SSR molecular marker for resisting empoasca flavescens of tea trees and application of SSR molecular marker

Abstract

The invention relates to the technical field of molecular markers, and discloses an anti-empoasca flavescens SSR molecular marker for a tea tree and application of the anti-empoasca flavescens SSR molecular marker, and the SSR molecular marker primer amplifies simple repetitive sequences of genes including one or more of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6. The invention finds that the expression quantity of 6 CsTIFY genes is obviously increased in the response process of resisting empoasca flavescens, further SSR site retrieval is performed on the 6 CsTIFY genes, 132 primers are designed, five SSR bands with obvious polymorphism and clear bands are screened through capillary electrophoresis, and by combining with tea empoasca flavescens resistance phenotypes of 24 tea tree germplasm resources, the expression quantity of the CsTIFY genes is obviously increased, and the expression quantity of the CsTIFY genes in the response process of resisting empoasca flavescens is obviously increased. It is found that the typing success rate of the SSR molecular marker is from 58.3% (CsTIFY2-7) to 83.3% (CsTIFY4-33), and a theoretical basis can be provided for early identification and molecular genetic breeding of tea tree resistance to empoasca flavescens.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, and in particular to an SSR molecular marker for tea tree resistance to green leafhoppers and an application thereof. Background Art

[0002] As one of the most important economic crops in the world, tea (Camellia sinensis) is threatened by a variety of pests. Among them, the tea green leafhopper has attracted much attention due to its high degree of damage to the new shoots and tender leaves of tea trees. The rapid reproduction and strong selective attack ability of the tea green leafhopper seriously threaten the growth and yield of tea.

[0003] TIFY transcription factors have extensive and important functions in plant growth and development. Studies have shown that TIFY family members affect plant stress resistance and hormone response mechanisms by regulating the jasmonic acid (JA) signaling pathway. According to the types of domains it contains, the TIFY family can be divided into four subfamilies: TIFY, ZML (ZIM&ZIM-like), JAZ (jasmonate-ZIM-domain) and PPD (PEAPOD). In recent years, the role of the TIFY transcription factor family in plant insect resistance has attracted widespread attention. The JAZ proteins of the TIFY family are key inhibitors in the JA signaling pathway and can regulate the JA signal transduction pathway to enhance the plant's insect resistance response. In alfalfa (Medicago sativa L.), the expression of MsTIFY14 in thrips-resistant and susceptible alfalfa varieties was significantly upregulated 14 days after thrips infection.

[0004] Simple sequence repeats (SSRs) are a type of repetitive sequences in the genome, with the characteristics of 1 to 6 nucleotide units, such as (CA)n, (AT)n, (GGC)n, etc. Due to their abundant quantity, good polymorphism, low cost and simple operation, SSR molecular markers have been widely used in the construction of plant genetic maps, genetic diversity analysis, gene positioning and cloning. Summary of the invention

[0005] In order to solve the above existing problems, the present invention discloses an SSR molecular marker for tea tree resistance to green leafhopper and its application. The present invention found that the expression of 6 CsTIFY genes was significantly upregulated during the response process of resistance to green leafhopper, further searched for SSR sites of 6 CsTIFY genes and designed 132 primers, screened 5 SSR bands with obvious polymorphism and clear bands by capillary electrophoresis, combined with the tea green leafhopper resistance phenotype of 24 tea germplasm resources, found that the typing success rate of SSR molecular markers ranged from 58.3% (CsTIFY2-7) to 83.3% (CsTIFY4-33), which can provide a theoretical basis for the early identification of tea tree resistance to green leafhopper and molecular genetic breeding.

[0006] On the one hand, the present invention provides an SSR molecular marker primer for tea trees to resist green leafhoppers, wherein the SSR molecular marker primer amplifies a simple repeat sequence of one or more genes including CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

[0007] The CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6 are all TIFY family member genes, among which the gene number of CsTIFY1 is GWHGACFB004081), the gene number of CsTIFY2 is GWHGACFB028923, the gene number of CsTIFY3 is GWHGACFB013026, the gene number of CsTIFY4 is GWHGACFB021202, the gene number of CsTIFY5 is GWHGACFB022136, and the gene number of CsTIFY6 is GWHGACFB005241. The above genes can be queried from the tea tree genome database http: / / tpia.teaplants.cn / according to the corresponding gene number.

