Method for detecting staphylococcus aureus through real-time fluorescent PCR (polymerase chain reaction) and application

Abstract

The invention relates to the technical field of bacterial detection, and aims to provide a method for detecting staphylococcus aureus through real-time fluorescent PCR and application. The method comprises the following steps: (1) collecting a sample; (2) extracting a genome of a sample to be detected: extracting the collected sample, and taking a certain amount of the genome of the final product sample as a subsequent template; (3) real-time fluorescent PCR detection: taking the genome in the step (2) as a template, preparing a reaction system by using a primer and a probe, setting an amplification reaction program, and carrying out real-time fluorescent PCR detection; and (4) result interpretation: judging whether the to-be-detected sample is infected with the staphylococcus aureus or not according to the real-time fluorescence PCR detection result. The detection method has the advantages of high sensitivity, strong specificity and accurate quantification, and is suitable for detecting staphylococcus aureus in a large number of samples.

Description

Technical Field

[0001] The invention relates to the field of bacteria detection, and in particular to a method and application of real-time fluorescence PCR for detecting Staphylococcus aureus. Background Art

[0002] Staphylococcus aureus, also known as golden Staphylococcus, belongs to the genus Staphylococcus and is a representative of Gram-positive bacteria. It is about 0.8 μm in diameter and is arranged in the shape of grapes under a microscope. Staphylococcus aureus was first discovered in 1880 by surgeon Alexander Ogston from a patient's abscess in Aberdeen, Scotland. Staphylococcus aureus is widely found in nature, such as soil, air, water and animal surfaces, so experimental animals are easily exposed to this bacterium. Once experimental animals are infected with Staphylococcus aureus, they may develop various symptoms of disease, including skin infections, respiratory infections, digestive tract infections, etc. These symptoms not only affect the appearance of the animals, but may also have a serious impact on the animals' activities and survival ability. For example, respiratory tract infections may cause animals to have symptoms such as difficulty breathing, coughing, and fever, and in severe cases may even threaten the animals' lives; digestive tract infections may cause animals to have symptoms such as diarrhea, vomiting, and decreased appetite, affecting the growth and development of animals.

[0003] At present, the methods for detecting Staphylococcus aureus in experimental animals in China include PCR (polymerase chain reaction) detection technology and biological detection methods. PCR detection technology refers to the process of amplifying and detecting specific DNA sequences or genes using PCR (polymerase chain reaction) technology. PCR is a method for amplifying DNA fragments in vitro, and its basic principle is based on DNA replication and the enzymatic activity of DNA polymerase. Among them, PCR is superior to biological detection methods and has relatively high sensitivity and specificity. However, from the perspective of detecting the health of experimental animals and ensuring the accuracy of experimental results, PCR detection technology still has the disadvantages of relatively low sensitivity, long time consumption, and inability to accurately quantify. For example, PCR is not sensitive enough for detecting low-concentration DNA samples; PCR requires subsequent electrophoresis analysis to confirm the amplification results, which makes the detection time-consuming; PCR cannot directly provide quantitative information about the amount of starting DNA template, which is a great disadvantage for applications that require accurate measurement of DNA quantity.

[0004] As a key part of the comprehensive quality assurance strategy, it is of great significance to explore a method with higher sensitivity, shorter experimental time and suitable for detecting Staphylococcus aureus in a large number of samples. Summary of the invention

[0005] The present invention is a method and application for detecting Staphylococcus aureus by real-time fluorescence PCR invented to meet the urgent needs of current laboratory animal health monitoring.

[0006] The first aspect of the present invention aims to provide a method for detecting Staphylococcus aureus by real-time fluorescence PCR.

[0007] The second aspect of the present invention aims to provide an application of a method for detecting Staphylococcus aureus by real-time fluorescence PCR.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is:

[0009] The first aspect of the present invention provides a method for detecting Staphylococcus aureus by real-time fluorescence PCR, comprising the following steps:

[0010] (1) Sample collection: Samples include organ tissue, cecal contents or feces, blood, swabs, and cell cultures;

[0011] (2) Extracting the genome of the sample to be tested: Extracting the collected sample and taking a certain amount of the final product sample genome as a subsequent template;

[0012] (3) Real-time fluorescence PCR detection: using the genome of step (2) as a template, preparing a reaction system using primers and probes, and setting an amplification reaction program to perform real-time fluorescence PCR detection;

[0013] (4) Result interpretation: Determine whether the sample is infected with Staphylococcus aureus based on the real-time fluorescence PCR test results;

[0014] Among them, the sample volume collected in step (2) is 200uL.

