Molecular marker significantly associated with wheat grain-filling rate qtl qgfr.yzu-1bl and application

Abstract

This invention discloses a method for measuring the grain filling rate (QTL) of wheat. QGFR.yzu‑1BL Significantly Associated Molecular Markers and Their Applications: Using the Yangmai 16 / Zhongmai 895 DH population and its 660K SNP high-density genetic map, a major-effect QTL for grain filling rate was located on the long arm of chromosome 1B. QGFR.yzu‑1BL SNP tag AX‑ 95630347 yes QGFR.yzu‑1BL A marker within the specified interval. This invention will... AX‑95630347 Converted to KASP tags AX‑ 95630347‑KASP The effectiveness and reliability of the KASP marker in assisting the identification of wheat grain filling rate were verified using a set of natural population materials. The KASP marker-specific primer set provided in this invention was used to target SNP markers. AX‑95630347 The genotype detection method has low human error, high throughput, and is suitable for detecting large numbers of samples. The KASP marker provided by this invention... AX‑ 110915909‑KASP QTL loci that can be used to measure wheat grain filling rate QGFR.yzu‑1BL The transfer of superior alleles is of great practical significance for accelerating genetic improvement using superior alleles at this QTL locus and improving breeding efficiency.

Description

Technical Field

[0001] This invention relates to the field of molecular genetic breeding technology, specifically to a method related to the QTL of wheat grain filling rate. QGFR.yzu-1BL Significantly related molecular markers and their applications. Background Technology

[0002] my country is the world's largest producer and consumer of wheat. Continuously increasing wheat production and striving for stable yields is of great significance to ensuring food security in my country and the world. Thousand-grain weight is one of the three factors affecting wheat yield, and its level is determined by the grain-filling process. Grain-filling rate (GFR) is a key factor influencing the grain-filling process and determining the final yield.

[0003] In wheat production, varieties with slow grain filling may experience insufficient grain filling and yield reduction due to adverse factors such as hot and dry winds or premature ripening caused by high temperatures in the later stages of growth. Large-grained varieties may suffer from low grain filler ratios (GFR), leading to incomplete grain filling and affecting yield and grain commercial value. With global warming and the increasing frequency of extreme weather events, wheat grain filling is likely to encounter more frequent adverse weather conditions, affecting the grain filling process and leading to yield reduction. Improving GFR is a crucial way to optimize the wheat grain filling process, thereby increasing yield and ultimately achieving high and stable yields. As an important yield trait, GFR is a complex quantitative trait controlled by multiple genes. Discovering major-effect QTLs regulating wheat GFR and developing reliable molecular markers are of great significance for the genetic improvement of wheat GFR and yield traits.

[0004] Previous studies have identified multiple QTL loci controlling grain filling rate-related traits. Yu et al. (2022) and Sun Xiaoxiao (2018) used a RIL population and a natural population to conduct linkage and association analyses on wheat grain traits such as grain filling rate (GFR) and grain weight, identifying multiple stable GFR-related QTLs. In both studies, they found that chromosome 4B contains two GFRs. mean QTL, chromosome 2B contains 1 GFR max QTLs. Lin et al. (2020) used three RIL populations and combined with a 90K SNP chip to discover two stable grain filling rate QTLs that significantly affected multiple yield traits. Hu et al. (2020) used a four-parent RIL population and combined with a 15K SNP chip to locate QTLs for GFR-related gene loci in materials such as Yangmai 16, and located five new QTLs related to grain filling rate, located at 3AL, 4DL(2), 6AL and 7AL respectively.

[0005] Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation among plant individuals and are ideal molecular markers for studying the genetics of complex plant traits. Currently, various methods exist for SNP genotyping, such as sequencing, solid-phase microarrays, and KASP marker methods. Among these, the solid-phase microarray method integrates a large number of SNP flanking sequences as probe sequences into a solid probe array, enabling the simultaneous determination of genotypes for a large number of SNP markers in a single experiment; however, its testing cost is relatively high. Currently, commonly used solid-phase SNP microarrays in wheat include 90K, 660K, and 55K microarrays. The 660K SNP microarray contains information on approximately 660,000 SNP markers. With the development of biotechnology, Kompetitive Allele-Specific PCR (KASP) technology, as a high-throughput, low-cost, and low-error-rate method for SNP genotyping, can achieve high-throughput detection of a single SNP marker in a single experiment and plays an important role in marker-assisted breeding applications in crops.

[0006] During wheat grain filling, dry matter accumulation exhibits a three-stage growth pattern of "slow-fast-slow," with an overall trend resembling an "S"-shaped curve, which can be fitted using the Logistic equation. Based on the characteristics of this three-stage grain filling curve, the entire process can be divided into three periods: a gradual increase period, a rapid increase period, and a slow increase period. The rapid increase period is characterized by the fastest rate of dry matter accumulation and an almost linear increase in grain dry weight. The grain filling rate (GFR2) during this rapid increase period is the primary cause of differences in grain weight among varieties. The grain filling rate reaches its maximum value during the rapid increase period, i.e., the maximum grain filling rate (GFR2). max It is highly positively correlated with GFR2.

