Molecular identity card-based amanita gray pattern detection method, detection primer and application
By using specific primers in real-time fluorescence PCR detection, the problem of DNA degradation in gray pattern amanita detection is solved, and fast, accurate and low-cost detection is achieved, with high sensitivity and applicability.
Patent Information
- Application Number
- CN202510097517.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2025-04-18
AI Technical Summary
The prior art is difficult to detect gray-pattern Amanita quickly, accurately and at low cost, especially after the samples provided by poisoned patients are digested by gastric juice, DNA degradation is severe, resulting in difficulty in detection.
The detection method based on SYBR Green I real-time fluorescence PCR was used to amplify the DNA of gray-patterned Amanita using specially designed upstream and downstream primers to achieve rapid and accurate detection.
The specific detection of gray-patterned Amanita is achieved, with the minimum detection limit of DNA content of 10-5ng, which can be accurately detected after the sample is boiled and digested with gastric juice, and has good applicability.
Smart Images
Figure CN119842957A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of molecular biology, and in particular to a method for detecting Amanita gracilis based on a molecular identity card, a detection primer and an application thereof. Background Art
[0002] Gray-striped Amanita (Amanitafuliginea) contains amatoxin, which can cause acute liver damage. It is similar in appearance to the Altissima, which is widely eaten by people in Guizhou. However, Altissima has slender rhizomes, while Amanita has a mushroom ring and stipe. Since people do not like to dig roots when eating mushrooms, poisoning incidents occur frequently. When poisoning by poisonous mushrooms occurs, the poisoned person often does not know which poisonous mushroom he has eaten, and is very likely to be unable to provide uncooked samples, which greatly increases the difficulty of subsequent identification and treatment. In order to provide symptomatic treatment, it is necessary to accurately detect the type of poisonous mushroom. Medical staff can only conduct detection through post-meal leftovers provided by the poisoned person and the vomit of the patient.
[0003] At present, the recognition and identification of Amanita phalloides is mainly based on morphological characteristics and DNA molecular sequences, which requires professional taxonomic knowledge and molecular biological identification conditions, and is time-consuming, which is not conducive to the timely diagnosis and treatment of poisoned patients by primary medical units. In addition, since the test objects in vomitus are digested by gastric juice, their DNA has undergone varying degrees of degradation, and the existing detection methods for Amanita phalloides are difficult to accurately detect them. Therefore, it is urgent to develop a fast, accurate, and low-cost detection technology to provide important technical support for the treatment of patients poisoned by poisonous mushrooms and poisoning incidents. Summary of the invention
[0004] The purpose of the present invention is to provide a method for detecting Amanita gracilis based on molecular identification, detection primers and applications to solve the problems existing in the above-mentioned prior art. The present invention realizes the specific detection of Amanita gracilis based on SYBR Green I real-time fluorescence PCR, and the minimum detection limit of DNA content of Amanita gracilis is 10 -5 ng, has good applicability.
[0005] To achieve the above object, the present invention provides the following solutions:
[0006] The present invention provides a primer set for detecting Amanita gracilis. The primer set consists of an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.
[0007] The present invention also provides application of the primer set in preparing a reagent for detecting Amanita gracilis.
[0008] The present invention also provides a reagent for detecting Amanita gracilis, comprising the primer set.
[0009] The present invention also provides a kit for detecting Amanita gracilis, comprising the primer set or the reagent.
[0010] The present invention also provides application of the primer set, the reagent or the kit in detecting Amanita gracilis.
[0011] The present invention also provides a method for detecting Amanita gracilis, comprising the following steps:
[0012] Extracting DNA from samples to be tested;
[0013] Using the sample DNA to be tested as a template, the primer set is used to perform real-time fluorescent PCR amplification;
[0014] If a fluorescent signal and an obvious amplification curve appear, the sample to be tested contains the gray-spotted Amanita phalloides; if no fluorescent signal or obvious amplification curve appears, the sample to be tested does not contain the gray-spotted Amanita phalloides.