[0015] Preferably, the primer and probe sequences used in the method are as follows:

[0016] The sequences of the primers are:

[0017] SA-FA: 5'-GCAGTCAATTGCACAGGTGG-3' (SEQ ID NO: 1);

[0018] SA-RA: 5'-ATAGTGACGTTTGTAGCCGCC-3' (SEQ ID NO: 2);

[0019] The sequence of the probe is:

[0020] SA-PA: 5'-CCAGTGGCTCAAATTGCAGA-3' (SEQ ID NO: 3);

[0021] Preferably, both ends of the sequence of the probe are labeled with a reporter fluorescent group and a quencher fluorescent group, respectively.

[0022] Further preferably, the reporter fluorescent group at the 5' end of the probe is selected from FAM, VIC, ROX, HEX or CY5; and the quencher fluorescent group at the 3' end of the probe is selected from BHQ1, BHQ2 or BHQ3.

[0023] Preferably, the positive control used in the method is a Staphylococcus aureus nucleic acid, and the positive control sequence is as follows: CATAGTGAATTGCAGTCAATTGCACAGGTGGCCACACATTACAGTATTCCCATCATAACTATATCTAGTACAGCTAATAATCCAGT GGCTCAAATTGCAGACTATGCATTGATTTATGGCAGAACTGATGAAAATGAAATGCGTATGGCGGCTACAACGTCACTATTTGCAC AGTTATTCACGG (SEQ ID NO: 10).

[0024] Preferably, the reaction system includes 10 μL of 2×AceQ qPCR Probe Master Mix; 0.8 μL of each of the forward, reverse, upstream and downstream primers; 1 μL of TaqMan probe; 2 μL of DNA template; and water is added to 20 μL.

[0025] Preferably, the sample genome in step (2) is nucleic acid.

[0026] Preferably, the amplification reaction procedure includes: 1) removing contamination at 37°C for 2 minutes; 2) pre-denaturation at 95°C for 5 minutes; 3) denaturation at 95°C for 15 seconds; 4) annealing at 60°C, extending for 45 seconds, 40 cycles, and single-point fluorescence detection at 60°C.

[0027] Preferably, the annealing comprises: lowering the temperature of the reaction mixture to 40-60° C., and hybridizing the oligonucleotide primer with the single-stranded template to form a DNA template-primer complex.

[0028] Preferably, the extension comprises: the DNA template-primer complex, under the action of Taq DNA polymerase, uses the target sequence as a template and synthesizes a new chain complementary to the template DNA chain according to the principles of base pairing and semi-conservative replication.

[0029] In a second aspect, the present invention also provides an application of a method for detecting Staphylococcus aureus by real-time fluorescence PCR, wherein the application is to perform experimental detection on humans, pets and experimental rodents, wherein the pets include dogs, cats and rabbits, and the experimental rodents include mice, rats, hamsters and guinea pigs.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] In view of the deficiencies of the current existing technology, the present invention provides a method for detecting Staphylococcus aureus by real-time fluorescence PCR based on TaqMan probe. The screened primers and probes are highly adaptable, can achieve higher sensitivity, strong specificity and accurate quantitative effects, and are suitable for detecting Staphylococcus aureus in a large number of samples.

[0032] The present invention can detect target nucleic acids at lower concentrations and has higher sensitivity; the present invention has high specificity through specific amplification based on DNA or RNA, and the present invention detects specific gene sequences by designing specific primers and probes, thereby avoiding cross-reactions and false positive results. The present invention can quickly obtain output results by performing real-time monitoring and result analysis while amplifying DNA. The PCR amplification process itself has a high degree of stability and repeatability, so that the fluorescent PCR results have better consistency and reliability between different laboratories and operators. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0035] Figure 1 The fluorescence PCR detection result of the primer / probe combination of group A provided in Example 2 of the present invention;

[0036] Figure 2 The fluorescence PCR test results of the primer / probe combination of group B provided in Example 2 of the present invention;

[0037] Figure 3 The fluorescence PCR test results of the primer / probe combination of Group C provided in Example 2 of the present invention;

[0038] Figure 4 The fluorescence PCR detection result of the primer / probe combination of group A provided in Example 3 of the present invention;

[0039] Figure 5 The fluorescence PCR test results of the primer / probe combination of group B provided in Example 3 of the present invention;