[0007] Yangmai 16 and Zhongmai 895 were once the main winter wheat varieties in the middle and lower reaches of the Yangtze River and the southern part of the Huang-Huai winter wheat region in my country, respectively. Both varieties exhibited characteristics such as rapid grain filling rate and high yield. Discovering the superior genes regulating GFR carried by these two materials and developing related molecular markers is of great significance for molecular breeding of wheat yield. Summary of the Invention

[0008] To accelerate molecular breeding for increased wheat yield, this invention used the doubled haploid (DH) population of Yangmai 16 / Zhongmai 895 as material. High-density genetic mapping of QTLs related to wheat GFR was constructed using wheat 660K SNP chip genotyping data. A stable major-effect QTL regulating wheat GFR was located on the long arm of chromosome 1B and named [QTL name missing]. QGFR.yzu-1BL Its enhancing allele comes from Yangmai 16, with a QTL confidence interval of 128.5–129.5 cM, flanked by markers [missing information].AX-110534755 and AX-111590092 The allelic variations of the two markers correspond to the physical locations of bases 653939615 and 665050665 on the positive strand of chromosome 1B, respectively, in the Chinese Spring reference genome version V1.0. According to the Chinese Spring reference genome version V1.0, SNP markers... AX-95630347 It is distributed in QGFR.yzu-1BL A marker within the specified interval; the allelic variation of this SNP corresponds to base 658738539 on the positive strand of chromosome 1B.

[0009] Based on the above research, the present invention will QGFR.yzu-1BL SNP chip marking within the interval AX-95630347 It has been transformed into a KASP marker that enables high-throughput, low-cost, and low-error-rate genotyping. AX-95630347-KASP The effectiveness and reliability of the KASP marker-assisted identification of wheat grain filling rate were verified using a natural population of wheat materials from the Huang-Huai wheat region. This provides a basis for using QTL loci for grain filling rate in breeding. QGFR.yzu-1BL It provides reliable molecular tools.

[0010] The first aspect of this invention provides a method for measuring the grain filling rate (QTL) of wheat grains. QGFR.yzu-1BL Significantly associated molecular markers, named AX-95630347 It has a flanking sequence as shown in SEQ ID NO.1, wherein the polymorphism of the 36th base of the flanking sequence is A or C. The complementary sequence of this flanking sequence is shown in SEQ ID NO.2. According to the Chinese spring wheat reference genome version V1.0, SEQ ID NO.2 corresponds to the sequence of bases 658738504 to 658738574 on the positive strand of chromosome 1B, and the polymorphism of the 658738539th base is T or G, which is T in the Chinese spring genome sequence.

[0011] A second aspect of the present invention provides a KASP primer set for identifying the aforementioned molecular marker genotypes, comprising primer A, primer B, and primer C, wherein:

[0012] The primer A is either (a1) or (a2) as follows:

[0013] (a1) From the 5' end to the 3' end are fluorescent tag sequence A and single-stranded DNA as shown in positions 22–46 of SEQ ID NO.3;

[0014] (a2) From the 5' end to the 3' end, there is a fluorescent tag sequence A and DNA with one or more nucleotides substituted and / or deleted and / or added to positions 22–46 of SEQ ID NO.3 and having the same function;

[0015] Primer B is either (b1) or (b2) as follows:

[0016] (b1) From the 5' end to the 3' end are fluorescent tag sequence B and single-stranded DNA as shown in positions 22–46 of SEQ ID NO.4;

[0017] (b2) From the 5' end to the 3' end, there is a fluorescent tag sequence B and DNA with one or more nucleotides substituted and / or deleted and / or added to positions 22–46 of SEQ ID NO.4 and having the same function;

[0018] Primer C can be either (c1) or (c2):

[0019] (c1) Single-stranded DNA as shown in SEQ ID NO.5;

[0020] (c2) DNA that has undergone substitution and / or deletion and / or addition of one or more nucleotides of SEQ ID NO.5 and has the same function as SEQ ID NO.5.

[0021] Furthermore, the fluorescent tag sequence A is the fluorescent tag sequence FAM, and the fluorescent tag sequence B is the fluorescent tag sequence HEX.