[0008] The present invention re-annotates the tea tree anti-emerald leafhopper transcriptome data (PRJNA553681) published online to the 'Longjing 43' genome, uses the DESeq2 software package to perform differentially expressed gene screening analysis (q value <0.005&|log2(Foldchange)>1|), obtains a total of 3795 differentially expressed genes (DEGs), and then performs KEGG pathway enrichment analysis to screen out key anti-emerald leafhopper genes. It is found that 6 tea tree TIFY family member genes CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6 are significantly up-regulated, indicating that the CsTIFYs genes have the same expression change trend in the anti-emerald leafhopper response process, and it is speculated that the CsTIFY family members regulate the tea tree's anti-emerald leafhopper mechanism through JA signaling. Subsequent experiments conducted SSR site retrieval and primer design for CsTIFY family members, and verified that primers for amplifying CsTIFY family member genes can be used as SSR molecular marker primers for tea trees' resistance to green leafhoppers, and to type whether tea trees are resistant to green leafhoppers.

[0009] Therefore, based on the role of the six tea tree TIFY family member genes discovered by the present invention in the tea tree's resistance to green leafhoppers pathway, SSR molecular marker primers can be designed for the six tea tree TIFY family member genes. The present invention searched for SSR sites in the six tea tree TIFY family member genes, and retrieved 15 mononucleotide repeat units, 8 dinucleotide repeat units, and 2 trinucleotide repeat units based on different repeated nucleotide units, and it does not exclude that the genes also include other SSR sites. It can be understood that different primers can be designed for different SSR sites in the six tea tree TIFY family member genes, and different primers can also be designed for the same SSR site. The only difference between different primers is their efficacy level in typing whether the tea tree is resistant to green leafhoppers. Therefore, as long as the SSR molecular marker primers are designed for one or more genes of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6, they all fall within the protection scope of the present invention.

[0010] Preferably, the SSR molecular marker primers include one or more of CsTIFY2-7 primers, CsIFY2-11 primers, CsTIFY3-6 primers, CsTIFY3-15 primers and CsTIFY4-33 primers;

[0011] The forward primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.1, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.2;

[0012] The forward primer of the CsTIFY2-11 primer has a nucleotide sequence as shown in Seq ID NO.3, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.4;

[0013] The forward primer of the CsTIFY3-6 primer has a nucleotide sequence as shown in Seq ID NO.5, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.6;

[0014] The forward primer of the CsTIFY3-15 primer has a nucleotide sequence as shown in Seq ID NO.7, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.8;

[0015] The forward primer of the CsTIFY4-33 primer has a nucleotide sequence as shown in Seq ID NO.9, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.10.

[0016] The names of the above-mentioned CsTIFY2-7 primer, CsIFY2-11 primer, CsTIFY3-6 primer, CsTIFY3-15 primer and CsTIFY4-33 primer are only used for naming and have no other meanings. Their core characteristics lie in their nucleotide sequences.

[0017] The present invention first designs a total of 132 SSR primers, including 15 primers for CsTIFY1 gene, 13 primers for CsTIFY2 gene, 47 primers for CsTIFY3 gene, 40 primers for CsTIFY4 gene, 15 primers for CsTIFY5 gene, and 2 primers for CsTIFY6 gene; 9 primers with clear amplification bands and good polymorphism were screened out by agarose electrophoresis, and the above-mentioned CsTIFY2-7 primers, CsIFY2-11 primers, CsTIFY3-6 primers, CsTIFY3-15 primers and CsTIFY4-33 primers were further screened out by capillary electrophoresis. The above-mentioned primers have clear amplification conditions and good polymorphism, and are therefore used as the preferred embodiment of the present invention.

[0018] Using the above-mentioned CsTIFY2-7 primers, CsIFY2-11 primers, CsTIFY3-6 primers, CsTIFY3-15 primers and CsTIFY4-33 primers to amplify the total DNA of tea trees, SSR molecular marker sequences of different fragment sizes can be obtained, and then the tea tree resistance to green leafhopper phenotypes are typed according to the combination of fragment sizes. 24 tea tree germplasm resources were successfully divided into two categories: strong resistance to green leafhopper and weak resistance to green leafhopper. Cross-comparison found that the accuracy was relatively high, especially the typing accuracy of CsTIFY4-33 primers was 83.3%.

