Vancomycin-resistant enterococcus detection kit and detection method

Abstract

The invention relates to the technical field of biological detection, in particular to a vancomycin-resistant enterococcus detection kit and a detection method. The detection kit comprises a nucleic acid molecule with a sequence as shown in SEQ ID NO.1 and one or more of detection reagents of the nucleic acid molecule. According to the detection method, whether a sample to be detected contains vancomycin-resistant enterococcus or not is correspondingly determined by detecting whether a nucleic acid molecule with a sequence as shown in SEQ ID NO.1 exists in DNA of the sample to be detected or not. By adopting the detection kit and the detection method disclosed by the invention, the VR-Efm detection can be quickly and accurately realized, timely intervention, propagation reduction and treatment scheme optimization are facilitated, and the detection kit and the detection method have great significance in controlling clinical drug-resistant bacteria.

Description

[0001] This application claims the priority of the Chinese patent application filed with the China Patent Office on October 31, 2024, with application number 2024115422207 and invention name “Vancomycin-resistant Enterococcus detection kit and detection method”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present application relates to the field of biological detection technology, and in particular to a vancomycin-resistant enterococcus detection kit and a detection method. Background Art

[0003] Enterococcus is a type of Gram-positive bacteria belonging to the family Enterococcus, which is commonly found in the intestinal tract of humans and non-human animals, the female reproductive tract, and other environments. Enterococcus has the following three characteristics that make it important in the fields of medicine and pathogenic biology:

[0004] First, enterococci are opportunistic pathogens that usually do not cause infection in healthy people, but can cause various infections, including urinary tract infections, endocarditis, meningitis, and skin infections, when the immune system is impaired or other susceptible conditions exist. This makes the infection path of enterococci difficult to predict at this stage.

[0005] Second, enterococci have very strong adaptability and survival ability. They can survive for a long time in harsh environments, including dry and high-salt environments, and be transmitted to patients and medical staff through contact, which makes the screening of enterococci face severe challenges.

[0006] Third, enterococci can be transformed into vancomycin-resistant Enterococcus faecium (VR-Efm) after acquiring vanA or vanB gene clusters through specific horizontal gene transfer. The enzymes encoded by these gene clusters can change the synthesis pathway of bacterial cell walls, making it difficult for vancomycin to effectively bind to its target, thereby reducing intracellular drug accumulation and causing bacteria to develop high-level resistance to vancomycin. The acquisition of this resistance and the spread of bacteria with this resistance pose a serious threat to public health and are difficult to control with the widespread use of antibiotics. Vancomycin is the bottom-line drug for the treatment of multidrug-resistant enterococcal infections, especially when other antibiotics are ineffective. Vancomycin helps control and reduce hospital-acquired infections. This transformation of enterococci from opportunistic pathogens to infectious pathogens VR-Efm not only poses a challenge to traditional antibiotic treatment, but also makes clinical infection prevention and control face a more complicated situation.

[0007] The above three characteristics lead to the increasingly serious problem of clinical enterococcal infection.

[0008] At present, there are three main methods for the detection of VR-Efm in clinical practice, namely culture method (gold standard), matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS) method and metagenomic sequencing method. However, these current methods have three major disadvantages: cumbersome operation, high cost and long detection time. Therefore, the establishment of a faster and more accurate detection method is crucial for the early diagnosis of VR-Efm, which can intervene in time, reduce transmission, optimize treatment plans, and is of great significance for the control of clinical drug-resistant bacteria. Summary of the invention

[0009] Based on this, one or more embodiments of the present application provide a vancomycin-resistant enterococcus detection kit and detection method, including the following technical solutions:

[0010] One or more embodiments of the present application provide a nucleic acid molecule, the sequence of which is shown in SEQ ID NO.1.

[0011] One or more embodiments of the present application provide a nucleic acid molecule with a sequence as shown in SEQ ID NO.1 and use of one or more of the detection reagents of the nucleic acid molecule in the preparation of a vancomycin-resistant enterococcus detection kit.

[0012] In some embodiments of the present application, the nucleic acid molecule detection reagent includes one or more of a primer combination and a detection probe.

[0013] In some embodiments of the present application, the primer combination includes a forward primer whose sequence is shown in SEQ ID NO.2 and a reverse primer whose sequence is shown in SEQ ID NO.3.

