SNP molecular marker for identifying flower stage of chrysanthemum and application thereof
By conducting genome-wide association analysis on chrysanthemum populations, it was found that the 374th base site of the CiSAM gene is associated with flowering period. Using Hitom sequencing technology to detect SNP molecular markers in the seedling stage, the problems of high cost and strong environmental dependence in existing technologies for flowering period identification were solved, achieving efficient, rapid and low-cost flowering period identification and improving the efficiency of breeding and cultivation management.
Patent Information
- Application Number
- CN202510076828.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-17
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-01-17
AI Technical Summary
Existing methods for identifying the flowering period of chrysanthemums rely on phenotypic observation, which is costly, labor-intensive, and susceptible to environmental influences. They also lack accurate identification methods for seedlings or early stages, making it difficult to meet the demands of modern agriculture for speed, accuracy, and non-destructive methods.
Genome-wide association analysis of chrysanthemum populations revealed that the 374th base site of the CiSAM gene is associated with flowering period. Hitom sequencing technology was used to detect SNP molecular markers in the seedling stage, providing kits and primers for identifying chrysanthemum flowering period and enabling early identification.
It enables efficient, rapid, low-cost, and environmentally minimally disturbed flowering period identification during the seedling stage, improving the efficiency of breeding and cultivation management, reducing production costs, and providing stable technical support for variety identification.
Smart Images

Figure CN119842955B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of SNP molecular marker technology, specifically relating to an SNP molecular marker for identifying early-flowering chrysanthemum varieties and its application. Background Technology
[0002] Chrysanthemum (Chrysanthemum morifolium Ramat.) belongs to the Asteraceae family and originated in China. It is one of China's ten traditional famous flowers and one of the world's four major cut flowers. It has high ornamental and economic value, and is widely popular due to its extremely beautiful and brightly colored flowers, making it one of the commercially developed flowering crops. In many countries, including the United States and Japan, it is considered a top crop, mainly cultivated for cut flowers and loose blooms for making wreaths, general decorations, hair ornaments, etc.
[0003] Flowering time is a crucial trait affecting chrysanthemum production and quality, and its timing directly determines the chrysanthemum's growth cycle, market supply, and economic benefits. To achieve precise control and identification of flowering time, traditional phenotypic observation methods are increasingly unable to meet the demands of modern agriculture for speed, accuracy, and non-destructive methods. Traditional methods primarily rely on observing flowering time, which typically requires a long growth cycle and is easily affected by environmental and cultivation management factors. Furthermore, phenotypic observation requires significant manual labor, resulting in high costs.
[0004] With advancements in genomics, molecular marker technology has been increasingly applied to plant breeding and flowering time identification. Genome-wide association studies (GWAS) of large-scale genetic resources can identify gene loci associated with important traits, making it possible to detect molecular markers for flowering time. However, most existing molecular markers are concentrated on a few single traits or a small number of gene regions, and related studies are mostly limited to single varieties or small populations, lacking adaptation studies to broad populations and environmental conditions. More importantly, existing methods often lack markers that can accurately identify flowering time in the seedling or early stages, which is crucial for shortening breeding cycles and improving efficiency. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide an SNP molecular marker for identifying the flowering period of chrysanthemums and its application.
[0006] This invention, through extensive population and flowering trait GWAS analysis, identified a candidate gene (CM05G691010) with a non-synonymous substitution (T→G) at nucleotide 374 (exon 3), resulting in a mutation from methionine to arginine. Sequencing confirmed a significant correlation between this site and the flowering time of chrysanthemums. Protein sequence alignment revealed homology with AT1G15760 (Sterile Alpha Motif (SAM) motif-containing gene) in Arabidopsis thaliana, hence the name CiSAM. Specifically, the T allele at this site is closely associated with the early flowering phenotype, while the G allele is significantly associated with the late flowering phenotype. Currently, several studies have confirmed the important role of SAM in regulating plant flowering time. SAM encodes an important transcription factor in plants, playing a crucial role in flowering time and floral organ development; its mutants often lead to altered flowering time. Therefore, locating SAM mutation sites associated with flowering time and developing corresponding molecular marker tools will help rapidly identify flowering characteristics.