[0019] It is worth noting that the above-mentioned typing adopts the clustering method, and its accuracy is correlated with the sample abundance of the target germplasm resources for typing. The tea germplasm resources selected in the present invention lack samples with severe damage or above of the green leafhopper, so the accuracy of some primers is not very high. It is understandable that when the sample abundance of the cluster analysis increases, the accuracy of this part of the primers will increase significantly, and it is not ruled out that higher accuracy can be obtained by adopting other analysis methods other than cluster analysis. At the same time, the accuracy rate does not affect the application of the above primers in the early identification of tea tree resistance to green leafhoppers and / or the breeding of tea trees resistant to green leafhoppers. For any SSR molecular marker primers designed for one or more genes among CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6, the key to their application lies in the role of the six tea tree TIFY family member genes discovered by the present invention in the tea tree resistance to green leafhopper pathway. For the five preferred SSR molecular marker primers of the present invention, their clear amplification bands and good polymorphism are the key to the good application of the above preferred primers.

[0020] On the other hand, the present invention provides an SSR molecular marker for tea tree resistance to green leafhoppers, wherein the SSR molecular marker includes a simple repeat sequence of one or more genes among CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

[0021] On the other hand, the present invention provides a method for preparing an SSR molecular marker for tea tree resistance to green leafhoppers, wherein the total DNA of the tea tree is amplified using primers to obtain a simple repeat sequence; the primers are the SSR molecular marker primers for tea tree resistance to green leafhoppers.

[0022] On the other hand, the present invention provides the use of the SSR molecular marker primers for tea tree resistance to green leafhopper in early identification of tea tree resistance to green leafhopper and / or breeding of tea tree resistance to green leafhopper.

[0023] On the other hand, the present invention provides the application of the SSR molecular marker primers for tea tree resistance to green leafhoppers in the identification of plant germplasm resources of tea trees, the study of genetic diversity, the construction of genetic maps, the identification of seed purity, the kinship and evolution or genetic breeding of populations.

[0024] On the other hand, the present invention provides the use of the SSR molecular marker for tea tree resistance to green leafhopper in early identification of tea tree resistance to green leafhopper and / or breeding of tea tree resistance to green leafhopper.

[0025] On the other hand, the present invention provides the application of the SSR molecular marker for tea tree resistance to green leafhopper in the identification of plant germplasm resources of tea trees, the study of genetic diversity, the construction of genetic maps, the identification of seed purity, the kinship and evolution or genetic breeding of populations.

[0026] On the other hand, the present invention provides an application of a tea tree TIFY family member gene in early identification of tea tree resistance to green leafhoppers and / or breeding of tea trees resistant to green leafhoppers, wherein the tea tree TIFY family member gene includes one or more of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

[0027] On the other hand, the present invention provides a use of a tea tree TIFY family member gene for preparing an SSR molecular marker for tea tree resistance to green leafhoppers and / or an SSR molecular marker primer for tea tree resistance to green leafhoppers, wherein the tea tree TIFY family member gene includes one or more of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

[0028] In view of the lack of research on molecular markers related to tea tree resistance to green leafhoppers, the research and development team of the present invention obtained SSR molecular markers and primers for tea tree resistance to green leafhoppers through gene screening, primer design screening and verification. The research method, SSR molecular markers and primers of the present invention can be widely used in tea variety identification, genetic structure and resource diversity analysis, genetic map construction, functional gene positioning and QTL positioning, seed purity identification, molecular marker-assisted breeding research, which is convenient for further research on tea tree resistance to green leafhopper genes and tea tree genetic polymorphism, and promotes the in-depth development of tea resources.