[0014] One or more embodiments of the present application provide a vancomycin-resistant enterococcus detection kit, which includes a nucleic acid molecule with a sequence as shown in SEQ ID NO.1 and one or more detection reagents for the nucleic acid molecule.

[0015] In some embodiments of the present application, the nucleic acid molecule detection reagent includes one or more of a primer combination and a probe.

[0016] In some embodiments of the present application, the primer combination includes a forward primer whose sequence is shown in SEQ ID NO.2 and a reverse primer whose sequence is shown in SEQ ID NO.3.

[0017] In some embodiments of the present application, the detection kit further includes one or more of a DNA extraction reagent, a PCR amplification reagent, a positive quality control product and a negative quality control product, and the positive quality control product includes a nucleic acid molecule whose sequence is shown in SEQ ID NO.1.

[0018] In some embodiments of the present application, the PCR amplification reagent includes one or more of a PCR buffer, a DNA polymerase, magnesium ions, and dNTPs.

[0019] One or more embodiments of the present application provide a method for detecting vancomycin-resistant enterococci, which determines whether the sample to be tested contains vancomycin-resistant enterococci by detecting whether a nucleic acid molecule with a sequence such as that shown in SEQ ID NO.1 exists in the DNA of the sample to be tested.

[0020] In some embodiments of the present application, the detection method includes a PCR method.

[0021] In some embodiments of the present application, the primer combination used in the PCR method includes a forward primer with a sequence as shown in SEQ ID NO.2 and a reverse primer with a sequence as shown in SEQ ID NO.3.

[0022] In some embodiments of the present application, the initial reaction system used in the PCR method includes 0.3 μM-0.6 μM of the forward primer and 0.3 μM-0.6 μM of the reverse primer.

[0023] In some embodiments of the present application, the amplification program adopted in the PCR method includes: pre-denaturation at 94.5°C-95.5°C for 4.5 minutes-5.5 minutes; 30-40 cycles, each cycle including denaturation at 94.5°C-95.5°C for 40 seconds-50 seconds, annealing at 59°C-61°C for 55 seconds-65 seconds and extension at 71.5°C-72.5°C for 55 seconds-65 seconds; extension at 71.5°C-72.5°C for 7 minutes-10 minutes.

[0024] The details of one or more embodiments of the present application are set forth in the description which follows, and other features, objects, and advantages of the present application will be apparent from the description and its claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0026] Figure 1 The results of PCR detection experiments on samples using the VR-Efm-F / VR-Efm-R primer combination;

[0027] Figure 2The results of PCR detection experiments on samples using the 27F / 1492R primer combination;

[0028] Figure 3 The results of PCR detection experiments using VR-Efm-F / VR-Efm-R primer combination to verify the samples;

[0029] Figure 4 The results are shown in Figure 2. These are the results of a PCR test using the 27F / 1492R primer combination to validate the samples. DETAILED DESCRIPTION

[0030] The present application will be further described in detail below in conjunction with the accompanying drawings, embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present application and are not used to limit the scope of the present application. The purpose of providing these embodiments and examples is to make the understanding of the disclosure of the present application more thorough and comprehensive. It should also be understood that the present application can be implemented in many different forms, and is not limited to the embodiments and examples described in the present application. Those skilled in the art can make various changes or modifications without violating the connotation of the present application, and the equivalent form obtained also falls within the protection scope of the present application. In addition, in the description below, a large number of specific details are given in order to provide a more comprehensive understanding of the present application, and it should be understood that the present application can be implemented without one or more of these details.

[0031] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used in this application and in the specification of this application are only for the purpose of describing the implementation methods and embodiments and are not intended to limit this application.

[0032] the term

[0033] Unless otherwise specified or there is a contradiction, the terms and phrases used in this application have the following meanings:

[0034] The terms "and / or", "or / and", and "and / or" used in this application include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0035] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0036] The terms "combination thereof", "any combination thereof", "any combination thereof" and the like used in this application include all suitable combinations of any two or more of the listed items.

[0037] In this application, the "suitable" mentioned in "suitable combination", "suitable method", "any suitable method", etc. is based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0038] In the present application, "preferred", "better", "more preferred" and "suitable" are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present application.