[0015] Optionally, the reaction system for real-time fluorescence PCR amplification is 5 μL of SYBR Green qPCR Mix, 0.5 μL of each of 10 μmol / L upstream and downstream primers, 1 μL of template DNA, and 3 μL of RNase-Free Water.
[0016] Optionally, the reaction conditions of the real-time fluorescence PCR amplification are 95°C for 2 min, 95°C for 15 s, 60°C for 30 s, and 40 cycles.
[0017] The present invention discloses the following technical effects:
[0018] The present invention performs multiple sequence alignment on the ITS sequence of Amanita grisea and the sequences of the same species and different species of the same genus on Genbank, and screens out a 23bp short sequence on the ITS sequence of Amanita grisea as the molecular ID of Amanita grisea. Based on the molecular ID information, a pair of primers suitable for SYBR Green I real-time fluorescence PCR detection is designed, which can realize the specific detection of Amanita grisea based on SYBR Green I real-time fluorescence PCR, and the minimum detection limit of DNA content of Amanita grisea is 10 -5 ng.
[0019] The detection method of the present invention can at least detect the gray-spotted Amanita phalloides boiled in water at 100° C. for 30 minutes and digested by artificial gastric juice for 4 hours and the mixture of gray-spotted Amanita phalloides and shiitake mushrooms in a ratio of 1:99, and has good applicability. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0021] Figure 1 This is the specific detection result of RT-PCR of Amanita gracilis;
[0022] Figure 2 This is the result of RT-PCR sensitivity test of Amanita gracilis;
[0023] Figure 3 These are the results of RT-PCR applicability testing for Amanita gracilis. DETAILED DESCRIPTION
[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0025] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0026] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0027] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.
[0028] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0029] Example
[0030] 1. Materials and methods
[0031] 1.1 Specimen collection and identification
[0032] The specimens used in this embodiment come from the collection of the herbarium and the field collection, and are stored in the FUNGARIUM OF JILINAGRICULTURALUNIVERSITY (FJAU) in the form of dry specimens. All specimens have been identified by morphology and ITS sequence comparison. Specimen related information is shown in Table 1. The reagents and manufacturers used in this embodiment are shown in Table 2.
[0033] Table 1 Specimen information
[0034]
[0035]
[0036] Table 2 Reagent concentrations, dosages and manufacturers used in the RT-PCR reaction system
[0037]
[0038] 1.2 Extraction of genomic DNA
[0039] In this example, genomic DNA was extracted from the target species specimens that had been accurately identified by morphology. The method used was a modified alkaline lysis method (alkaline lysis solution ratio: 0.5 mol / L NaOH solution, 1% mass concentration of Triton X-100, 1% mass concentration of PVP40). The DNA concentration was detected using a NanoDrop 2000 ultra-micro spectrophotometer, and the OD was calculated. 260 / OD 280 If the ratio is close to 1.8, it indicates that the purity of the extract is good, and the qualified DNA sample is placed in a 4°C refrigerator for later use, or in a -20°C refrigerator for later use.
[0040] 1.3 PCR amplification and sequencing
[0041] ITS fragments were used for amplification and sequencing. The PCR amplification reaction system was a 25 μL system: 12.5 μL Taq PCR MasterMix (2X, blue dye), 1 μL each of 10 μM forward and reverse primers, 1 μL DNA template (10 ng / μL), and finally ddH2O was used to make up to 25 μL. Then amplification was performed in a PCR instrument (Bio-Rad T100). The ITS amplification primers were ITS1 (CTTGGTCATTTAGAGGAAGTAA, SEQ ID NO.4) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO.5), and the amplification program was 94°C pre-denaturation for 3 min, 30 cycles: 94°C denaturation for 30 s, 55°C annealing for 45 s, and 72°C extension for 1 min; after the cycle was completed, the final extension was performed at 72°C for 10 min, and then stored at 4°C. The amplified product was detected by 1% agarose gel electrophoresis, and the PCR product with clear and bright electrophoresis bands was sent for sequencing. The sequencing primers were the same as the PCR amplification primers (sequencing was completed by Shanghai Sangon Biotechnology Co., Ltd.).