[0007] This invention also proposes a method based on Hitom sequencing technology, using CiSAM site 374 as a molecular marker to achieve rapid identification of flowering time at the seedling stage. This method has the advantages of high efficiency, speed, low cost, and minimal environmental interference, effectively overcoming the shortcomings of existing technologies, and is particularly suitable for large-scale breeding and cultivation management.
[0008] Specifically, the SNP molecular marker provided by this invention for identifying the flowering period of chrysanthemums is located at position 320969022 on chromosome 5, with the site name LG05:320969022; it is located at position 374 of the CiSAM gene; the nucleotide sequence of the CiSAM gene is shown in SEQ ID No. 1; the two nucleotide bases at this site are T or G, and this SNP molecular marker has T / G polymorphism, which leads to changes in the flowering time of chrysanthemums. The traits of different genotypes at this site are as follows: TT: early flowering trait; TG: late flowering trait; GG: late flowering trait.
[0009] The CiSAM genome fragment is shown in SEQ ID No. 1:
[0010] CCCGAGCCACCTTGTTTATTCATAACCAATCTATTACTTCTCTTCACCATTGCACCTTTCCATCTAGAGCTATAAGTCCTTCTTTTTCACCATGATAATAGCCGAATCATTGCGATGAACCCATGTTTGTACATATTTAGCTACTTTTTTCTTGGTTTTCTTCATAGCATTTATTAGT TTAGTAATGGGGCGTGAACGAGTTGAGCTTTTAGCGAGTTTTAGTATCTCTAGCCTGTGTTTAGCTATAGAGATTCCCATGCTTTGGAGAAACTCATGGTTGAAGTACGAAATGTCGTCTTCTTCGAGTAGATTTAGGGTGAATGATTGTGAGTATTCGTGTATGGAAGGTGGTTCA
[0011] The chrysanthemum reference genome used in this invention is the diploid wild chrysanthemum WT genome from China Agricultural University.
[0012] This invention also provides a kit for identifying early-flowering chrysanthemum varieties, containing primers for amplifying the SNP molecular markers. Specifically, the primer sequences are shown in SEQ ID No. 2 and SEQ ID No. 3.
[0013]
[0014] This invention also provides the application of the SNP molecular markers and amplification primers provided above in chrysanthemum breeding.
[0015] The method for detecting chrysanthemum flowering period using the aforementioned SNP molecular markers includes the following steps:
[0016] (1) Genomic DNA was extracted from the chrysanthemum leaves to be tested;
[0017] (2) Using genomic DNA as a template, the target sequence in the genomic DNA of the sample to be tested is amplified by PCR;
[0018] (3) The amplified samples were detected using a fluorescence detection platform, and the flowering time of chrysanthemums was determined based on the polymorphism of SNP molecular markers reflected by the obtained fluorescence signals.
[0019] (4) When the SNP molecular marker genotype is TT, it is an early flowering trait; when the SNP molecular marker genotype is TG or GG, it is a late flowering trait.
[0020] The composition of the PCR reaction system and the PCR reaction procedure for PCR amplification of the above SNP molecular markers are as follows:
[0021] The concentration ratio of the upstream primer to the downstream primer in each pair of the primer set is 1:1 in the system; the final concentration of both the upstream primer and the downstream primer in the system is preferably 0.1-1.5 μmol / L.
[0022] The system also includes:
[0023] dNTPs: The final concentration in the system is 0.1-0.25 mmol / L for each, preferably 0.2 mmol / L;
[0024] Magnesium chloride: The final concentration in the system is 1.0-4.0 mmol / L, preferably 2 mmol / L;
[0025] DNA polymerase: The final concentration in the system is 0.04 U / μL.
[0026] PCR buffer: prepared by mixing potassium chloride (final concentration 10-50 mmol / L) and Tris-HCl (pH 7.5-9.0) (final concentration 1-10 mmol / L).