[0039] In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0040] In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0041] In the present application, the terms "first", "second", "third", "fourth", etc. in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0042] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0043] In the present application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval, and includes the two numerical endpoints (i.e., the minimum value and the maximum value) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints. In the present application, it is equivalent to directly listing each integer, such as t is an integer selected from 1 to 10, indicating that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed in the present application should be understood to include any and all sub-ranges included therein.

[0044] The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

[0045] In the present application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0046] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference separately. Unless they conflict with the application purpose and / or technical solution of this application, the cited documents involved in this application are cited with all contents and all purposes. When the cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the cited documents are involved in this application, the examples and preferred methods of the cited relevant technical features can also be incorporated into this application as references, but are limited to the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be modified adaptively according to the description of this application.

[0047] In a first aspect of the embodiments of the present application, a nucleic acid molecule is provided, the sequence of which is as shown in SEQ ID NO.1 or which is specific to vancomycin-resistant enterococci and has at least 90% homology with SEQ ID NO.1.

[0048] "Homology" in this application refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules. To compare two or more nucleotide sequences, the percentage of "sequence homology" between the first sequence and the second sequence can be calculated by dividing [the number of nucleotides in the first sequence that are identical to the nucleotides at the corresponding positions] by [the number of nucleotides in the second sequence] minus [the total number of nucleotides in the first sequence], and then multiplying by [100%], wherein the deletion, insertion, substitution or addition of each nucleotide in the second nucleotide sequence - relative to the first nucleotide sequence - is considered to be a difference at a single nucleotide (position). Alternatively, the degree of sequence homology between two or more nucleotide sequences can be calculated using known computer algorithms for sequence alignment, such as NCBIBlast v2.0, using standard settings. Some other techniques, computer algorithms and arrangements for determining the degree of sequence homology are described, for example, in WO 04 / 037999, EP 0 967 284, EP 1 085 089, WO 00 / 55318, WO 00 / 78972, WO 98 / 49185 and GB 2 357 768 A.

[0049] In clinical prevention and control, this screening strategy is the key to controlling the spread of drug resistance. It can effectively isolate and treat infected patients, reduce unnecessary vancomycin drug exposure, and thus slow the development of drug resistance. Early detection is crucial to controlling the spread of VR-Efm. The molecular markers provided in this application enable rapid identification of VR-Efm in the early stages of infection, so that isolation and treatment measures can be taken in a timely manner to reduce the spread of drug-resistant strains.

[0050] This application screened out a specific nucleic acid fragment of VR-Efm, which provided a powerful tool for early screening and accurate diagnosis at the molecular biology level, and helped to take timely treatment measures by quickly identifying drug-resistant genes.

[0051] Nucleic acid molecules of the present application mainly refer to isolated nucleic acid molecules."Isolated" refers to molecules that are substantially free of other biomolecules, such as nucleic acids, proteins, lipids, carbohydrates or other materials, such as cell debris and growth medium.Usually, the term "isolated" is not intended to refer to the complete absence of these materials or the absence of water, buffer or salt, unless they are present in an amount that significantly interferes.

[0052] The second aspect of the embodiments of the present application provides a use of a nucleic acid molecule with a sequence as shown in SEQ ID NO.1 and one or more of the detection reagents of the nucleic acid molecule in the preparation of a vancomycin-resistant enterococcus detection kit.

[0053] Based on this nucleic acid molecule, continuous monitoring of VR-Efm can help reveal the epidemic trend of drug-resistant strains, provide a scientific basis for public health decision-making, and guide the rational use of antibiotics. These molecular markers are highly specific and can be integrated into public health monitoring systems to track the transmission pathways and epidemic trends of VR-Efm, providing a scientific basis for the formulation of effective prevention and control strategies.

[0054] This application not only improves the detection and diagnosis capabilities of VR-Efm through the identification and application of VR-Efm-specific nucleic acid fragments, but also provides an important molecular tool for understanding its biological characteristics and developing new treatments. Specific nucleic acid fragments are not only of great value in clinical diagnosis, but can also be used to study the genetic evolution, drug resistance mechanisms, virulence factor expression, and interactions with other microorganisms of VR-Efm. The findings of this application have opened up new avenues for future research, including the development of new antibiotics, the design of targeted treatment strategies, and the study of interactions between microorganisms and hosts.