[0022] above:

[0023] SEQ ID NO.1:

[0024] 5'-GATCGTCGTGGTGCACACCGCCGGTAACAAAGGGTATCTGATGCAGACCATCAAGGACACCTCACCGTGGG-3';

[0025] SEQ ID NO.2:

[0026] 5'-CCCACGGTGAGGTGTCCTTGATGGTCTGCATCAGATACCCTTTGTTACCGGCGGTGTGCACCACGACGATC-3;

[0027] SEQ ID NO.3:

[0028] 5'- GAAGGTGACCAAGTTCATGCT GTGTCCTTGATGGTCTGCATCAGAT-3';

[0029] SEQ ID NO.4:

[0030] 5'- GAAGGTCGGAGTCAACGGATT GTGTCCTTGATGGTCTGCATCAGAG-3';

[0031] SEQ ID NO.5:

[0032] 5'-GAGTGAGAACTCATTCGCTGCACTG-3'.

[0033] A third aspect of the present invention provides the application of the above-described primer set in any of the following:

[0034] 1) Detection or auxiliary detection of SNP markers in wheat samples AX-95630347 genotype;

[0035] 2) Preparation, detection, or auxiliary detection of wheat SNP markers to be tested AX-95630347 Products with the correct genotype;

[0036] 3) Preparation, detection, or auxiliary detection of the grain filling rate (QTL) of wheat to be tested QGFR.yzu-1BL Products with the correct genotype;

[0037] 4) Prepare, screen, or breed wheat single plants, lines, strains, or varieties with high grain filling rates;

[0038] 5) Assist in screening or breeding wheat individual plants, lines, strains, or varieties with high grain filling rate characteristics.

[0039] Preferably, in applications 2) to 4), the product is a PCR reagent or kit.

[0040] Furthermore, the product also includes fluorescent probe A, fluorescent probe B, quencher probe A, and quencher probe B. Fluorescent reporter group A is FAM, fluorescent reporter group B is HEX, and fluorescent quencher group is BHQ. Fluorescent probe A, fluorescent probe B, quencher probe A, and quencher probe B are contained in KASP 2×Master Mix, which is a product of LGC Ltd. (UK), catalog number KBS-1016-002 (suitable for 96-well or 384-well PCR plates).

[0041] The fourth aspect of this invention provides a method for detecting SNP markers in wheat. AX-95630347 The method for determining genotypes includes the following steps:

[0042] Using wheat genomic DNA as a template, PCR amplification was performed using the primer set described above. The amplified products were scanned for fluorescence signals, and the scan data were analyzed using Kluster Caller software. Based on the analysis results, SNP markers were determined according to the following method. AX-95630347Genotype: If the fluorescence signal data of the wheat amplification products to be tested cluster in the fluorescence signal coordinate system of the genotyping results, close to the X-axis and far from the origin, as analyzed by Kluster Caller software, then the wheat to be tested contains SNP markers. AX-95630347 The genotype is homozygous AA; if the fluorescence signal data of the wheat amplification products are clustered near the Y-axis and far from the origin in the coordinate system by Kluster Caller software analysis, then the SNP marker in the wheat is present. AX-95630347 The genotype is homozygous CC; if the fluorescence signal data of the wheat amplification products are clustered near the middle of the diagonal in the coordinate system by Kluster Caller software analysis, then the wheat contains SNP markers. ​ The genotype is heterozygous AC or CA.

[0043] The fifth aspect of this invention provides a method for assisting in the identification or comparison of the grain filling rate of wheat grains, comprising the following steps:

[0044] Using the genomic DNA of the wheat to be tested as a template, the above method was used to identify the wheat to be tested. ​ The genotype, if the wheat being tested contains ​ If the wheat has the AA genotype, the tested wheat has a relatively high grain-filling rate. ​ If the genotype is CC, the wheat being tested has a relatively low grain filling rate.

[0045] The sixth aspect of this invention provides a method for assisting in screening or breeding wheat individual plants, lines, strains, or varieties with high grain filling rates, comprising the following steps:

[0046] Selecting grain filling rate (QTL) in each generation of breeding. ​ SNP markers within the interval ​ The wheat material with genotype AA was selected and finally bred. ​ This refers to wheat plants, lines, strains, or varieties with the genotype AA. In practical applications, it can be used... ​ The genotype of wheat material is AA. ​ 95630347 Materials with genotypes AA, AC, or CC were hybridized, and the above-mentioned methods were used to detect SNP markers in wheat during the segregating generations. ​ The genotype method, selection ​ Individual plants, strains, varieties, or cultivars with genotypes of AA or AC, until a suitable variety is selected. ​ A single plant, strain, variety, or strain with the genotype AA.

[0047] The high grain filling rate described in this invention refers to the grain filling rate of the wheat sample that, when the effects of other gene loci on the genome of the compared wheat are equal, is higher than that of the homozygous wheat sample with base A at position 36 of SEQ ID NO. 1 on chromosome 1B in the genome than the homozygous wheat sample with base C at position C.