[0040] Figure 6 The fluorescence PCR detection result of the primer / probe combination of group C provided in Example 3 of the present invention;

[0041] Figure 7 This is the fluorescence PCR detection result provided in Example 4 of the present invention. DETAILED DESCRIPTION

[0042] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0043] Example 1

[0044] The present invention provides a detection method for detecting Staphylococcus aureus using real-time fluorescence PCR technology, and the detection method comprises the following steps:

[0045] (1) Sample collection: selected from organ tissue, cecal contents or feces, blood, swabs or cell culture;

[0046] (2) Extracting the genome of the sample to be tested: Take 200uL of the above-treated sample for extraction. The genome extraction is carried out using a kit (FastPure Blood / Cell / Tissue / Bacteria DNA Isolation MiniKit from Novezan, Cat: DC 112-02; Lot: 7E0580L3). Perform the extraction operation according to the instructions in the kit and take an appropriate amount of the final product sample genome as a subsequent template;

[0047] (3) Prepare a fluorescent PCR reaction system, which includes 10 μL of 2×AceQ qPCR Probe Master Mix; 0.8 μL of each of the forward and reverse upstream and downstream primers (10 μmol / L); 1 μL of TaqMan probe (10 μmol / L); 2 μL of DNA template; and add water to 20 μL.

[0048] As shown in Table 1:

[0049] Table 1 Fluorescence PCR reaction system

[0050] name Dosage / Serving 2×AceQ qPCR Probe Master Mix 10μL Forward primer (10 μmol / L) 0.8μL Reverse primer (10 μmol / L) 0.8μL Probe (10 μmol / L) 1μL DNA template 2μL <![CDATA[ddH2O]]> 5.4μL Total volume 20μL

[0051] In the above reaction system, 2×AceQ qPCR Probe Master Mix is ​​a special reagent for fluorescent PCR using the probe method, which has the characteristics of good specificity, high sensitivity and strong stability. This product is an optimized premixed reagent with two times the concentration, which can obtain a good standard curve in a wide quantitative range, accurately quantify and detect the target gene, with good repeatability and high credibility.

[0052] In the above reaction system, the primers and probes were compared by searching the entire genome sequence of Staphylococcus aureus on the NCBI website. The primers and probes were designed using Primer Premier 5 software based on the conserved sequence of the Staphylococcus aureus genome. The designed primers, probes and positive control sequences are as follows:

[0053] The primer and probe sequences are as follows:

[0054] The sequences of the primers are:

[0055] SA-F: 5'-GCAGTCAATTGCACAGGTGG-3' (SEQ ID NO: 1);

[0056] SA-R: 5'-ATAGTGACGTTTGTAGCCGCC-3' (SEQ ID NO: 2);

[0057] The sequence of the probe is:

[0058] SA-P: 5'-CCAGTGGCTCAAATTGCAGA-3' (SEQ ID NO: 3);

[0059] Both ends of the probe sequence are labeled with a reporter fluorescent group and a quencher fluorescent group, respectively. The reporter fluorescent group modified at the 5' end of the probe is selected from FAM, VIC, ROX, HEX or CY5, etc.; the quencher fluorescent group modified at the 3' end of the probe is selected from BHQ1, BHQ2 or BHQ3, etc.

[0060] The positive control is Staphylococcus aureus nucleic acid, and the positive control sequence is as follows:

[0061] CATAGTGAATTGCAGTCAATTGCACAGGTGGCCACACATTACAGTATTCCCATCATAACTATATCTAGTACAGCTAATAATCCAGT

[0062] GGCTCAAATTGCAGACTATGCATTGATTTATGGCAGAACTGATGAAAATGAAATGCGTATGGCGGCTACAACGTCACTATTTGCAC AGTTATTCACGG (SEQ ID NO: 10).

[0063] The DNA template is the nucleic acid extracted in step (2);

[0064] The above-mentioned ddH2O, i.e. double distilled water, is a kind of redistilled water. It is water obtained by distilling water again after it has been distilled once. Its purity is higher than that of distilled water.