[0042] 1.4 Data Analysis
[0043] Sequencher (v5.4.5) software was used to perform sequence splicing and manual proofreading on the sequencing files sent back by the sequencing company to remove overlapping peak fragments in the forward and reverse primer intervals and low-quality fragments at both ends. At the same time, the reverse complementarity principle of forward and reverse sequences was used to solve a poly structure caused by the repetition of a single base to ensure the successful splicing of high-quality fragments.
[0044] 1.5 Molecular ID mining and primer design
[0045] Aliview software was used to perform multiple sequence alignment of the successfully spliced ITS sequence of Amanita grisea and 148 sequences of the same species and different species of the same genus downloaded from Genbank to find the specific sequence interval of the Amanita grisea species sequence, and the selected target sequence was analyzed using blastn in the BLAST tool of the NCBI website. After a large amount of sequence data analysis, a 23bp short sequence of Amanita grisea (5'-CAGGGCTTGTATAGCTTTGCTCT-3', SEQ ID NO.1) was screened out and defined as the molecular ID card of Amanita grisea. Based on the molecular ID card of Amanita grisea, the molecular ID card was used as one of the primers, and primers were designed using primer 5.0 software. The primers were synthesized by Shanghai Shenggong Biological Co., Ltd. (Table 3).
[0046] Table 3 Primer information
[0047]
[0048] 1.6 Specificity evaluation
[0049] The specimens shown in Table 1 were selected as test materials for detecting the specificity of the real-time fluorescence PCR method for Amanita gracilis. The target species material (No. 1), 18 poisonous and non-toxic mushroom materials of the same genus and other genera (No. 2-19) and a no template blank control (NTC) with ddH2O added were tested by real-time fluorescence PCR under the same conditions (95℃2min, 95℃15s, 60℃30s, 40 cycles) according to the reaction system in Table 2. The number of cycles was used as the horizontal axis and the increase in the fluorescence signal of the amplification curve (ΔRn) was used as the vertical axis. If the amplification curve shows an obvious amplification curve, it means that it is positive, indicating that the target species has been detected; if there is no amplification curve, it means that it is negative, and no target species has been detected.
[0050] 1.7 Sensitivity evaluation
[0051] In order to detect the sensitivity of the real-time fluorescence PCR method for Amanita phalloides, as shown in Table 4, the initial concentration of DNA (1 ng / μL) was used as a template for 10-fold gradient dilution using DNA diluent (SangonBiotech). In a 10 μL reaction system (Table 2), the DNA contents were 1 ng, 10 -1 ng, 10 -2 ng, 10 -3 ng, 10 -4 ng, 10 -5 ng and 10 -6 ng, and a no-template blank control (NTC) with an equal amount of ddH2O added were used for real-time fluorescence PCR detection under the same conditions (95℃2min, 95℃15s, 60℃30s, 40 cycles). The number of cycles was used as the horizontal axis, and the increase in the fluorescence signal of the amplification curve (ΔRn) was used as the vertical axis. If the amplification curve shows an obvious amplification curve, it is positive, indicating that the sample at this concentration has been detected; if there is no amplification curve, it is negative, indicating that the sample at this concentration cannot be detected.
[0052] Table 4. Template DNA processing for sensitivity experiments
[0053]
[0054] 1.8 Applicability Evaluation
[0055] The samples were processed in a simulated on-site environment, boiled in 100°C water and digested with gastric juice for different periods of time to simulate post-meal leftovers and vomitus.
[0056] In order to detect the applicability of the real-time fluorescence PCR method for Amanita gracilis, as shown in Table 5, the samples were boiled at 100°C in groups, cooled to room temperature, and then artificial gastric juice (USP, sterile) was added to simulate digestion in groups and kept warm in a constant temperature water bath at 37°C. Template DNA was then extracted according to the method of "1.2 Extraction of genomic DNA" for real-time fluorescence PCR detection. Referring to the reaction system in Table 2, real-time fluorescence PCR detection was performed under the same conditions (95°C for 2 min, 95°C for 15 s, 60°C for 30 s, 40 cycles). The number of cycles was used as the horizontal axis, and the increase in the fluorescence signal of the amplification curve (ΔRn) was used as the vertical axis. If the amplification curve shows an obvious amplification curve, it means that it is positive, which means that the sample under the treatment condition is detected; if there is no amplification curve, it means that it is negative, which means that the sample under the treatment condition cannot be detected.