[0048] Through the above technical solution, the present invention achieves the following beneficial effects:

[0049] This invention utilizes the Yangmai 16 / Zhongmai 895 DH population and its 660K SNP high-density genetic map to locate a major-effect QTL for grain filling rate on the long arm of chromosome 1B. ​ SNP tag ​ yes ​ ​ A marker within the specified interval. This invention will... ​ Converted to KASP tags ​ The effectiveness and reliability of the KASP marker in assisting the identification of wheat grain filling rate were verified using a set of natural population materials. The KASP marker-specific primer set provided by this invention was used to... ​ SNP markers within the interval ​ The genotype detection method has low human error, high throughput, and is suitable for detecting large numbers of samples. The KASP marker provided by this invention... ​ QTL loci that can be used to measure wheat grain filling rate ​ The transfer of superior alleles is of great practical significance for accelerating genetic improvement using superior alleles at this QTL locus and improving breeding efficiency. Attached Figure Description

[0050] ​ It is an SNP marker ​ Flanking sequences and their homologous sequences multiple sequence alignment results and KASP markers ​ The diagram shows the location of the specific binding region of the primer sequence. The base sequences of sequence 2 (SEQ ID NO. 2), sequence 6 (SEQ ID NO. 6), sequence 7 (SEQ ID NO. 7), and sequence 8 (SEQ ID NO. 8) in the diagram are consistent with the corresponding sequences in the sequence listing.

[0051] ​ It is the development of KASP tags ​ Detection of wheat material typing results during primer screening;

[0052] ​ It uses KASP tags. ​ Test results of some wheat varieties in natural populations;

[0053] ​ It is a KASP tag ​ The results of the phenotypic T-test of grain filling rate (GFR) were obtained from two genotypes in 151 wheat varieties from natural populations under different environmental conditions. E1 and E2 were from the Yangzhou and Hai'an experimental sites in 2021–2022, respectively; E3 and E4 were from the Yangzhou and Suqian experimental sites in 2022–2023, respectively. BLUE represents the best linear unbiased estimate of the phenotypic value under the four environmental conditions. max GFR mean GFR2 represents the maximum grain filling rate, average grain filling rate, and grain filling rate during the rapid growth period, respectively; ** and *** represent the grain filling rates during the rapid growth period, respectively. P <0.01 and P The difference is significant under the condition <0.001, and ns indicates that the difference is not significant. Detailed Implementation

[0054] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0055] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0056] Unless otherwise specified, all test materials and reagents used in the following examples are commercially available.

[0057] The primers used were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0058] All wheat varieties used can be obtained from the National Wheat Improvement Center.

[0059] In the following quantitative experiments, the number of seeds and the weight of seeds were determined using the Wanshen SC-G automatic seed analysis and thousand-seed weight analyzer developed by Hangzhou Wanshen Testing Technology Co., Ltd.

[0060] In the quantitative experiments described below, three biological replicates were performed, and the results were averaged.

[0061] Example 1: Main-effect QTL of wheat grain filling rate ​ SNP tags ​ The acquisition of its KASP-labeled primer set

[0062] Test materials: Zhongmai 895 and Yangmai 16 are among the main winter wheat varieties promoted in the Huang-Huai wheat region and the middle and lower reaches of the Yangtze River, respectively, and both have excellent comprehensive agronomic traits. In this study, a DH population was constructed using Yangmai 16 as the female parent and Zhongmai 895 as the male parent, comprising 174 families.

[0063] Field trials: The DH population was planted at the Yangzhou and Hai'an experimental bases in Jiangsu Province in 2021–2022, and at the Yangzhou and Suqian experimental bases in Jiangsu Province in 2022–2023. All field trials employed a randomized block design with three replicates. Planting was done in small plots with four rows per plot, each 1.5 m long and spaced 25 cm (Yangzhou and Hai'an) or 20 cm apart (Suqian). Field management followed local experimental management methods.

[0064] The flowering period of all materials was meticulously recorded in the field. The specific flowering time was recorded when 50% of the panicles showed visible anthers, and at least 40 panicles with similar growth stages were marked for each family. Samples were collected on days 10, 15, 20, 25, 30, and 35 after flowering, and at maturity. Five marked panicles were randomly selected from each plot. The collected panicles were quickly blanched at 105℃ for 30 minutes, then dried at 80℃ for 20 hours until constant weight. Threshing was performed manually to avoid grain loss. The total grain weight, total number of grains, and thousand-grain weight of each sample were determined using a Wanshen SC-G fully automatic seed analyzer and a thousand-grain weight meter (Hangzhou Wanshen Testing Technology Co., Ltd.), following the instrument operating procedures. The thousand-grain weight and dry weight at different time points were fitted with Logistic filling curves using the Proc NLIN program in SAS 9.2 software. The filling parameters for each family were calculated based on the fitted Logistic curves. The Logistic equation is Y = k / (1+ae). –bX In the equation, X represents the time after flowering, Y represents the thousand-grain dry weight at time X, e is the base of the natural logarithm function, and a, b, and k are parameters to be determined. The GFR can be obtained by differentiating the equation and performing related calculations. max GFR mean Grouting parameters such as GFR2. Among them, the maximum grain filling rate GFR2 is... max = bk / 4; Grain filling rate (GFR) mean The dry weight of 1,000 grains at maturity is divided by the grain-filling duration; the grain-filling rate (GFR2) during the rapid growth period is obtained by dividing the difference in dry weight of 1,000 grains between two time points obtained by the first derivative by the duration of this period.

