Primer group and probe for detecting seed sources of honeysuckle and lonicerae flos and application of primer group and probe

Abstract

The invention discloses a primer group and a probe for detecting seed sources of honeysuckle and lonicerae flos and application of the primer group and the probe. The primer group and the probe are composed of a first primer group, a first probe, a second primer group, a second probe, a third primer group, a third probe, a fourth primer group, a fourth probe, a fifth primer group and a fifth probe, and each primer group is composed of a corresponding upstream primer and a downstream primer. According to the invention, a real-time fluorescent quantitative PCR technology is used, five primer probe groups of lonicera hypoglauca, lonicera confusa, lonicera macranthoides and lonicera fulvotomentosa in lonicera japonica and lonicera confusa are adopted, the components of lonicera hypoglauca, lonicera confusa, lonicera macranthoides and lonicera fulvotomentosa in lonicera japonica and lonicera fulvotomentosa can be successfully detected respectively, and the specific effect is good; the rapid and accurate identification of four congeneric sibling species in honeysuckle and lonicerae flos is realized.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and relates to a primer set and a probe for detecting the provenance of honeysuckle and Chinese honeysuckle, and applications thereof. Background Art

[0002] Honeysuckle and Chinese honeysuckle are both commonly used medicines with the same origin of food and medicine, and are used in large quantities. Due to the difference in the output of honeysuckle and Chinese honeysuckle, the price of honeysuckle is much more expensive than that of Chinese honeysuckle. Honeysuckle and Chinese honeysuckle are closely related plants, and the shape characteristics of dried medicinal materials are relatively similar. In addition, both honeysuckle and Chinese honeysuckle have many improved varieties, so it is difficult to identify them according to traditional standard methods. Therefore, there are lawless elements in the market who adulterate Chinese honeysuckle in order to gain greater benefits. If a patient takes a mixed product, he will not only suffer economic losses but also affect treatment. Therefore, it is very necessary to monitor whether honeysuckle is mixed with Chinese honeysuckle in the process of production, processing and sales, and the focus is to quickly and accurately identify the varieties of honeysuckle and Chinese honeysuckle. In addition to the existing Chinese Pharmacopoeia standard regulations, it is also necessary to establish a fast, accurate and stable identification method for both. Fluorescence quantitative PCR technology is a highly sensitive nucleic acid quantification technology developed on the basis of PCR technology. Fluorescent dyes or fluorescent probes are included in the PCR reaction system, and the accumulation of fluorescent signals is used to monitor the entire PCR reaction process in real time. It has the characteristics of simple operation, rapid and efficient, high throughput and high sensitivity, which greatly overcomes the shortcomings of traditional PCR technology. At present, this technology has gradually become an important means in traditional Chinese medicine research.

[0003] At present, the commonly used identification methods are divided into two categories: classical identification methods and modern identification methods. The classical identification methods are summarized and developed in long-term practice. They can distinguish the authenticity of honeysuckle to a certain extent, and can also judge the quality and authenticity of medicinal materials. They mainly include origin identification, property identification, microscopic identification and physical and chemical identification. Among them, origin identification is to apply biological taxonomy methods to identify the biological source of traditional Chinese medicine, so as to determine its correct scientific name. This is the basis for the identification of honeysuckle. The 2015 edition of the Chinese Pharmacopoeia has a detailed description of the sources of honeysuckle and Chinese honeysuckle. Property identification is a method of observing and identifying the property characteristics of traditional Chinese medicine using sensory organs. Among the four varieties of Chinese honeysuckle, the gray felt honeysuckle has the largest cultivation area and is very similar to the authentic honeysuckle. With the increasing number of variants of honeysuckle and gray felt honeysuckle, it is difficult to distinguish them by ordinary identification methods. Since honeysuckle and Chinese honeysuckle are both plants of the genus Lonicera in the family Caprifoliaceae, it is not easy to identify them through properties and microscopic examination after drying; and in terms of physical and chemical identification, it is very difficult to identify similar species, especially closely related species of the same genus.

[0004] Therefore, people continue to explore the use of modern methods for identification. Modern identification methods for honeysuckle can be divided into instrumental analysis and molecular biology methods. Instrumental analysis methods, such as the use of chemometric methods for chemical pattern recognition, are used for the identification of traditional Chinese medicine. Ni et al. analyzed the rare earth element content of honeysuckle from different geographical origins by ICP-MS. Wu Feiyan et al. observed honeysuckle samples from different sources under an electron microscope and found that their outer skin had more glandular hairs and non-glandular hairs; while almost no glandular hairs were found on the outer skin of gray felt honeysuckle from different sources. Molecular identification technology refers to a method of identifying medicinal materials by directly analyzing the polymorphism of genetic material DNA to infer the intrinsic genetic variation of the species. Compared with instrumental methods, it has the characteristics of stability, accuracy, good specificity, and is not affected by the biological development stage and storage and processing. It is gradually becoming an important means of identifying traditional Chinese medicine. There have been reports on the identification of honeysuckle and Chinese honeysuckle. For example, Cui Zhiwei et al. studied ITS2 and psb A-trn H as the dominant barcode combination for identifying different varieties of honeysuckle. The amplification success rate of ITS2 and psb A-trn H sequences of different varieties of honeysuckle was 100%, and the sequencing success rates were 72.7% and 91.0%, respectively, and both had many variable sites. However, the molecular identification methods reported so far, including DNA barcode, ISSR (inter-simple sequence repeat), RFLP (Restriction Fragment Length Polymorphism), SSR (simple sequence repeat), SNP (single nucleotide polymorphism), etc., all have defects, such as complex operation, large sample volume, poor reproducibility, long experimental cycle, easy contamination, etc., cannot meet the needs of rapid testing, and it is difficult to perform rapid quantification after detection. Therefore, it is urgent to establish a rapid, simple, stable and universal molecular identification method for honeysuckle and Chinese honeysuckle, especially for the rapid and accurate identification of the four closely related species of Chinese honeysuckle (red gland honeysuckle, south China honeysuckle, gray felt honeysuckle, and yellow-brown honeysuckle).