[0065] (4) Amplification reaction procedure: 1. Decontamination: 37°C, 2 min; 2. Pre-denaturation: 95°C, 5 min; 3. Denaturation: 95°C, 15 s; 4. Annealing, extension: 60°C, 45 s, 40 cycles, single-point fluorescence detection at 60°C. As shown in Table 2:

[0066] Table 2

[0067]

[0068] The principle of pre-denaturation and denaturation in the above amplification reaction procedure is: when the template DNA is heated to 90-95°C, the hydrogen bonds of the double helix structure are broken, and the double strands are unwound into a single strand state so that it can bind to the primers and prepare for the next round of reaction;

[0069] The annealing principle in the above amplification reaction procedure is: the temperature of the reaction mixture is lowered to 40-60°C, the oligonucleotide primers hybridize with the single-stranded template, and a DNA template-primer complex is formed;

[0070] The above extension principle: Under the action of Taq DNA polymerase, the DNA template-primer complex uses the target sequence as a template and synthesizes a new chain complementary to the template DNA chain according to the principles of base pairing and semi-conservative replication.

[0071] (5) Interpretation of results

[0072] The blank control has no Ct value and no fluorescence amplification curve, which is always a horizontal line;

[0073] The negative control has no Ct value and no fluorescence amplification curve, which is always a horizontal line;

[0074] The positive control Ct value should be ≤35, and there should be an obvious fluorescence amplification curve, which indicates that the reaction system is running normally. Otherwise, the test is invalid and real-time fluorescence PCR amplification needs to be repeated.

[0075] Specific results judgment:

[0076] If there is no fluorescence amplification curve in the sample to be tested, the sample pathogen nucleic acid is judged to be negative;

[0077] If the sample to be tested has a fluorescence amplification curve and the Ct value should be ≤35, the sample is judged to be positive for pathogen nucleic acid;

[0078] If the Ct value of the sample to be tested is between 35 and 40, the real-time fluorescence PCR test should be repeated. After retesting, if the Ct value is ≥40, the sample pathogen nucleic acid is judged to be negative. If the Ct value after retesting is still between 35 and 40, the sample pathogen nucleic acid is judged to be suspected positive and further sequence determination is required.

[0079] The performance of the primer determines the quality of the real-time fluorescence PCR detection effect. Example 2 and Example 3 screened multiple sets of primer / probe combinations for the detection indicator Staphylococcus aureus, and finally screened out a set of optimal primer / probe combinations. Example 2 and Example 3 are intended to illustrate the design and screening process of primer / probe combinations through sensitivity verification and specificity verification.

[0080] Design of primers and probes: The entire genome sequence of Staphylococcus aureus was searched on the NCBI website for comparison. Primers and probes were designed using Primer Premier 5 software based on the conserved sequences of the Staphylococcus aureus genome. Three sets of primers and three sets of probes were designed as shown in Table 3.

[0081] Table 3 Primer and probe sequences

[0082]

[0083] Example 2

[0084] In this example, the detection method constructed in Example 1 was used to verify the sensitivity of three sets of primer / probe combinations. The verification process was as follows:

[0085] Determine the concentration of Staphylococcus aureus plasmid DNA and calculate the number of copies per μL of plasmid; dilute the plasmid to a concentration of 2.08×10 7 , 2.08×10 6 , 2.08×10 5 , 2.08×10 4 , 2.08×10 3 , 2.08×10 2 , 2.08×10 1 , 2.08 copies / μL; using the above-mentioned Staphylococcus aureus plasmid DNA as a template, the fluorescent PCR reaction system was configured according to Example 1 to perform fluorescent PCR amplification. The above-mentioned Staphylococcus aureus strains were isolated and purified from clinical samples in this laboratory.

[0086] Copy number calculation formula: (6.02×10 23 Copies / mole) × (concentration g / mL) / (MW g / mol) = copies / mL; copies / mL × 1000 = copies / μL;

[0087] Result judgment:

[0088] The experimental results are shown in Table 4 and Figure 1-3As shown in the figure, the Ct values ​​of group A and group B were ≤35, indicating that the detection method of the present invention is effective, and the detection of Staphylococcus aureus by the primer / probe combination of group A can reach 2.08 copies / μL, and the detection of Staphylococcus aureus by group B can reach 2.08×10 1 Copy number / μL; The fluorescence PCR test results of the three groups are as follows Figure 1-3 The fluorescence amplification curve shown in the figure indicates that the real-time fluorescence PCR method has high sensitivity and good amplification effect. The slope of the exponential phase of the amplification curve of group A is larger than that of group B, indicating that the primer / probe combination of group A has high sensitivity and obvious changes in fluorescence signals, which is conducive to the detection of low-concentration samples.