[0055] The technical solution provided by this application is a solution for rapid and accurate detection of VR-Efm, which can be used to identify specific nucleic acid fragments of hospital-acquired VR-Efm, thereby facilitating early diagnosis and effective treatment. By analyzing VR-Efm-specific nucleic acid fragments, doctors can better understand the characteristics of the infectious strain, provide patients with personalized treatment plans, and improve treatment effects.

[0056] Traditional diagnostic methods may have a certain misdiagnosis rate. Compared with the current traditional culture method (gold standard), matrix-assisted laser desorption / ionization time-of-flight mass spectrometry and metagenomic sequencing, this application has the obvious advantages of low cost and simple operation, significantly improving the accuracy of diagnosis and reducing the development of inappropriate treatment and drug resistance caused by misdiagnosis.

[0057] The establishment of the technical platform of this application can not only be used for the detection of VR-Efm, but can also be extended to the identification and research of other drug-resistant strains, and has broad application prospects.

[0058] The present application does not specifically limit the detection reagents, and the detection reagents can detect the nucleic acid molecules by, but not limited to, the following methods:

[0059] The PCR method uses DNA polymerase to exponentially amplify a specific DNA fragment (i.e., the nucleic acid molecule) in vitro. By designing specific primers for the specific DNA fragment, the specific DNA fragment can be replicated in large quantities under appropriate temperature cycling conditions.

[0060] Real-time fluorescence quantitative PCR method is to add fluorescent groups to the PCR reaction system, use the accumulation of fluorescent signals to monitor the entire PCR process in real time, and perform quantitative analysis on unknown templates through specific mathematical models.

[0061] Nucleic acid hybridization technology uses the complementary base sequences between single-stranded nucleic acid molecules to form a stable double-stranded structure through base pairing. A nucleic acid probe with a known sequence is hybridized with the nucleic acid in the sample to be tested, and the presence of the target nucleic acid fragment is determined based on the presence and strength of the hybridization signal.

[0062] Gene chip technology fixes a large number of nucleic acid probes with known sequences on a chip carrier, hybridizes them with the labeled sample nucleic acid to be tested, and determines the presence and expression level of the target nucleic acid fragment by detecting the intensity and position of the hybridization signal.

[0063] Sequencing method: common sequencing technologies include Sanger sequencing, second-generation sequencing (NGS) and third-generation sequencing.

[0064] It is understandable that, based on different detection methods, the components of the corresponding detection reagents may be different. In response to the specific nucleic acid fragments discovered in the present application, the embodiments of the present application have developed a molecular marker, including but not limited to PCR primers and probes. In some of the examples, the detection reagents for the nucleic acid molecules include one or more of a primer combination and a probe. Optionally, the primer combination includes a forward primer with a sequence as shown in SEQ ID NO.2 and a reverse primer with a sequence as shown in SEQ ID NO.3. It is understandable that the probe is, for example, a fluorescent probe required in qPCR technology based on PCR technology, or a single-stranded DNA probe that directly binds to the drug-resistant bacteria-specific complementary fragment shown in SEQ ID NO.1. The probe is characterized in that it is a DNA fragment that is partially or completely complementary to the drug-resistant bacteria-specific fragment.

[0065] According to a third aspect of an embodiment of the present application, a vancomycin-resistant enterococcus detection kit is provided, the detection kit comprising a nucleic acid molecule with a sequence as shown in SEQ ID NO.1 and one or more detection reagents for the nucleic acid molecule.

[0066] The definition of the detection reagent is shown in the second aspect. In some examples, the detection reagent for the nucleic acid molecule includes one or more of a primer combination and a probe. In some examples, in some embodiments of the present application, the primer combination includes a forward primer having a sequence as shown in SEQ ID NO.2 and a reverse primer having a sequence as shown in SEQ ID NO.3.

[0067] It is understood that the detection kit of the present application may include other detection reagents in addition to the primer set and the probe, including but not limited to: DNA extraction reagent, PCR amplification reagent, positive quality control product and negative quality control product, etc., wherein the positive quality control product includes a nucleic acid molecule with a sequence as shown in SEQ ID NO.1. The PCR amplification reagent includes, for example, one or more of PCR buffer, DNA polymerase, magnesium ions and dNTPs, which may be mixed or separately packaged, that is, they may be ready-to-use reagents or ready-to-match. These detection reagents may be in dry form or in liquid form. It is understood that the detection kit may also include pure water, and various reagents may be contained in bottles or tubes.

