Specific primer for detecting acinetobacter baumannii and application thereof
By designing specific primers baylyi-F and baylyi-R, and combining PCR amplification and gel electrophoresis, the high cost and misjudgment problems of Acinetobacter belyi detection were solved, and rapid and accurate Acinetobacter belyi detection was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YANGZHOU UNIV
- Filing Date
- 2025-01-23
- Publication Date
- 2026-05-22
AI Technical Summary
Current technologies lack specific PCR primers for Acinetobacter belye, resulting in high detection costs and long processing times, as well as the risk of misinterpretation during sequence alignment.
Specific primers, baylyi-F and baylyi-R, were designed and provided for the PCR detection of Acinetobacter belyi. Combined with agarose gel electrophoresis and Sanger sequencing, the accuracy and efficiency of the detection were ensured.
Rapid and accurate detection of Acinetobacter belyi was achieved in just 3 hours with a 100% accuracy rate, and it was successfully applied to conjugation transfer experiments.
Smart Images

Figure CN119842940B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the detection of Acinetobacter bacilli, and more specifically, to a specific primer for detecting Acinetobacter belyeh and its application. Background Technology
[0002] Acinetobacter is a group of aerobic, Gram-negative bacteria, comprising up to 116 species, widely distributed in humans, animals, and the natural environment. As important opportunistic pathogens globally, Acinetobacter bacteria often exhibit multidrug resistance phenotypes. Data from the China Antimicrobial Resistance Monitoring Network also shows that the resistance rate of these strains is increasing year by year. Among them, *Acinetobacter belyi* possesses an extremely strong ability to capture exogenous DNA, making it particularly noteworthy. For example, *Acinetobacter belyi* ADP1 has become one of the commonly used recipient bacteria in laboratories for determining the horizontal transfer ability of genes, including carbapenem resistance genes. bla NDM and tigecycline resistance gene tet (X).
[0003] Currently, the classic method for identifying bacteria is classification based on their physiological and biochemical characteristics, but this method is costly and time-consuming. 16S rDNA and rpoB Gene sequencing is also a common method for identifying bacteria, but the genus *Acinetobacter* is diverse, with little difference in gene sequence among species, leading to a significant risk of misidentification. In contrast, PCR detection technology using specific primers is not only simple, efficient, and low-cost, but also overcomes the shortcomings of sequence alignment misidentification. However, no reports have yet been found regarding specific PCR primers for *Acinetobacter belyeh* and their applications. Summary of the Invention
[0004] To address the current lack of specific PCR primers for Acinetobacter belyi, this invention provides a specific primer for detecting Acinetobacter belyi and its application. This specific primer can efficiently detect Acinetobacter belyi, promoting rapid detection of this type of pathogen.
[0005] To achieve the above objectives, the present invention provides a specific primer for detecting Acinetobacter belyeh, comprising:
[0006] baylyi-F:TTGCTTCACCCGCCAAAATG
[0007] baylyi-R: TTCTTGGCCTGTACGCATCA.
[0008] A second aspect of the present invention provides the application of the above-described specific primers in the preparation of products for detecting Acinetobacter belye.
[0009] Preferably, the product is a reagent kit.
[0010] A third aspect of the present invention provides the application of the above-described specific primers in the detection of Acinetobacter belyeh.
[0011] A fourth aspect of the present invention provides a method for detecting Acinetobacter belyi, comprising the following steps:
[0012] S1. PCR amplification of the genomic DNA of the test strain was performed using the specific primers described above.
[0013] S2. If the gel electrophoresis results show a clear and single DNA band of 370 bp, then the strain is identified as Acinetobacter belyeh.
[0014] Specifically, in step S1, the minimum detection concentration of genomic DNA is 1.504 × 10⁻⁶. -6 ng / μL.
[0015] Through the above technical solution, the present invention achieves the following beneficial effects:
[0016] 1. PCR amplification was performed using the primers of this invention. After 1.2% agarose gel electrophoresis and Sanger sequencing, a clear and single 370 bp DNA band was observed. The bacterial culture PCR detection of Acinetobacter belyi showed 100% accuracy, took only 3 hours, and was successfully applied to the conjugation transfer experiment of Acinetobacter belyi ADP1.