[0029] In summary, the present invention has the following beneficial technical effects: the present invention discovered that the expression levels of 6 CsTIFY genes were significantly upregulated during the response to the green leafhopper, further performed SSR site retrieval on the 6 CsTIFY genes and designed 132 primers, screened 5 SSR bands with obvious polymorphism and clear bands by capillary electrophoresis, and combined with the tea green leafhopper resistance phenotypes of 24 tea germplasm resources, it was found that the typing success rate of SSR molecular markers ranged from 58.3% (CsTIFY2-7) to 83.3% (CsTIFY4-33), which can provide a theoretical basis for the early identification of tea resistance to the green leafhopper and molecular genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : Heat map of differentially expressed genes in tea trees infected by insect pests; CK, control; MD, mechanical damage; LD, insect pest infection;

[0031] Figure 2 :Differential gene pathway analysis diagram;

[0032] Figure 3 : Gene expression levels of 6 tea tree TIFY family members;

[0033] Figure 4 :Agarose electrophoresis detection bands of DNA extracted from 24 tea germplasm resources;

[0034] Figure 5 : Capillary electrophoresis of SSR-PCR using primers CsTIFY2-7;

[0035] Figure 6 :SSR-PCR capillary electrophoresis of primer CsTIFY2-11;

[0036] Figure 7 : Capillary electrophoresis of SSR-PCR using primers CsTIFY3-6;

[0037] Figure 8 :SSR-PCR capillary electrophoresis of primer CsTIFY3-15;

[0038] Fig. 9 :SSR-PCR capillary electrophoresis of primer CsTIFY4-33;

[0039] Fig.10 : Genetic relationship cluster diagram of tea germplasm resources constructed by genotyping 24 tea germplasm resources using 5 polymorphic SSR molecular markers. DETAILED DESCRIPTION

[0040] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The materials, reagents, etc. used in the following examples are reagents and materials that can be obtained from commercial sources unless otherwise specified. The basic experimental methods involved in the following examples are experimental methods in existing textbooks or literature unless otherwise specified, and routine adjustments in the experimental methods do not affect the experimental results.

[0041] Example 1: Screening of tea tree genes for resistance to green leafhoppers

[0042] In this example, the tea tree green leafhopper resistance transcriptome data (PRJNA553681) published online was re-annotated to the 'Longjing 43' genome, and the DESeq2 software package was used for differentially expressed gene screening analysis (q value <0.005 & |log2(Foldchange)>1|), and a total of 3795 differentially expressed genes (DEGs) were obtained, as shown in Figure 2. Figure 1As shown, CK, control; MD, mechanical damage; LD, insect pest infection. It was found that the differentially expressed genes were mainly enriched in pathways such as "sugar metabolism", "environmental information processing", "plant hormone signal transduction" and "phenylpropanoid biosynthesis", such as Figure 2 shown.

[0043] Kobas software was used to perform KEGG pathway enrichment analysis of differentially expressed genes, and indicators such as enrichment factors were generated to judge the significance of enrichment in order to screen out key genes for resistance to green leafhoppers. From the above genes, it was found that six tea tree TIFY family member genes CsTIFY1 (GWHGACFB004081), CsTIFY2 (GWHGACFB028923), CsTIFY3 (GWHGACFB013026), CsTIFY4 (GWHGACFB021202), CsTIFY5 (GWHGACFB022136), and CsTIFY6 (GWHGACFB005241) were significantly upregulated (the gene numbers in brackets of the above genes can be queried from the tea tree genome database http: / / tpia.teaplants.cn / ), such as Figure 3 As shown, it indicates that the CsTIFYs genes have the same expression change trend in the response process against the green leafhopper. It is speculated that the CsTIFY family members regulate the tea tree's resistance to the green leafhopper through JA signaling.

[0044] Example 2: Design and screening of primers for CsTIFYs gene SSR molecular markers

[0045] The CTAB method was used to extract DNA from 24 tea germplasm resources (Yujinxiang, 5-81, Fuding Dabaicha, Jingbai No. 2, Longjing 43, Jiaming No. 1, Yuehuang No. 1, Zhenong 404, Zhenong 410, Zhenong 417, Zhongcha 108, Zhonghuang No. 3, Jinguanyin, Zijuan, Baiye No. 1, Zhenong 418, 1-35, Huangjinya, Shubei, Zhenong 408, Zhenong 415, Zhenong 428, Zhenongbai, Ziya) collected. The agarose electrophoresis detection bands were clear and without dispersion. Figure 4 As shown; the OD260 / OD280 values ​​were all around 1.8, indicating that the extracted DNA was of relatively high quality and good purity, and could be used for subsequent SSR marker analysis.