[0027] This invention utilizes the reference genome of *Chrysanthemum indicum* (WT) and extensive resequencing data to identify a SNP locus significantly associated with the flowering period of *Chrysanthemum indicum*: LG05:320969022. Genome-wide association analysis revealed a significant association between this locus and the flowering period of *Chrysanthemum indicum* populations. The discovery of this innovative finding required the collection of *Chrysanthemum indicum* ecotypes from various regions of my country. The collected seeds were planted at the Shangzhuang Experimental Station of China Agricultural University, and flowering times were recorded for two consecutive years. Genomic DNA was extracted for whole-genome sequencing and resequencing.
[0028] This invention differs from other related existing technologies in the following ways: First, no large-scale resequencing studies have been published on wild chrysanthemum. Previously, the identification of chrysanthemum flowering time could only be done manually after flowering, requiring high costs and a large workforce. Second, this invention involves significant labor investment, including seedling cultivation and extraction of genomic DNA from 161 wild chrysanthemum ecotypes for resequencing. This data, combined with the wild chrysanthemum WT reference genome, was used for big data analysis, involving extensive data mining and computation. This is fundamentally different from existing technologies that rely on markers from other literature or free databases. Finally, the method of this invention was validated using PCR amplification and sequencing in early-flowering and late-flowering wild chrysanthemum ecotypes. Furthermore, PCR amplification and sequencing were performed on five early-flowering cultivated chrysanthemum varieties and five late-flowering cultivated chrysanthemum varieties. The results conformed to the distribution of SNP genotypes in early and late flowering varieties, ensuring sufficient identification capability of molecular markers.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] (1) When identifying varieties using this invention, DNA extracted directly from seedlings can be used for testing, unlike traditional methods that require waiting for flower bud transformation or flower opening before identification can be performed, thus shortening the identification time from several months to a few days.
[0031] (2) Compared with phenotypic identification methods, the DNA detection-based identification method of the present invention is not affected by the external environment and will not change due to changes in environmental conditions, and its results are stable and reliable.
[0032] (3) Compared with traditional methods for identifying flower bud transformation, the operation of this invention does not require a long period of experience accumulation.
[0033] (4) By detecting the LG05:320969022 locus of wild chrysanthemum, this invention can identify the flowering period of chrysanthemum seedlings in the early stage, effectively clarifying whether the individual belongs to the early-flowering type / late-flowering type; by identifying different varieties according to market demand during the seedling stage of chrysanthemum, different flowering period varieties can be selected, which is conducive to improving the screening efficiency and breeding efficiency of chrysanthemum flowering period and reducing production costs; it can also be used for variety identification, effectively protecting the rights and interests of producers and breeders, and providing strong technical support for the protection of chrysanthemum germplasm resources and new varieties. Attached Figure Description
[0034] Figure 1 GWAS analysis results of flowering period traits of wild chrysanthemum ecotypes in different regions.
[0035] Figure 2. Verification diagram of wild chrysanthemum flowering period. Note: A. Number of samples with different genotypes in the population; B. Expression level of CiSAM gene in leaves / terminal buds of early / late flowering plants; C. PCR electrophoresis diagram of CiSAM gene fragment in wild chrysanthemum population; D. PCR electrophoresis diagram of CiSAM gene fragment in cultivated chrysanthemum. Detailed Implementation
[0036] Example 1 This example provides the process for obtaining SNP molecular markers according to the present invention.
[0037] 1. First, the resequencing results of 161 wild chrysanthemum materials were compared with the diploid wild chrysanthemum WT reference genome sequence from China Agricultural University, resulting in 8,090,751 high-quality SNP loci after filtering. Genome-wide association analysis (GWAS) was performed using the wild chrysanthemum planting-flowering days as the phenotype, locating a flowering-significantly associated SNP locus, LG05:320969022, located on exon CM05G691010 of chromosome 5 of the wild chrysanthemum genome. After alignment with Arabidopsis protein sequences, it was annotated as a gene containing the sterile α motif (SAM) motif, and therefore named CiSAM. This gene has been relatively little studied in plants, but published papers have shown that it can influence flowering by shaping the binding of the LEAFY transcription factor. It is speculated that the CiSAM gene may be a candidate gene controlling chrysanthemum flowering. Figure 1 ).