[0017] 2. The specific detection method for Acinetobacter belyi provided by this invention is simple to operate, efficient and highly accurate. Attached Figure Description
[0018] Figure 1 This is the matching result of primers baylyi-F and baylyi-R with the gene template in Example 1;
[0019] Figure 2 This is the Blasten alignment result of the measured PCR product sequence and the gene template in Example 1;
[0020] Figure 3 This is the result of the optimal annealing temperature determination for the Acinetobacter belyeh specific primers in Example 2;
[0021] Figure 4 This is the stability result of the Acinetobacter belyeh specific primers in Example 3;
[0022] Figure 5 This is the result of the PCR detection limit determination of Acinetobacter belyi genomic DNA in Example 4. Detailed Implementation
[0023] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0024] Example 1: Design and validation of primers for Acinetobacter belyeh.
[0025] (1) Design specific primers
[0026] Twenty-one strains of *Acinetobacter belittleae* were collected from the NCBI database and laboratory records. Based on whole-genome quality control assessment and average nucleotide identity analysis, 17 strains met the standards. Specific primers baylyi-F (TTGCTTCACCCGCCAAAATG) and baylyi-R (TTCTTGGCCTGTACGCATCA) were designed using the Primer-BLAST online website based on the specific homologous gene (564 bp encoding a domain protein) of these 17 *Acinetobacter belittleae* strains. SnapGene Version 6.0.2 confirmed that the primer sequences bound completely to the corresponding gene templates. Figure 1 ).
[0027] (2) Preparation of DNA template
[0028] Acinetobacter belyeh ADP1 three-zone streaks were plotted on antibiotic-free LB agar plates and incubated at 37 ℃ for 18 h. A half-loop of bacterial growth was scraped using a 10 μL disposable inoculation loop and added to 500 μL of physiological saline. After centrifugation and removal of the supernatant, genomic DNA was extracted according to the procedures outlined in the Tiangen Bacterial Genomic DNA Extraction Kit. The concentration was then measured to be 201.801 ng / μL using a micro-UV spectrophotometer and stored at -20 ℃ for later use.
[0029] (3) Establish a PCR detection method for Acinetobacter belyi.
[0030] PCR system: 2 × Taq Master Mix (Novizan), 12.5 μL; DNA template, 1 μL; upstream and downstream primers, 1 μL each; sterile water, 9.5 μL.
[0031] PCR program: 94 ℃ pre-denaturation for 3 min, (94 ℃ denaturation for 30 s, 57.5 ℃ annealing for 30 s, 72 ℃ extension for 1 min) × 35 cycles, 72 ℃ final extension for 10 min, and storage at 16 ℃.
[0032] (4) Determination of PCR amplification results
[0033] 10 μL of the PCR product was subjected to 1.2% agarose gel electrophoresis, and images were taken using a Tanon 2500 gel imaging system, revealing clear and single electrophoretic bands. The PCR amplification product was sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing, and the measured PCR product sequence size was 370 bp.
[0034] GATTGATGCAAGTCAGCCAAATTGATGATTTACTGCGCCAATCTCTCACAGAACTTTCGCCTTACTATGACAAGCAAGCCGAACAGATTATTCTCAATATTACCAAATCTACGACACTTAACGACAAAGAAAGACAAGCAGCGACACAATTGAGTCAACTCATGCGTGATTCAAGTACTCAAATT ATCAGTAATCCAAAAACCCACAGGCTATTGAAGATATTTACTTAAAAACCTATACAGAGGAAGAAGTACAAGCCAGCATCAAGTTTTTAAAAACACCTGAAGGGCAATCAATTACTCGCAAAAATGCAAAAATGATGGGTGAACTTTCTGAATACATGATGCGTACAGGCCAAGAAAAAAAATT.
[0035] Furthermore, the alignment results between the measured sequence and the gene template were also as expected, indicating that it was the same gene. Figure 2 ).