[0046] The SSRminer plug-in in the TBtools software was used to search for SSR sites in the CsTIFYs gene, and the conditions were: single bases were repeated more than 10 times, double bases were repeated more than 6 times, and three bases, four bases, five bases and six bases were repeated more than 5 times. The Batch Target Region Primer Design plug-in in the TBtools software was used to batch design SSR primers, which were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The SSR sites of the six tea tree JA signaling pathway key genes CsTIFYs obtained in Example 1 were statistically analyzed. There were three types of repeat units, including 15 mononucleotide repeat units, 8 dinucleotide repeat units, and 2 trinucleotide repeat units, as shown in Table 1. A total of 132 SSR primers were designed, including 15 primers for CsTIFY1 gene, 13 primers for CsTIFY2 gene, 47 primers for CsTIFY3 gene, 40 primers for CsTIFY4 gene, 15 primers for CsTIFY5 gene, and 2 primers for CsTIFY6 gene.

[0047] Table 1: Nucleotide repeat units and numbers of six CsTIFY gene SSR markers

[0048]

[0049]

[0050] Eight tea germplasm resources with different resistance to green leafhoppers ('Zhe Nong 418', 'Zi Juan', 'Zhong Cha

[0051] DNA was used as a template, and 132 primers were used for PCR reaction. Nine primers with clear amplification bands and good polymorphism were selected. Then, capillary electrophoresis (high-resolution electrophoresis) was used for secondary screening. Finally, five candidate SSR primers were obtained, including two for CsTIFY2 gene, two for CsTIFY3 gene, and one for CsTIFY4 gene, as shown in Table 2.

[0052] Table 2: 5 polymorphic SSR primer sequences

[0053]

[0054] The capillary electrophoresis of SSR-PCR with primer CsTIFY2-7 is shown in Figure 5 The capillary electrophoresis of SSR-PCR with primer CsTIFY2-11 is shown in Figure 6 The capillary electrophoresis of SSR-PCR with primers CsTIFY3-6 is shown in Figure 7As shown in the capillary electrophoresis diagram of SSR-PCR with primer CsTIFY3-15, Figure 8 The capillary electrophoresis of SSR-PCR with primer CsTIFY4-33 is shown in Fig. 9 shown.

[0055] Example 3: Cluster analysis of tea germplasm resources

[0056] The tea germplasm resources selected for the experiment were planted in the tea garden experimental base of Zhejiang Academy of Agricultural Sciences and the Panban Tea Experimental Base of Zhejiang University. The DNA extraction of the leaves of the experimental materials was carried out using the CTAB method. The damage degree of tea germplasm resources was investigated during the peak period of the green leafhopper, and the classification standards were as follows:

[0057] Level 0: no damage or slight damage: buds and leaves are normal or temporarily wilted.

[0058] Level 1: Obvious damage: The base of the main vein of the 2-3 leaves below the bud turns red or appears permanently wilted.

[0059] Level 3: More serious damage: The main veins of the 2-3 leaves below the bud turn red, the buds and leaves shrink and wrinkle, and the tips of the buds and leaves begin to dry up.

[0060] Level 5: Severe damage: Buds and leaves appear visibly burnt, with the burnt surface not exceeding 1 / 4.

[0061] Level 7: Extremely serious damage: Buds and leaves shrink and dry up, more than 1 / 4 of the leaves are burnt, and the buds and leaves droop.

[0062] The phenotypes of damage to tea green leafhoppers in the field are shown in Table 3.

[0063] Table 3: Phenotypes of damage to tea green leafhoppers in the field

[0064]

[0065] Capillary electrophoresis was used to perform genotyping on 24 tea germplasm resources using five polymorphic SSR molecular markers. The banding patterns of the amplified products were counted, with bands recorded as 1 and no bands as 0, to construct a 0 / 1 matrix. Popgen32 software was used to construct a genetic relationship cluster diagram of tea germplasm resources, as shown in Figure 2. Fig.10 shown.

[0066] The results showed that all 24 tea tree materials could be divided into two groups, namely, strong resistance to green leafhopper (damage degree 0) and weak resistance to green leafhopper (damage degrees 1 and 3). The classification was based on the combination of different fragment sizes and typing was performed by clustering method. Combined with the damage phenotype of tea green leafhopper in the field, the typing success rates of the five SSR molecular markers were 58.3% (CsTIFY2-7), 70.8% (CsTIFY2-11), 66.7% (CsTIFY3-6), 58.3% (CsTIFY3-15) and 83.3% (CsTIFY4-33), respectively. The relatively small number of "damage degree 3" samples may be one of the reasons for the low accuracy of some molecular markers.