[0089] Table 4

[0090]

[0091] Example 3

[0092] This example specifically verifies the detection method constructed in Example 1 for three sets of primer / probe combinations, and the verification process is as follows:

[0093] Pseudomonas aeruginosa, Shigella dysenteriae, Klebsiella pneumoniae, Coryneform bacteria, Pasteurella multocida, Escherichia coli, Salmonella, beta-hemolytic Streptococcus, Bordetella bronchiseptica, Campylobacter jejuni, Streptococcus pneumoniae, Brucella, rat parvovirus KRV, Staphylococcus aureus nucleic acid were extracted respectively for detection. Using the above sample nucleic acid as a template, the fluorescent PCR reaction system was configured according to Example 1, and fluorescent PCR amplification was performed. The above strains (except Staphylococcus aureus) are all preserved in this laboratory, and the Staphylococcus aureus strains are all derived from the clinical sample separation and purification in this laboratory.

[0094] Result judgment:

[0095] The experimental results are shown in Table 5 and Figure 4-6 As shown, the positive controls of the three primer / probe combinations had Ct values ​​and corresponding fluorescence amplification curves, while the negative controls had no Ct values ​​and no fluorescence amplification curves, indicating that this experiment was successful.

[0096] Through the sensitivity verification of Example 2 and the specificity verification of Example 3, the best primer / probe combinations were finally screened out according to sensitivity and amplification efficiency, namely SA-FA (SEQ ID NO.1), SA-RA (SEQ ID NO.2) and SA-PA (SEQ ID NO.3).

[0097] Table 5

[0098]

[0099] Example 4

[0100] This example uses the detection method constructed in Example 1 and the best primer / probe combinations screened in Example 2 and Example 3, which are SA-FA, SA-RA and SA-PA, respectively, to detect Staphylococcus aureus in 10 actual clinical samples stored in this laboratory, including 3 rat feces, 3 mouse feces, 3 guinea pig feces and 1 hamster feces. Among them, the positive control of Staphylococcus aureus strains was obtained by separation and purification of clinical samples in this laboratory. The detection process is as follows:

[0101] (1) Sample collection: selected from organ tissue, cecal contents or feces, blood, swabs or cell culture;

[0102] (2) Extracting the genome of the sample to be tested: Take 200uL of the above-treated sample for extraction. The genome extraction uses a kit (FastPure Blood / Cell / Tissue / Bacteria DNA Isolation MiniKit from Novizan, Cat: DC 112-02; Lot: 7E0580L3). Perform the extraction operation according to the instructions in the kit, and take an appropriate amount of the final product sample genome as the subsequent template;

[0103] (3) Prepare a fluorescent PCR reaction system, which includes 10 μL of 2×AceQ qPCR Probe Master Mix; 0.8 μL of each of the forward and reverse upstream and downstream primers (10 μmol / L); 1 μL of TaqMan probe (10 μmol / L); 2 μL of DNA template; and add water to 20 μL.

[0104] The primer and probe sequences are as follows:

[0105] The sequences of the primers are:

[0106] SA-FA: 5'-GCAGTCAATTGCACAGGTGG-3' (SEQ ID NO: 1);

[0107] SA-RA: 5'-ATAGTGACGTTTGTAGCCGCC-3' (SEQ ID NO: 2);

[0108] The sequence of the probe is:

[0109] SA-PA: 5'-CCAGTGGCTCAAATTGCAGA-3' (SEQ ID NO: 3);

[0110] Both ends of the probe sequence are labeled with a reporter fluorescent group and a quencher fluorescent group, respectively. The reporter fluorescent group modified at the 5' end of the probe is selected from FAM, VIC, ROX, HEX or CY5, etc.; the quencher fluorescent group modified at the 3' end of the probe is selected from BHQ1, BHQ2 or BHQ3, etc.

[0111] The positive control is Staphylococcus aureus nucleic acid, and the positive control sequence is as follows:

[0112] CATAGTGAATTGCAGTCAATTGCACAGGTGGCCACACATTACAGTATTCCCATCATAACTATATCTAGTACAGCTAATAATCCAGT

[0113] GGCTCAAATTGCAGACTATGCATTGATTTATGGCAGAACTGATGAAAATGAAATGCGTATGGCGGCTACAACGTCACTATTTGCAC AGTTATTCACGG (SEQ ID NO: 10).

[0114] (4) Amplification reaction procedure: 1. Decontamination: 37°C, 2 min; 2. Pre-denaturation: 95°C, 5 min; 3. Denaturation: 95°C, 15 s; 4. Annealing and extension: 60°C, 45 s, 40 cycles, single-point fluorescence detection at 60°C.