[0065] Genetic map construction: The genetic linkage map of the Yangmai 16 / Zhongmai 895 DH population was constructed by Xu et al. (2019). The map contained 148,179 SNP markers, with a total genetic distance of 3,681.73 cM and an average distance of 0.25 cM between adjacent markers.

[0066] QTL positioning and marking ​ Findings: Using QTL IciMapping V4.0 software (Meng et al., 2015), the complete composite interval mapping (ICIM) method was employed to locate the grain filling rate of 174 families in the DH population under different environments. A LOD value of 3.0 was selected as the threshold. The mapping results showed that a major-effect QTL exists on the long arm of chromosome 1B, simultaneously regulating both the maximum grain filling rate and the grain filling rate during the rapid growth phase. ​ Its enhancing allele comes from Yangmai 16, with a QTL confidence interval of 128.5–129.5 cM, flanked by markers [missing information]. ​ and ​ 111590092 The allelic variations of the two markers correspond to the physical positions of bases 653939615 and 665050665 on the positive strand of chromosome 1B in the Chinese Spring Reference Genome V1.0 version, respectively. This invention first attempts to use SNP markers... ​ 110534755 and ​ The conversion to KASP markers was unsuccessful. Further, referring to the Chinese Spring genome version V1.0 and its annotation information (http: / / 202.194.139.32 / ), in... ​ Find the corresponding physical interval containing ​ Multiple SNP tags, including those from KASP, were identified and attempted to be converted into KASP tags. The final SNP tags were... ​ 95630347 It was successfully converted into a KASP tag with ideal fractal effect and named ​ .

[0067] KASP markup ​ Obtaining the primer set: SEQ ID NO.1 is the SNP marker. ​ 95630347The flanking sequence of SEQ ID NO.1 has a polymorphism of A or C at position 36, meaning that the base at this position is A or C in actual wheat materials. The reverse complementary sequence of SEQ ID NO.1 is SEQ ID NO.2, which has two corresponding polymorphic single nucleotides, T or G, meaning that the base at this position is T or G in actual wheat materials. The extended sequence (SEQ ID NO.6) containing SEQ ID NO.2 was obtained from the wheat multi-omics database website (WheatOmics1.0, http: / / 202.194.139.32 / ). This extended sequence is the sequence of bases 658738504 to 658738618 of the positive strand of chromosome 1B in the Chinese Spring Reference Genome V1.0 version. A BLAST search was performed on SEQ ID NO. 6 in the International Wheat Genome Sequencing Consortium (IWGSC; https: / / wheat-urgi.versailles.inra.fr / ), yielding two highly homologous sequences with high similarity to SEQ ID NO. 6, namely SEQ ID NO. 7 and SEQ ID NO. 8 in the sequence listing, located on wheat chromosomes 1D and 1A, respectively. Multiple sequence alignment was performed on SEQ ID NO. 2 (sequence 2), SEQ ID NO. 6 (sequence 6), SEQ ID NO. 7 (sequence 7), and SEQ ID NO. 8 (sequence 8). ​ Based on chromosome specificity and general principles of KASP primer design, a set of KASP primers was designed, consisting of primers A, B, and C. The 3' terminal bases of the two competing primers (primer A and primer B) (the 3' terminal base T of primer A and the 3' terminal base G of primer B) correspond to SNP markers. ​ The allelic variations of bases A or C, along with the shared primer (primer C), ensured chromosome 1B specificity for PCR amplification. This invention is based on SNP markers within the major QTL interval of wheat grain filling rate. ​ Developed KASP tags ​The primer set consists of primers A, B, and C. Two competing primers have a fluorescent tag sequence attached to their 5' ends. Primer A can consist of fluorescent tag sequence A and single-stranded DNA as shown in positions 22–46 of SEQ ID NO. 3, sequentially from 5' to 3'. Alternatively, it can consist of fluorescent tag sequence A and DNA with one or more nucleotide substitutions and / or deletions and / or additions to positions 22–46 of SEQ ID NO. 3 that have the same function. Fluorescent tag sequence A is preferably the fluorescent tag sequence FAM (5'–GAAGGTGACCAAGTTCATGCT–3'). Primer B can be a fluorescent tag sequence B and a single-stranded DNA as shown in positions 22–46 of SEQ ID NO.4, from 5' to 3' end, or it can be a fluorescent tag sequence B and DNA with one or more nucleotide substitutions and / or deletions and / or additions to positions 22–46 of SEQ ID NO.4 that has the same function. The fluorescent tag sequence B is preferably the fluorescent tag sequence HEX (5'–GAAGGTCGGAGTCAACGGATT–3'). Primer C can be SEQ ID NO.5, or it can be a DNA molecule with one or more nucleotide substitutions and / or deletions and / or additions to SEQ ID NO.5 that has the same function.