[0068] In a fourth aspect of the embodiments of the present application, a method for detecting vancomycin-resistant enterococci is provided, wherein the method determines whether the sample to be tested contains vancomycin-resistant enterococci by detecting whether a nucleic acid molecule with a sequence such as that shown in SEQ ID NO.1 exists in the DNA of the sample to be tested.

[0069] As defined in the second aspect, the present application does not particularly limit the type of detection reagent and detection method of the nucleic acid molecule shown in SEQ ID NO.1. The embodiments of the present application use the PCR method to explain the technical solution of the present application, but it is understood that the present application is not limited to this. In some examples of the present application, the primer combination used in the PCR method includes a forward primer with a sequence as shown in SEQ ID NO.2 and a reverse primer with a sequence as shown in SEQ ID NO.3.

[0070] It is understandable that, based on the specific primer combination designed in the present application, a suitable PCR initial reaction system and a suitable PCR amplification program can be used. The present application embodiment uses the following initial reaction system and amplification program as an example to explain the detection method of the present application, but it is understandable that the present application is not limited to this. In some examples of the present application, the initial reaction system used in the PCR method includes 0.3 μM-0.6 μM (for example, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6 μM) of the forward primer and 0.3 μM-0.6 μM (for example, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6 μM) of the reverse primer. In some examples of the present application, the amplification program used in the PCR method includes: 94.5°C-95.5°C (for example, 94.5, 94.6, 94.7, 94.8, 94.9, 95, 95.1, 95.2, 95.3, 95.4, 95.5°C) pre-denaturation for 4.5 minutes-5.5 minutes (for example, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5 minutes); 30-40 , each cycle comprising denaturation at 94.5°C-95.5°C (e.g., 94.5, 94.6, 94.7, 94.8, 94.9, 95, 95.1, 95.2, 95.3, 95.4, 95.5°C) for 40 seconds-50 seconds (e.g., 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 seconds), 5 9°C-61°C (e.g., 59, 59.2, 59.4, 59.6, 59.8, 60, 60.2, 60.4, 60.6, 60.8, 61°C) annealing for 55 seconds-65 seconds (e.g., 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 seconds) and 71.5°C-72.5°C (e.g., 71.5, 71.6, 71.7, 71.8, 71.9, 72, 72.1, 72.2, 72.3, The temperature is preferably set to 72.4, 72.5°C) for extension for 55 - 65 seconds (for example, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 seconds); 71.5°C - 72.5°C (for example, 71.5, 71.6, 71.7, 71.8, 71.9, 72, 72.1, 72.2, 72.3, 72.4, 72.5°C) for extension for 7 - 10 minutes (for example, 7, 7.5, 8, 8.5, 9, 9.5, 10 minutes).

[0071] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0072] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0073] 1. VR-Efm collection and identification

[0074] The clinical sample inclusion criteria follow the following 4 points:

[0075] (1) Comprehensiveness of sample sources: Inpatients from the First Affiliated Hospital of Guangzhou Medical University and the First People's Hospital of Foshan were selected, and the sample types collected included urine, bile, feces, sputum, ascites, cerebrospinal fluid, catheter site secretions, pleural effusion, blood, and wound swabs, etc., to ensure the comprehensiveness and diversity of the study and to comprehensively evaluate the drug resistance characteristics of different infection types.

[0076] (2) Clarity of a specific time frame: Sample collection was limited to March 2021 to November 2023 in order to study the development trend of enterococcal resistance within a specific time period, and then track and analyze the spread and evolution of resistant bacteria.

[0077] (3) Diversity of the cohort population: Patients of different ages (ranging from 31 to 93 years old), genders, and with different underlying diseases were included. The patients’ epidemiological and clinical data were collected, including sociodemographic characteristics (age, gender, race), comorbidities (such as cardiovascular disease, liver disease, kidney disease, tumors, central nervous system diseases, chronic lung disease, and diabetes), history of medical device use (such as central venous catheters, endotracheal intubations, and indwelling urinary catheters), history of antibiotic exposure (in the past 30 days), surgical history (including abdominal, traumatic, neurological, vascular, and thoracic surgery), and previous anticancer chemotherapy history, in order to increase the representativeness of the sample and the generalizability of the research results.

[0078] (4) Focus on hospital-acquired infections: By selecting samples of patients hospitalized for more than 24 hours, we focus on studying infection patterns in hospital settings, which helps to distinguish hospital-acquired from community-acquired infections.