[0038] According to haplotype analysis, among the 161 wild chrysanthemum materials, the earliest flowering time was observed when the LG05:320969022 locus was TT, while the flowering time was significantly later than that of the TT locus when the locus was TG or GG. Furthermore, the flowering time was latest when the locus was homozygous (GG). Figure 2 A).
[0039] To further determine the role of CiSAM in regulating chrysanthemum flowering time, transcriptome analysis of early and late flowering plants revealed that CiSAM was highly expressed in the leaves of the early-flowering ecotype, significantly higher than in the late-flowering ecotype; and significantly higher than in the terminal buds (regardless of whether it was early or late flowering). Figure 2 B).
[0040] To determine the reliability of the SNP sites, we performed PCR amplification of the CiSAM genome fragment (sequence 1) of early-flowering wild chrysanthemums: WT, BJ_03J_6_C, SD_01L_2_A, SX_02S_1_B, SX_01J_1_A and late-flowering wild chrysanthemums: SC_02C_1_B, HB_05E_3_A, GD_02Y_1_A, GX_03G_1_C, CQ_01Y_1_B, and sequenced the PCR products. Figure 2C) Sequencing results were consistent with resequencing results, accurately identifying wild chrysanthemum species with different flowering times (Table 1). To apply SNP locus identification to a wider range of varieties, CiSAM genome fragments were amplified by PCR and sequenced in 5 early-flowering cultivars and 5 late-flowering cultivars. Sequencing results showed that in the cultivars, the T genotype accounted for a higher proportion in early-flowering varieties, while the G genotype accounted for nearly 100% in late-flowering varieties (Table 2).
[0041] Table 1. Percentage of CiSAM fragment genotypes in the wild chrysanthemum population (%)
[0042]
[0043] Table 2. Percentage of CiSAM fragment genotypes in cultivated chrysanthemums (%)
[0044]
[0045] 2. The above 161 wild chrysanthemum accessions were all sourced from the germplasm bank of China Agricultural University, and their germplasm bank numbers are as follows: NMG_01_1_A, LN_2L_A, LN_02L_B, BJ_06J_3_C, BJ_06J_3_A, BJ_07J_1_B, BJ_06J_3_B, BJ_06J_02_A, BJ_06J_2_C, BJ_06J_2_B, BJ_06J_1_B, BJ_06J_1_C, BJ_06J_1_A, BJ_01J_3_C, BJ_01J_2_A, BJ_01J_3_B, BJ_01J_1_C, BJ_02J_1_A, BJ_02J_2_C, BJ_02J_2 _B, HB_02J_A, HB_02J_C, HB_02J_B, BJ_02J_3_A, BJ_05J_1_C, BJ_05J_1_B ,BJ_05J_2_A,BJ_03J_1_B,BJ_04J_1_A,BJ_03J_7_C,BJ_03J_7_B,BJ_03J _5_C, BJ_03J_6_C, BJ_03J_5_B, SD_06L_12_A, SD_06L_11_B, SD_06L_12_B ,SD_06L_12_C,SD_06L_8_A,SD_06L_9_A,SD_06L_10_A,SD_06L_8_C,SD_06 L_9_B, SD_06L_8_B, SD_06L_10_C, SD_06L_5_A, SD_06L_7_B, SD_06L_6_A, SD_06L_6_C, SD_06L_5_C, SD_06L_4_A, SD_06L_7_A, SD_06L_5_B, SD_06L_ 4_B, SD_06L_2_A, SD_06L_2_C, SD_06L_2_B, SD_06L_1_A, SX_01J_4_B, SX_ 01J_4_A, SX_01J_4_C, SX_01J_1_A, SX_01J_2_C, SX_01J_2_A, SD_09L_2_A, SD_09L_2_C, SD_01L_2_A, SD_01L_3, SD_01L_1, SD_02L_1_B, SD_02L_1_A, SD_02L_1_C, SD_02L_2_C, SD_05L_2_A, SD_05L_2_B, SD_05L_2_C, SD_03L_ 1_B, SD_03L_1_A, SD_07L_2_A, SD_07L_1_A, SD_07L_2_C, SD_02L_3_B, SD_ 