[0068] above:

[0069] SEQ ID NO.6:

[0070] 5'-CCCACGGTGAGGTGTCCTTGATGGTCTGCATCAGATACCCTTTGTTACCGGCGGTGTGCACCACGACGATCCCCTTCTTGACCGCATGCAGTGCAGCGAATGAGTTCTCACTCAT-3';

[0071] SEQ ID NO.7:

[0072] 5'-CCCACGGCGAGGTGTCCCTGATGGTCTGCATATGCGGCCCAGCGTTGCCAGCGGTGTGCACCATGACGATCCCCTTCAGGACCGCATGTAGTGTACCGTATGAATTCTCGCTCAT-3';

[0073] SEQ ID NO.8:

[0074] 5'-CCCACGGCGAGGTGTCCCTGATGGTCTGCATATGCGGCCCAGCGTTGCCAGCGGTGTGCACCATGACGATCCCCTTCAGGACCGCATGTAGTGTACCGTATGAGTTCTCGCTCAT-3'.

[0075] Example 2 uses KASP tags ​ Establishment of genotype detection methods

[0076] Use KASP tag ​ The primer set was used to detect the genotypes of some wheat varieties in the natural population.

[0077] 1. Genomic DNA was extracted from natural wheat populations using the CTAB method, and the resulting template solution was diluted to a DNA concentration of approximately 30 ng / μL.

[0078] 2. Using the genomic DNA extracted in step 1 as a template, PCR amplification was performed using the primer sets shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 to obtain the amplification products.

[0079] Preparation of KASP-labeled primer working solution:

[0080] Take 12 μL (100 μM) of each of the two competing primers (primer A and primer B) and 30 μL (100 μM) of the common primer (primer C). Add sterile ultrapure water to make up to 100 μL and mix thoroughly. This mixture is used as the working solution for KASP-labeled primers.

[0081] PCR amplification reaction system: Contains 2 μL DNA template (approximately 30 ng / μL), 0.08 μL primer working solution, and 2.5 μL KASP 2×Master Mix (LGC, catalog number: KBS-1016-002), topped with sterile ultrapure water to a final volume of 5 μL. The KASP 2×Master Mix contains fluorescent probe A, fluorescent probe B, quencher probe A, and quencher probe B, as well as high-fidelity... ​ Enzymes, dNTPs, Mg 2+The components are as follows. The nucleotide sequence of fluorescent probe A is 5'–GAAGGTGACCAAGTTCATGCT–3', with a FAM fluorescent group attached to its 5' end; the nucleotide sequence of fluorescent probe B is 5'–GAAGGTCGGAGTCAACGGATT–3', with a HEX fluorescent group attached to its 5' end; the nucleotide sequence of quencher probe A is 5'–AGCATGAACTTGGTCACCTTC–3', with a BHQ quencher group attached to its 3' end; the nucleotide sequence of quencher probe B is 5'–AATCCGTTGACTCCGACCTTC–3', with a BHQ quencher group attached to its 3' end.

[0082] The PCR reaction procedure is as follows: Step 1, pre-denaturation at 95℃ for 15 min; Step 2, denaturation at 95℃ for 20 s, followed by 65–57℃ (decreasing by 1℃ per cycle) for 60 s, for a total of 9 cycles; Step 3, denaturation at 95℃ for 20 s, followed by annealing and extension at 57℃ for 1 min, for a total of 32 cycles; store at 10℃.

[0083] 3. Scanning of fluorescence signals of PCR amplification products:

[0084] The PCR amplification products were scanned using a multi-functional microplate reader. The excitation wavelength of FAM was 485 nm and the emission wavelength was 520 nm; the excitation wavelength of HEX was 535 nm and the emission wavelength was 556 nm; and the excitation wavelength of the system reference fluorescence ROX was 575 nm and the emission wavelength was 610 nm.

[0085] 4. Allelic typing:

[0086] The microplate reader scanning data were analyzed using Kluster Caller software (specific methods are described in the KlusterCaller software manual, which is available from LGC). Based on the analysis results, the wheat SNP markers to be tested were determined as follows. ​ Genotypes: The fluorescence signal data of the wheat amplification products to be tested were analyzed by Kluster Caller software. The genotypes of the samples clustered near the X-axis and far from the origin in the fluorescence signal coordinate system of the genotyping results were the alleles connected to the FAM fluorescent tag sequence; the genotypes of the samples clustered near the Y-axis and far from the origin were the alleles connected to the HEX fluorescent tag sequence.