[0079] VR-Efm was isolated from 101 clinical samples, as listed in Table 3. It was identified as Enterococcus by matrix-assisted laser desorption / ionization time-of-flight mass spectrometry.

[0080] 2. Drug sensitivity test of VR-Efm

[0081] Refer to the standard drug sensitivity test method to evaluate the sensitivity of VR-Efm to multiple antibiotics.

[0082] First, the strain was cultured in a suitable medium until the logarithmic growth phase, and then a bacterial suspension was prepared with 0.5% Tween 80 saline and appropriately diluted. The diluted bacterial suspension was inoculated on the drug-containing medium and the control medium to ensure that the bacterial liquid was evenly distributed. After culturing at 37°C for 48-72 hours, the growth was observed and the drug resistance percentage was calculated, that is, the ratio of the number of colonies growing on the drug-containing medium to the number of colonies growing on the control medium. Strains with a drug resistance percentage greater than 1% were considered resistant.

[0083] The results of drug sensitivity tests are shown in Table 1. All isolated enterococci were resistant to vancomycin and were VR-Efm strains. All strains were resistant to ampicillin and teicoplanin, and more than 90% of the strains were resistant to daptomycin, rifampicin, and gentamicin.

[0084] In the embodiment of the present application, the drug sensitivity test of VR-Efm is not limited to the above method, and the disk diffusion method can also be used to evaluate the sensitivity of bacteria to antibiotics by measuring the diameter of the inhibition zone around the paper containing antibiotics.

[0085] 3. Minimum inhibitory concentration (MIC) experiment

[0086] MIC assays were performed on strains showing resistance to quantitatively assess their susceptibility to specific antibiotics.

[0087] Purified VR-Efm strains identified by MALDI-TOF MS were selected and inoculated in appropriate liquid culture medium and cultured at 37°C until the logarithmic growth phase. Subsequently, bacterial suspensions were prepared using appropriate diluents to ensure standardization of the final inoculation concentration. The bacterial suspensions were evenly inoculated into broth microdilution plates containing different antibiotic concentrations using a multi-point inoculator. The antibiotics included vancomycin, ampicillin, teicoplanin, daptomycin, rifampicin, gentamicin, streptomycin, and linezolid, and the concentration range was set according to the guidelines of CLSI or EUCAST. The inoculated plates were cultured at 37°C for 24 to 48 hours. The lowest antibiotic concentration for bacterial growth, i.e., MIC value, was recorded by visual observation or automated instrumentation.

[0088] The experimental results showed that all tested VR-Efm strains showed high levels of resistance to vancomycin, ampicillin and teicoplanin, but were mostly sensitive to streptomycin and linezolid. The VR-Efm MIC determination criteria are shown in Table 2. The VR-Efm MIC test results are shown in Table 3.

[0089] The MIC determination of VR-Efm in the examples of the present application is not limited to the above method. A plastic strip (E-test strip) with an antibiotic concentration gradient can also be used. The strip is attached to an agar plate and the MIC value is estimated based on the intersection of the antibiotic concentration and the bacterial growth inhibition zone.

[0090] 4. Screening of VR-Efm-specific nucleic acid fragments

[0091] Whole genome sequencing technology is used to identify specific nucleic acid fragments associated with VR-Efm resistance, including key resistance-related genes, such as the rsmH gene. The present application discovered an unreported specific fragment in the genes of the above-mentioned VR-Efm strain, which is highly conserved in VR-Efm and is uncommon or non-existent in other non-vancomycin-resistant enterococci. By downloading all known full-length Enterococci on NCBI, the VR-Efm sequence obtained by this sequencing was divided into sequences of 300bp in length and the divided sequences were compared using the blast algorithm. The sequences that can only be compared to VR-Efm were selected, and after obtaining the specific sequence, it was submitted to NCBI for nucleic acid sequence comparison. It was found that it had a low similarity with other strains and was a specific sequence of VR-Efm. VR-Efm specific sequence (SEQ ID NO.1): AAGGATTCATCTC ATCCGTTGCGTCCAAAAGAAACCATATCCCTAGAAAATCACTAAATTACCAAACACCATTAGAAGTTTTTTTGAGTTACGTAAATGGAAAGTTTTGTCTCGCTTAATTTGACAAATAATATTATCTAAATGGTGTGTAACATGAAGAGCTAGCTTGGCGTTCTTTACATTTTCCTTTTCTAGTTGTTCCAATCTTGATCGTCTGATT.