[0067] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto, and any equivalent modifications or substitutions that can be easily thought of by any technician familiar with the technical field within the technical scope disclosed by the present invention should be included in the protection scope of the present invention.

[0068] Sequence Listing

[0069] Seq ID NO.1

[0070] CCTATTACTCAGCACCCATAC

[0071] Seq ID NO.2

[0072] ACCTCTACACATGCCTTCAC

[0073] Seq ID NO.3

[0074] CTATTATCACACCCATACA

[0075] Seq ID NO.4

[0076] TCTTACATGGTATCAGAGCTA

[0077] Seq ID NO.5

[0078] GCGATAAGCCTTACCCTATT

[0079] Seq ID NO.6

[0080] CGAACTCGACATAGTTTCCA

[0081] Seq ID NO.7

[0082] GCCATATATTCCTCGTGCT

[0083] Seq ID NO.8

[0084] GTTTCCAGCAAACAAACTCAA

[0085] Seq ID NO.9

[0086] AACGGAGGTCAGTTTAATGT

[0087] Seq ID NO.10

[0088] GATTGGTAGATCTGCACCC。

Claims

1. A tea tree anti-green leafhopper SSR molecular marker primer, characterized in that: The SSR molecular marker primers amplify simple repeat sequences of one or more genes including CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

2. The SSR molecular marker primer for tea tree resistance to green leafhopper as claimed in claim 1, characterized in that: The SSR molecular marker primers include one or more of CsTIFY2-7 primers, CsTIFY2-11 primers, CsTIFY3-6 primers, CsTIFY3-15 primers and CsTIFY4-33 primers; The forward primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.1, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.2; The forward primer of the CsTIFY2-11 primer has a nucleotide sequence as shown in Seq ID NO.3, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.4; The forward primer of the CsTIFY3-6 primer has a nucleotide sequence as shown in Seq ID NO.5, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.6; The forward primer of the CsTIFY3-15 primer has a nucleotide sequence as shown in Seq ID NO.7, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.8; The forward primer of the CsTIFY4-33 primer has a nucleotide sequence as shown in Seq ID NO.9, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.

10.

3. A SSR molecular marker for tea tree resistance to green leafhopper, characterized in that: The SSR molecular marker includes a simple repeat sequence of one or more genes among CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

4. A method for preparing a tea tree SSR molecular marker for resistance to green leafhoppers, characterized in that: The total DNA of the tea tree is amplified by using primers to obtain a simple repeat sequence; the primers are the SSR molecular marker primers for tea trees against green leafhoppers as claimed in claim 1 or 2.

5. Use of the SSR molecular marker primers for tea tree resistance to green leafhopper as described in claim 1 or 2 in early identification of tea tree resistance to green leafhopper and / or tea tree resistance to green leafhopper breeding.

6. Application of the SSR molecular marker primers for tea tree resistance to green leafhopper as described in claim 1 or 2 in the identification of plant germplasm resources of tea tree, research on genetic diversity, construction of genetic map, seed purity identification, population relationship and evolution or genetic breeding.

7. Use of the SSR molecular marker for tea tree resistance to green leafhopper as claimed in claim 3 in early identification of tea tree resistance to green leafhopper and / or tea tree resistance to green leafhopper breeding.

8. Application of the SSR molecular marker for tea tree resistance to green leafhopper as claimed in claim 3 in the identification of plant germplasm resources of tea tree, research on genetic diversity, construction of genetic map, seed purity identification, population relationship and evolution or genetic breeding.

9. An application of a tea plant TIFY family member gene in early identification of tea plant resistance to green leafhoppers and / or tea plant resistance to green leafhoppers breeding, characterized in that: The tea tree TIFY family member genes include one or more of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

10. A use of a tea plant TIFY family member gene for preparing an SSR molecular marker for tea plant resistance to green leafhoppers and / or an SSR molecular marker primer for tea plant resistance to green leafhoppers, characterized in that: The tea tree TIFY family member genes include one or more of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

Images