[0087] The genotypes of some wheat varieties in a natural population were detected using the aforementioned KASP marker primer set. The genotyping results are as follows: ​As shown, specifically: the fluorescence signal data of the wheat amplification products analyzed by Kluster Caller software aggregated in samples near the X-axis and far from the origin (sample set 1), with genotype AA; the fluorescence signal data of the amplification products aggregated in samples near the Y-axis and far from the origin (sample set 2), with genotype CC; the fluorescence signal data points of the amplification products clustered in samples near the middle of the diagonal in the coordinate system have the genotype heterozygous AC (sample set 3); if the sample DNA quality is poor, the fluorescence signal of the amplification product is weak, and its fluorescence signal data cannot be automatically interpreted by Kluster Caller software, and is shown as pink sample points in the figure.

[0088] Example 3 uses KASP tags ​ Application of auxiliary identification of wheat grain filling rate in breeding

[0089] 1. Test materials and phenotypic determination

[0090] The experimental materials included 151 wheat varieties from the Huang-Huai wheat region (see Table 1).

[0091] Grain filling rate determination: 151 wheat varieties were planted at the Yangzhou and Hai'an experimental bases in Jiangsu Province in 2021–2022, and at the Yangzhou and Suqian experimental bases in Jiangsu Province in 2022–2023. All field trials employed a randomized block design with three replicates. Planting was done in small plots with four rows per plot, each 1.5 m long and with a row spacing of 25 cm (Yangzhou and Hai'an) or 20 cm (Suqian). Field management followed the guidelines of the local experimental stations. The grain filling rate (GFR) of each experimental material was analyzed and determined using the method described in Example 1. max Grain filling rate (GFR) mean The grain filling rate during the rapid growth period (GFR2) was used as the mean of three replicates for statistical analysis.

[0092] 2. Use KASP tags ​ Primer set detection of various experimental materials:

[0093] Following the method described in Example 2, genomic DNA was extracted from each experimental material, and the genotype of each experimental material was analyzed using the aforementioned high-throughput molecular marker detection system. The detection results are as follows: ​As shown in Table 1, the genotypes of 151 wheat varieties are listed, with 94 varieties having the genotype AA and 57 varieties having the genotype CC. The BLUE values ​​(best linear unbiased estimates) of the grain filling rate phenotype for the 151 wheat varieties under four environmental conditions (Yangzhou and Hai'an in 2021-2022; Yangzhou and Suqian in 2022-2023) are also listed in Table 1. The PROC TTEST program in the internationally used SAS 9.2 statistical software was used to perform T-test analysis on the phenotypic data of the 151 wheat varieties under the four environmental conditions and BLUE values. The results showed that under the conditions of Yangzhou and Hai'an in 2021-2022, Yangzhou in 2022-2023, and when using BLUE value analysis, the maximum grain filling rate (GFR) of the AA genotype was... max Both the grain filling rate (GFR2) during the rapid growth period and the grain filling rate (GFR2) were significantly higher. P <0.01 or P <0.001) higher than that of materials with genotype CC; under the conditions of Yangzhou and Hai'an in 2021-2022 and Suqian in 2022-2023, and when using BLUE value analysis, the average grain filling rate (GFR) of materials with genotype AA was higher. mean Significant ( P <0.01 or P <0.001) is higher than that of materials with genotype CC ( ​ These results illustrate the KASP tag ​ The primer set and genotype detection system can be effectively used to assist in the identification of wheat grain filling rate and for molecular-assisted selection breeding aimed at improving wheat grain filling rate.

[0094] Table 1151 wheat varieties marked with KASP ​ Genotypes tested

[0095] And the best linear unbiased estimate of the grain filling rate phenotypic value under four different environments.

[0096]

[0097] This invention measured the grain filling rate-related traits of 174 families in the Yangmai 16 / Zhongmai 895 DH population under multiple different environments. Genotypic analysis of this population was performed using a 660K SNP chip, and a high-density linkage map was constructed. QTL mapping revealed a major-effect QTL on the long arm of chromosome 1B that simultaneously regulates the maximum grain filling rate and the grain filling rate during the rapid growth phase. The enhancing allele of this QTL originates from Yangmai 16, and the QTL genetic confidence interval is 128.5–129.5 cM, with markers flanking it as follows: ​ and ​ The LOD value was 3.03–12.69, explaining 3.53%–13.57% of the phenotypic variation. This locus is denoted as ​ According to the Chinese Spring reference genome version V1.0, the markers are... ​ and ​ The allelic variations were located at bases 653939615 and 665050665 on the positive strand of chromosome 1B, respectively. Further analysis revealed SNP markers. ​ It is distributed in ​ A marker within the specified interval; the allelic variation of this SNP corresponds to base position 658738539 on the positive strand of chromosome 1B in the Chinese Spring genome V1.0 version. This invention uses wheat 660K SNP chip marking. ​ This was transformed into a KASP marker that can be used for high-throughput, low-cost, and low-error-rate genotyping, named... ​ .