[0092] 5. Specific polymerase chain reaction (PCR) detection experiment

[0093] After determining the specific fragment of VR-Efm, a rapid and accurate detection method was developed based on PCR detection experiments.

[0094] First, specific primers were designed based on the specific fragment of VR-Efm, and sequence verification was performed using BLAST to ensure specificity. The specific sequences of the primers are shown in Table 4, where the VR-Efm-F / VR-Efm-R primer combination specifically amplifies the VR-Efm specific fragment shown in SEQ ID NO.1, and the 27F / 1492R primer combination is used as a control, which can specifically amplify enterococcal DNA and thus identify the presence of enterococci.

[0095] Subsequently, total genomic DNA was extracted from 7 clinical samples for PCR detection. Among them, 3 of the 7 clinical samples carried VR-Efm (FV22-8, FV21-1, FV22-6), and the other 4 clinical samples carried non-vancomycin-resistant enterococci (FV23-59, GV4-59, GV4-98, GV2-58).

[0096] In order to further verify the universality and effectiveness of this application, this application supplements the experimental data for the extended sample set, aiming to strengthen the scientific basis and practical value claimed by this application. The three supplemented samples are recorded as A, B, and C. The supplemented samples are different from the 101 samples recorded in Table 3. Among them, A, B, and C are confirmed to be samples carrying non-vancomycin-resistant enterococci by matrix-assisted laser desorption / ionization (MALDI) mass spectrometry identification method.

[0097] PCR experiments were performed in an RT-PCR medium containing 10 ng genomic DNA, 1× PCR buffer, 200 μM of each dNTP, 1.5 mM MgCl 2 , 0.5 μM of each primer and 1 unit of Taq DNA polymerase.

[0098] The PCR program consisted of an initial denaturation step at 95°C for 5 min, followed by 40 cycles, each cycle consisting of denaturation at 95°C for 45 s, annealing at 60°C for 60 s, and extension at 72°C for 60 s, and finally a final extension at 72°C for 10 min.

[0099] PCR products were analyzed by 1.5% agarose gel electrophoresis in 1× TAE buffer, stained with SYBR SafeDNA Gel Stain, and visualized under UV light by Gel Doc XR+ System.

[0100] PCR test results are as follows Figure 1 , Figure 2 , Figure 3 and Figure 4 shown.

[0101] Figure 1The primer combination used was VR-Efm-F / VR-Efm-R. Clinical samples carrying VR-Efm were amplified to produce obvious specific bands, while clinical samples carrying non-vancomycin-resistant enterococci did not produce any bands. The use of the above primer combination can accurately distinguish VR-Efm from non-vancomycin-resistant enterococci. Figure 2 The primer combination used was 27F / 1492R, and all samples produced bands, proving that the samples carried enterococci. The PCR products were further sequenced using the Sanger sequencing method and compared with the reference gene sequence using the BLAST algorithm to confirm the specificity of the PCR products.

[0102] Figure 3 The primer combination used was VR-Efm-F / VR-Efm-R. No bands were produced in samples A, B, and C, while obvious bands were produced in FV21-1, FV22-6, and FV22-8. The detection results were consistent with the matrix-assisted laser desorption / ionization (MALDI) mass spectrometry technology. Figure 4 The primer combination used was 27F / 1492R, and all samples produced bands, proving that enterococci were present in the samples.

[0103] Through these steps, the inventors successfully established a PCR detection method that can not only specifically detect VR-Efm, but also quickly diagnose infection in the early stages, providing an important molecular tool for clinical treatment. This PCR-based detection method has the advantages of simple operation, high cost-effectiveness and easy promotion, and is expected to play an important role in public health monitoring and pathogen control.