[0057] Table 5 Suitability test sample processing
[0058]
[0059] Note: 30+ represents 1% Target species + 99% Lentinula Edodes.
[0060] 2. Results and Analysis
[0061] 2.1 Specificity test results
[0062] Based on the molecular ID technology, specific primers for Amanita gracilis were designed, and the DNA of each sample was tested by real-time fluorescence PCR to verify the specificity of the method. Figure 1 As shown, only Amanita gracilis had a fluorescent signal and an obvious amplification curve, while the negative control and blank control had no signal and no amplification, indicating that this method has good specificity for Amanita gracilis.
[0063] 2.2 Sensitivity test results
[0064] The sensitivity of the method was verified by real-time fluorescence PCR detection of DNA samples of different concentrations using the designed specific primers. Figure 2 As shown, the DNA content is 10 -5 ng, all three replicates showed fluorescence signals and obvious amplification curves, indicating that the molecular detection limit of Amanita gracilis can reach 10 -5 ng. Although fluorescence signals and amplification curves appeared after the detection limit of DNA concentration, the repeatability of the amplification curve was poor, so it was not considered that DNA concentrations below the detection limit could be detected. Neither fluorescence signals nor amplification curves appeared in NTC.
[0065] 2.3 Applicability test results
[0066] The designed specific primers were used to perform real-time fluorescence PCR on samples that had been boiled and digested with artificial gastric juice, as well as a mixture of Amanita gracilis and Lentinula edodes at a ratio of 1:99, to verify the applicability of this method. Figure 3 As shown, treatments 1-7 all had fluorescence signals and obvious amplification curves, while NTC had no fluorescence signals and amplification curves. Real-time fluorescence PCR can detect Amanita phalloides boiled at 100℃ for 30 minutes and digested with artificial gastric juice for 4 hours, as well as a mixture of Amanita phalloides and Lentinus edodes at a ratio of 1:99, indicating that this method has good applicability to Amanita phalloides boiled and digested with gastric juice.
[0067] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.
Claims
1. A primer set for detecting Amanita phalloides, characterized in that: The primer set consists of an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.
3.
2. Use of the primer set as claimed in claim 1 in preparing a reagent or a kit for detecting Amanita gracilis.
3. A reagent for detecting Amanita phalloides, characterized in that: Comprising the primer set of claim 1.
4. A kit for detecting Amanita phalloides, characterized in that: Comprising the primer set according to claim 1 or the reagent according to claim 3.
5. Use of the primer set according to claim 1, the reagent according to claim 3 or the kit according to claim 4 in detecting Amanita gracilis.
6. A method for detecting Amanita phalloides, characterized in that: The following steps are involved: Extracting DNA from samples to be tested; Using the sample DNA to be tested as a template, the primer set according to claim 1 is used to perform real-time fluorescent PCR amplification; If a fluorescent signal and an obvious amplification curve appear, the sample to be tested contains the gray-spotted Amanita phalloides; if no fluorescent signal or obvious amplification curve appears, the sample to be tested does not contain the gray-spotted Amanita phalloides.
7. The method according to claim 6, characterized in that The reaction system of the real-time fluorescent PCR amplification was 5 μL of 2×SYBR Green qPCR Mix, 0.5 μL of each of 10 μmol / L upstream and downstream primers, 1 μL of template DNA, and 3 μL of RNase-Free Water.
8. The method according to claim 6, characterized in that The reaction conditions of the real-time fluorescence PCR amplification are 95° C. for 2 min, 95° C. for 15 s, 60° C. for 30 s, and 40 cycles.