[0036] Example 2: Determination of the optimal annealing temperature
[0037] Using the genomic DNA of Acinetobacter belyi ADP1 as a template, PCR amplification was performed according to the PCR system and procedure established in Example 1 (3). The annealing temperature gradients were set to 46 ℃, 47.6 ℃, 49.3 ℃, 50.9 ℃, 52.5 ℃, 54.2 ℃, 55.8 ℃, 57.5 ℃, 59.1 ℃, 60.7 ℃, 62.4 ℃, and 64 ℃, with three replicates for each temperature. 10 μL of PCR product was aspirated for 1.2% agarose gel electrophoresis and detected using a Tanon 2500 gel imaging system with an exposure time of 1 s. Finally, the results were analyzed for grayscale values using ImageJ Version 1.54m software. The results are as follows: Figure 3 As shown, the optimal annealing temperature is 57.5 ℃.
[0038] Example 3: Determination of primer stability
[0039] Acinetobacter belyeh specific primers were stored at room temperature, 4 ℃, and -20 ℃, and samples were collected on days 1, 3, 5, 7, and 10. PCR amplification was performed at 57.5 ℃, with three replicates for each temperature. 10 μL of the PCR product was subjected to 1.2% agarose gel electrophoresis, followed by detection using a Tanon 2500 gel imaging system with an exposure time of 1 second. Finally, the grayscale analysis software ImageJ Version 1.54m was used for analysis. The results are as follows: Figure 4 As shown, -20 ℃ low temperature conditions are more conducive to maintaining primer stability.
[0040] Example 4: Determination of the Limit of Detection
[0041] Genomic DNA of Acinetobacter belyi ADP1 was serially diluted twofold using sterile water to a final concentration of 1.879 × 10⁻⁶. -7 ng / μL. Using the diluted genome as a template, PCR amplification was then performed at 57.5 ℃. Figure 5 It can be seen that dilution 2 -27 The target gene band subsequently disappeared, and the detection limit for genomic DNA was 1.504 × 10⁻⁶. -6 ng / μL.
[0042] Example 5: Accuracy of PCR detection of Acinetobacter belyi bacterial culture
[0043] A total of 80 bacterial strains were tested, including 11 *Acinetobacter belyeh* strains, 20 *Escherichia coli* strains, 19 *Acinetobacter variants* strains, 8 *Acinetobacter tangs* strains, 6 *Acinetobacter ininus* strains, 4 *Acinetobacter schenckii* strains, 2 *Acinetobacter sichuanensis* strains, 2 *Acinetobacter lyovovich* strains, 2 *Acinetobacter pseudolyovovich* strains, 2 *Acinetobacter amygdalae* strains, 1 *Georgia feroxina* strain, 1 *Klebsiella pneumoniae* strain, 1 *Salmonella* strain, and 1 *Acinetobacter baumannii* strain. 1 μL of fresh bacterial culture was used as template for PCR amplification at 57.5 ℃. 10 μL of the PCR product was subjected to 1.2% agarose gel electrophoresis, followed by imaging with a Tanon 2500 gel imaging system with an exposure time of 1 s. The entire detection process took only 3 h. The results are shown in Table 1. *Acinetobacter belyeh* showed clear and single 370 bp bands, while other strains showed no bands and were negative. The accuracy of PCR detection of *Acinetobacter belyeh* bacterial culture was 100%.
[0044] Table 1. Detection results of Acinetobacter belyeh specific primers
[0045]
[0046] Example 6 Application of Acinetobacter belyeh specific primers—Conjugation transfer experiment
[0047] Using rifampicin-resistant Acinetobacter belyi ADP1 as the recipient bacterium, and tigecycline-resistant... tet (X3) Positive Acinetobacter ames JXZ5-1 was used as the donor bacterium for membrane conjugation transfer experiments at a volume ratio of 3:1. Screening was performed using LB double-drug plate assays with rifampicin (100 µg / mL) and tigecycline (2 µg / mL), and specific primers baylyi-F / baylyi-R were used to obtain... tet PCR detection of the (X3) gene in Acinetobacter belyi ADP1 was performed. The results showed that the strains grown on the double-drug plate exhibited a specific 370 bp band, which were all conjugates.
[0048] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0049] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.
[0050] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.
Claims
1. A specific primer for detecting Acinetobacter belyeh, characterized in that, include: baylyi-F:TTGCTTCACCCGCCAAAATG baylyi-R: TTCTTGGCCTGTACGCATCA.
2. The use of the specific primers described in claim 1 in the preparation of products for detecting Acinetobacter belye.
3. The application according to claim 2, characterized in that, The product in question is a reagent kit.