04L_1_B, SD_04L_1_A, SD_04L_2_B, SD_04L_2_C, JS_01S_3_B, SX_02S_1_B,SX_02S_1_A, SX_02S_1_C, HN_02Y_A, SH_02H_1_C, SH_02H_1_A, SH_02H_1_B, SC_08C_2_A, SC_08C_2_B, SC_08C_3_C, S C_08C_3_B, SC_10C_3_A, SC_10C_3_C, SC_10C_1_A, SC_10C_2_A, SC_10C_3_B, SC_02C_1_A, SC_02C_3_C, SC_02C_2_A, S C_02C_2_B, SC_02C_3_A, SC_02C_1_B, SC_02C_3_B, HB_05E_3_A, HB_05E_2_C, HB_05E_2_A, HB_05E_2_B, SC_07C_2_B, S C_04C_2_B, ZJ_01Z_5_C, SC_03C_1_C, SC_03C_1_B, SC_03C_1_A, SC_04C_3_B, SC_04C_2_C, SC_04C_2_A, SC_04C_1_A, S C_04C_1_B, SC_04C_1_C, SC_04C_3_A, SC_01C_1_A, CQ_01Y_1_B, SC_05C_2_B, SC_05C_2_C, SC_05C_4_B, SC_05C_2_A, S C_05C_3_A, SC_05C_4_A, SC_07C_3_A, SC_07C_3_B, SC_07C_2_A, SC_07C_1_B, SC_07C_1_A, SC_07C_1_C, SC_07C_3_C, S C_06C_2_B, SC_06C_3_A, GZ_01Q_1_C, GZ_01Q_1_A, GZ_01Q_1_B, YN_02D_1_B, YN_02D_1_A, GD_02Y_1_B, GD_02Y_1_A, G D_01Y_1_B, GX_01G_1_C, GX_02G_1, GX_02G_5, GX_02G_3, GX_03G_1_C, GX_02G_2, GX_03G_1_A, GX_03G_1_B, GX_02G_4. ,
[0046] Example 2: Detection of the effectiveness of the SNP molecular markers of the present invention
[0047] 1. Obtaining genomic DNA
[0048] Genomic DNA of the tested varieties was extracted from seedling leaves using the CTAB method.
[0049] The specific operating method is as follows: When the seedlings of the above-mentioned male parent, female parent, and tested varieties (offspring) have grown 4-5 true leaves, take a leaf tissue of about 1 square centimeter as a sample, place it in a 2 mL centrifuge tube, add a steel ball with a diameter of 4 mm, add 250 μL of EDTA solvent, and grind at 1200 r / min for 30 s; then add 500 μL of EDTA solvent, mix by inverting, and place in a 65℃ oven for lysis for more than 1 hour; after the solution cools to room temperature, add an equal volume of chloroform (chloroform is mixed with anhydrous ethanol at a ratio of 24:1), centrifuge at 12000 r / min for 10 min; take 600 μL of the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of anhydrous ethanol, invert, and let stand at -20℃ for more than 1 hour; after taking it out from -20℃, centrifuge at 12000 r / min for 10 min, discard the solution, and add 700 μL of EDTA solvent. Centrifuge at 12000 rpm for 10 min with 75% ethanol; discard the solution (supernatant), and after the solution evaporates, add 100 μL of ultrapure water to fully dissolve it, thus completing the extraction.
[0050] The quality and concentration of genomic DNA must meet the requirements of PCR. The standards are as follows: the A260 / A280 ratio detected by Nanodrop2000 (Thermo) UV spectrophotometer should be around 1.8, and the A260 / A230 ratio should be greater than 1.8; the concentration of genomic DNA of the tested variety should be 30-50 ng / μL.
[0051] 2. Using the genomic DNA of the tested varieties and their paternal and maternal parents as templates, PCR amplification was performed to obtain PCR amplification products. The upstream primer was the primer shown in sequence 2 of the sequence listing, and the downstream primer was the primer shown in sequence 3 of the sequence listing.
