecule includes siRNA, and the sequence of the siRNA inhibiting lncRNA ROLLCSC is: AGGAGAGAAAGAGGAAGAAAGAATT; the sequence of the siRNA inhibiting CDC42 is: GCAGACAATTAAGTGTGTTGTTGTT.

10. The use according to any one of claims 1 to 9, characterized in that: The nucleotide sequence of the lncRNA ROLLCSC is shown in SEQ ID NO.14.

Images