[0104] Table 1

[0105]

[0106] Table 2

[0107]

[0108] Table 3

[0109]

[0110]

[0111]

[0112]

[0113] Table 4. Primer sequences

[0114] Primer Primer sequences (5'-3') 27F AGAGTTTGATCCTGGCTCAG SEQ ID NO.4 1492R TACGGCTACCTTGTTACGACTT SEQ ID NO.5 VR-Efm-F AATCAGACGATCAAGATTGGAACAAC SEQ ID NO.2 VR-Efm-R AAGGATTCATCTCATCCGTTGCG SEQ ID NO.3

[0115] Overall, the present application provides an efficient early screening method for specific nucleic acid fragments of VR-Efm, significantly improving the accuracy and timeliness of diagnosis. The present application provides important guidance for clinical treatment by accurately identifying the drug-resistant genes of VR-Efm, which helps to select effective antibiotics and improve the treatment effect. At the same time, the revealed drug resistance mechanism provides potential targets for new drug development and promotes the research and development of anti-resistance drugs. In addition, the detection technology of the present application provides a powerful tool for public health monitoring and prevention and control, which helps to control the spread of VR-Efm, reduce hospital infection rates, and improve the level of public health safety.

[0116] The technical features of the above-mentioned implementation modes and examples can be combined in any appropriate manner. To make the description concise, not all possible combinations of the technical features in the above-mentioned implementation modes and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0117] The above-described embodiments only express several implementation methods of the present application, which is convenient for understanding the technical solution of the present application in detail, but it cannot be understood as a limitation on the scope of protection of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present application, several deformations and improvements can be made, which all belong to the protection scope of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, the technicians in this field can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by the technicians in this field through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the protection scope of the claims attached to the present application. Therefore, the protection scope of the patent of the present application shall be based on the content of the attached claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. A nucleic acid molecule, characterized in that The sequence of the nucleic acid molecule is shown as SEQ ID NO.

1.

2. Use of one or more of the nucleic acid molecules having a sequence as shown in SEQ ID NO.1 and the detection reagents of the nucleic acid molecules in the preparation of a kit for detecting vancomycin-resistant enterococci.

3. The use according to claim 2, characterized in that: The nucleic acid molecule detection reagent includes one or more of a primer combination and a probe; Optionally, the primer combination includes a forward primer whose sequence is shown as SEQ ID NO.2 and a reverse primer whose sequence is shown as SEQ ID NO.

3.

4. A kit for detecting vancomycin-resistant enterococci, characterized in that: The detection kit comprises a nucleic acid molecule having a sequence as shown in SEQ ID NO.1 and one or more detection reagents for the nucleic acid molecule.

5. The vancomycin-resistant enterococcus detection kit according to claim 4, characterized in that: The nucleic acid molecule detection reagent includes one or more of a primer combination and a probe; Optionally, the primer combination includes a forward primer whose sequence is shown as SEQ ID NO.2 and a reverse primer whose sequence is shown as SEQ ID NO.

3.

6. The vancomycin-resistant enterococcus detection kit according to any one of claims 4 to 5, characterized in that: The detection kit further comprises one or more of a DNA extraction reagent, a PCR amplification reagent, a positive quality control product and a negative quality control product, wherein the positive quality control product comprises a nucleic acid molecule whose sequence is shown in SEQ ID NO.1; Optionally, the PCR amplification reagent includes one or more of PCR buffer, DNA polymerase, magnesium ions and dNTPs.

7. A method for detecting vancomycin-resistant enterococci, characterized in that: The detection method determines whether the sample to be tested contains vancomycin-resistant enterococci by detecting whether a nucleic acid molecule with a sequence such as that shown in SEQ ID NO.1 exists in the DNA of the sample to be tested.

8. The method for detecting vancomycin-resistant enterococci according to claim 7, characterized in that: The detection method includes PCR method; Optionally, the primer combination used in the PCR method includes a forward primer with a sequence as shown in SEQ ID NO.2 and a reverse primer with a sequence as shown in SEQ ID NO.

3.

9. The method for detecting vancomycin-resistant enterococci according to claim 8, characterized in that: The initial reaction system used in the PCR method includes 0.3 μM-0.6 μM of the forward primer and 0.3 μM-0.6 μM of the reverse primer.

10. The method for detecting vancomycin-resistant enterococci according to any one of claims 8 to 9, characterized in that: The amplification program adopted in the PCR method includes: pre-denaturation at 94.5°C-95.5°C for 4.5 minutes-5.5 minutes; 30-40 cycles, each cycle including denaturation at 94.5°C-95.5°C for 40 seconds-50 seconds, annealing at 59°C-61°C for 55 seconds-65 seconds and extension at 71.5°C-72.5°C for 55 seconds-65 seconds; extension at 71.5°C-72.5°C for 7 minutes-10 minutes.

Images