[0052] The PCR reaction system, totaling 25 μL, includes:
[0053] Template DNA (50 ng): 1 μL
[0054] A mixture of upstream and downstream primers (concentration ratio 1:1, total 10 μmol / L): 2.0 μL.
[0055] dNTPs (2.5 mg / L each): 2.0 μL
[0056] Ex Taq (5 U / μL): 0.2 μL
[0057] 10×Ex Taq Buffer (Mg 2+ plus (20 mmol / L): 2.5 μL,
[0058] ddH2O: 17.3 μL.
[0059] 3. Detection of PCR amplification products
[0060] The PCR amplification products were examined by agarose gel electrophoresis to detect the presence of bands. The products were then subjected to next-generation sequencing. Based on the sequencing results, it was determined whether the wild chrysanthemum being tested was an early / late flowering variety.
[0061] 3.1 Preparation of agarose gel
[0062] Take 20 mL of 50×TAE buffer and add water to 1000 mL to prepare a 1×TAE dilution buffer. Prepare a 1% agarose gel solution by weighing 1 g of agarose and pouring it into a 200 mL Erlenmeyer flask. Add 100 mL of 1×TAE dilution buffer and heat in a microwave until the agarose is completely melted. Add 5 μL of nucleic acid dye to the agarose gel solution cooled to 60±5℃, shake thoroughly, and slowly pour into the gel tank. After 20 minutes, vertically and slowly remove the comb and place the gel plate into the electrophoresis tank. Add electrophoresis buffer (1×TAE) to the electrophoresis tank, ensuring the liquid level is approximately 1 mm above the gel surface.
[0063] 3.2 Agarose gel electrophoresis.
[0064] Use a pipette to draw 5 μL of PCR product into each well of the gel. Connect the leads, turn on the electrophoresis apparatus, and set the voltage to 130 V, the current to 300 mA, and the time to 15 min. After electrophoresis, place the gel plate in a gel imaging analyzer to observe the results. The PCR products are then sent to the company for sequencing.
[0065] 4. Test results.
[0066] Based on the sequencing results, if the 91st base of the R-direction sequence of the amplified band of an unknown variety is T, then the variety is an early-flowering variety. If the 91st base of the R-direction sequence of an unknown variety is G, then the variety is a late-flowering variety.
[0067] Of course, the above description is not intended to limit the present invention, and the present invention is not limited to the examples given above. Any changes, modifications, additions or substitutions made by those skilled in the art within the scope of the present invention should be protected by the present invention.
Claims
1. A SNP molecular marker for identifying the flowering period of chrysanthemum, characterized in that, The SNP molecular marker is located at position 320969022 of chromosome 5, and the site name is LG05:320969022; the sequence of the SNP molecular marker is shown as SEQ ID No. 1, the 374th site of the shown molecular marker has T / G polymorphism, which causes the change of flowering time of chrysanthemum, and the traits of different genotypes of the site are as follows: TT: early flowering trait; TG: late flowering trait; GG: late flowering trait.
2. A kit for identifying the flowering stage of chrysanthemum, characterized by, The primer for amplifying the SNP molecular marker of claim 1; the primer sequences are shown as SEQ ID No. 2 and SEQ ID No.
3.
3. The SNP molecular marker of claim 1 is applied in chrysanthemum breeding.
4. The method for detecting the flowering time of chrysanthemum by using the SNP molecular marker according to claim 1, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of the sample to be tested from the leaves of chrysanthemum; (2) using the genomic DNA as a template, performing PCR amplification on the target sequence in the genomic DNA of the sample to be tested; the amplification primer sequences are shown as SEQ ID No. 2 and SEQ ID No. 3; (3) detecting the amplified sample by using a fluorescence detection platform, and judging the flowering time of chrysanthemum according to the SNP molecular marker polymorphism reflected by the obtained fluorescence signal; (4) when the genotype of the SNP molecular marker is TT, it is an early flowering trait; when the genotype of the SNP molecular marker is TG or GG, it is a late flowering trait.
Citation Information
Patent Citations
Method for efficiently predicting florescence of chrysanthemum based on whole genome selection
CN116564407A
Application of FNSII-1 gene in variety identification / breeding of high-linarin chrysanthemum
CN117230085A