[0098] This invention utilizes a set of grain filling rate phenotypic data of wheat materials in the Huang-Huai wheat region under multiple different environments (four different environments and the best linear unbiased estimate of phenotypic data for each environment) to label KASP. AX-95630347-KASP The effectiveness and reliability were verified, and the test results showed that, in most environments, AX-95630347 The grain filling rate (including maximum grain filling rate, average grain filling rate, and grain filling rate during the rapid growth period) of materials with genotype AA was significantly higher. P <0.01 or P The KASP molecular marker <0.001 was higher than that of materials with the CC genotype. These results indicate that the KASP molecular marker described in this invention... AX-95630347-KASP It can be effectively used for the main effect QTL of wheat grain filling rate QGFR.yzu-1BL Molecular marker-assisted selection breeding.

[0099] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0100] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0101] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. Used to identify the QTL (Qualitative Time To Live) of wheat grain filling rate. QGFR.yzu-1BL Application of primer sets for significantly associated molecular markers in any of the following: 1) To prepare, screen or breed products of wheat single plants, lines or varieties with high grain filling rates; 2) To assist in the screening or breeding of wheat individual plants, lines, strains, or varieties with high grain filling rates; The primer set includes fluorescent tag sequence A and single-stranded DNA as shown in positions 22–46 of SEQ ID NO.3, from the 5' end to the 3' end; fluorescent tag sequence B and single-stranded DNA as shown in positions 22–46 of SEQ ID NO.4, from the 5' end to the 3' end; and single-stranded DNA as shown in SEQ ID NO.

5.

2. The application according to claim 1, characterized in that, The fluorescent tag sequence A is the fluorescent tag sequence FAM, and the fluorescent tag sequence B is the fluorescent tag sequence HEX.

3. The application according to claim 1, characterized in that, In application 1), the product is a PCR reagent or kit.

4. The application according to claim 3, characterized in that, The product also includes fluorescent probe A, fluorescent probe B, quencher probe A and quencher probe B, fluorescent reporter group A is FAM, fluorescent reporter group B is HEX, and fluorescent quencher groups A and B are both BHQ.

5. A method for assisting in the identification or comparison of grain filling rates in wheat, characterized in that, Includes the following steps: Using wheat genomic DNA as a template, PCR amplification was performed using the primer set described in claim 2. The amplified products were scanned for fluorescence signals, and the scan data were analyzed using Kluster Caller software. Based on the analysis results, SNP markers were determined according to the following method. AX-95630347 Genotype: If the fluorescence signal data of the wheat amplification products to be tested cluster in the fluorescence signal coordinate system of the genotyping results, close to the X-axis and far from the origin, as analyzed by Kluster Caller software, then the wheat to be tested contains SNP markers. AX-95630347 The genotype is homozygous AA; if the fluorescence signal data of the wheat amplification products are clustered near the Y-axis and far from the origin in the coordinate system by Kluster Caller software analysis, then the SNP marker in the wheat is present. AX-95630347 The genotype is homozygous CC; if the fluorescence signal data of the wheat amplification products are clustered near the middle of the diagonal in the coordinate system by Kluster Caller software analysis, then the wheat contains SNP markers. AX-95630347 The genotype is heterozygous AC or CA; among which, SNP markers AX-95630347 Located on chromosome 1B, its nucleotide sequence is shown in SEQ ID NO.

1. The nucleotide sequence shown in SEQ ID NO.1 has a polymorphism of A or C from the 36th base at the 5' end.

6. The method according to claim 5, characterized in that, If the wheat to be tested contains AX-95630347 If the wheat has the AA genotype, the tested wheat has a relatively high grain-filling rate. AX-95630347 If the genotype is CC, the wheat being tested has a relatively low grain filling rate.

7. A method for assisting in the screening or breeding of wheat individual plants, lines, strains, or varieties with high grain-filling rates, characterized in that, Includes the following steps: Selecting grain filling rate (QTL) in each generation of breeding. QGFR.yzu-1BL SNP markers within the interval AX-95630347 The wheat material with genotype AA was selected and finally bred. AX-95630347 Wheat plants, lines, strains, or varieties with the genotype AA; among them, SNP markers AX-95630347 Located on chromosome 1B, its nucleotide sequence is shown in SEQ ID NO.

1. The nucleotide sequence shown in SEQ ID NO.1 has a polymorphism of A or C from the 36th base at the 5' end.

Images