[0115] (5) Interpretation of results

[0116] The experimental results are as follows Figure 7 As shown in the figure, the positive control of the primer / probe combination has a Ct value and a corresponding fluorescence amplification curve, while the negative control has no Ct value and no fluorescence amplification curve, indicating that this experiment is successful. None of the 10 clinical samples tested had a Ct value and no fluorescence amplification curve, and no Staphylococcus aureus was detected.

[0117] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A method for detecting Staphylococcus aureus by real-time fluorescence PCR, characterized in that: The following steps are involved: (1) Sample collection: Samples include organ tissue, cecal contents or feces, blood, swabs, and cell cultures; (2) Extracting the genome of the sample to be tested: Extracting the collected sample and taking a certain amount of the final product sample genome as a subsequent template; (3) Real-time fluorescence PCR detection: using the genome of step (2) as a template, preparing a reaction system using primers and probes, and setting an amplification reaction program to perform real-time fluorescence PCR detection; (4) Result interpretation: Determine whether the sample is infected with Staphylococcus aureus based on the real-time fluorescence PCR test results; Among them, the sample volume collected in step (2) is 200uL.

2. The method for detecting Staphylococcus aureus by real-time fluorescence PCR according to claim 1, characterized in that: The sequences of the primers and probes are as follows: The sequences of the primers are: SA-FA: 5'-GCAGTCAATTGCACAGGTGG-3', or a complementary sequence thereof; SA-RA: 5'-ATAGTGACGTTGTAGCCGCC-3', or a complementary sequence thereof; The sequence of the probe is: SA-PA: 5'-CCAGTGGCTCAAATTGCAGA-3', or a complementary sequence thereof; Both ends of the probe sequence are labeled with a reporter fluorescent group and a quencher fluorescent group respectively.

3. The method for detecting Staphylococcus aureus by real-time fluorescence PCR according to claim 2, characterized in that: The reporter fluorescent group at the 5' end of the probe is selected from FAM, VIC, ROX, HEX or CY5; the quencher fluorescent group at the 3' end of the probe is selected from BHQ1, BHQ2 or BHQ3.

4. The method for detecting Staphylococcus aureus by real-time fluorescence PCR according to claim 1, characterized in that: Staphylococcus aureus nucleic acid was used as the positive control, and the positive control sequence was as follows: CATAGTGAATTGCAGTCAATTGCACAGGTGGCCACACATTACAGTATTCCCATCATAACTATATCTAGTACAGCTAATAATCCAGT GGCTCAAATTGCAGACTATGCATTGATTTATGGCAGAACTGATGAAAATGAAATGCGTATGGCGGGCTACAACGTCACTATTTGCAC AGTTATTCACGG.

5. The method for detecting Staphylococcus aureus by real-time fluorescence PCR according to claim 1, characterized in that: The reaction system includes 10 μL of 2×AceQ qPCR Probe Master Mix; 0.8 μL of each of the forward, reverse, upstream and downstream primers; 1 μL of TaqMan probe; 2 μL of DNA template; and water is added to 20 μL.

6. The method for detecting Staphylococcus aureus by real-time fluorescence PCR according to claim 1, characterized in that: The sample genome in step (2) is nucleic acid.

7. The method for detecting Staphylococcus aureus by real-time fluorescence PCR according to claim 1, characterized in that: The amplification reaction procedure includes: 1) removing contamination at 37°C for 2 minutes; 2) pre-denaturation at 95°C for 5 minutes; 3) denaturation at 95°C for 15 seconds; 4) annealing at 60°C, extending for 45 seconds, cycling 40 times, and performing single-point fluorescence detection at 60°C.

8. The method for detecting Staphylococcus aureus by real-time fluorescence PCR according to claim 7, characterized in that: The annealing comprises: lowering the temperature of the reaction mixture to 40-60° C., hybridizing the oligonucleotide primer with the single-stranded template, and forming a DNA template-primer complex.

9. The method for detecting Staphylococcus aureus by real-time fluorescence PCR according to claim 7, characterized in that: The extension includes: the DNA template-primer complex, under the action of Taq DNA polymerase, uses the target sequence as a template and synthesizes a new chain complementary to the template DNA chain according to the principles of base pairing and semi-conservative replication.

10. An application of the method for detecting Staphylococcus aureus by real-time fluorescence PCR according to any one of claims 1 to 9, characterized in that: The application is to perform experimental tests on humans, pets and rodents, wherein the pets include dogs, cats and rabbits, and the rodents include mice, rats, hamsters and guinea pigs.

Images