[0005] In view of this, this patent application is filed. Summary of the invention

[0006] To solve the above problems, the present invention provides a primer set and a probe for detecting the provenance of honeysuckle and Flos Lonicerae, also provides the application of the primer set and the probe, and a method for detecting four provenances of Flos Lonicerae in honeysuckle using the primer set and the probe, and also provides a detection kit comprising the primer set and the probe of the present invention.

[0007] The following technical solutions are used to achieve this:

[0008] The first object of the present invention is to provide a primer set and a probe for detecting the provenance of Lonicera japonica Lonicera, which is composed of a first primer set, a first probe, a second primer set, a second probe, a third primer set, a third probe, a fourth primer set, a fourth probe and a fifth primer set, a fifth probe;

[0009] The first primer set consists of an upstream primer as shown in SEQ ID NO: 1 and a downstream primer as shown in SEQ ID NO: 2;

[0010] The second primer set consists of an upstream primer as shown in SEQ ID NO: 3 and a downstream primer as shown in SEQ ID NO: 4;

[0011] The third primer set consists of an upstream primer as shown in SEQ ID NO: 5 and a downstream primer as shown in SEQ ID NO: 5;

[0012] The fourth primer set consists of an upstream primer as shown in SEQ ID NO: 7 and a downstream primer as shown in SEQ ID NO: 8;

[0013] The fifth primer set consists of an upstream primer as shown in SEQ ID NO: 9 and a downstream primer as shown in SEQ ID NO: 10;

[0014] The sequence of the first probe is CCTTTTGAACATTTTGTACATT, and both the 5′ and 3′ ends thereof are modified with fluorescent groups;

[0015] The sequence of the second probe is AATTCGACTAATGATAA, and both the 5′ and 3′ ends thereof are modified with fluorescent groups;

[0016] The sequence of the third probe is CGTACTCCAGAAAA, and both the 5′ and 3′ ends thereof are modified with fluorescent groups;

[0017] The sequence of the fourth probe is TTACAAATAAAATAGATC, and both the 5′ end and the 3′ end thereof are modified with fluorescent groups;

[0018] The sequence of the fifth probe is TCTTTATTACTTTCTTTAT, and both the 5′ end and the 3′ end thereof are modified with fluorescent groups.

[0019] In order to solve the technical problem of adulterating honeysuckle with fake honeysuckle, the present invention adopts a probe method of real-time fluorescence quantitative PCR technology, and designs specific primers and probes for honeysuckle and four kinds of honeysuckle respectively. After verifying the effectiveness and specificity of the detection, the honeysuckle and four kinds of honeysuckle in the mixed products can be quickly and accurately identified and quantified, which provides fast and accurate technical support for the identification and quantitative detection of fake honeysuckle in honeysuckle, and provides convenient and effective technical means for food and drug safety supervision and law enforcement.

[0020] Preferably, it also includes an internal reference primer set and an internal reference probe;

[0021] The internal reference primer set consists of an upstream primer as shown in SEQ ID NO: 11 and a downstream primer as shown in SEQ ID NO: 12;

[0022] The sequence of the internal reference probe is TACATTGAATGTACAGAAATG, and both the 5′ and 3′ ends thereof are modified with fluorescent groups;

[0023] Preferably, the modification group at the 5' end of the first, second, third, fourth and fifth probes is CY5, and the modification group at the 3' end is MGB;

[0024] The modification group at the 5' end of the internal reference probe is FAM, and the modification group at the 3' end is MGB.

[0025] The second object of the present invention is to provide the use of the primer set and probe described in any of the above items in detecting the honeysuckle provenance in honeysuckle, wherein the honeysuckle provenance includes red gland honeysuckle, south China honeysuckle, gray felt honeysuckle and yellow-brown honeysuckle.

[0026] The third object of the present invention is to provide a method for detecting the provenance of Lonicera japonica Lonicera, using the first primer set and the first probe to perform a real-time fluorescent PCR reaction to detect whether the sample to be tested contains Lonicera japonica Lonicera;

[0027] Using the second primer set and the second probe to perform a real-time fluorescent PCR reaction to detect whether the sample to be tested contains Lonicera japonica;

[0028] Using the third primer set and the third probe to perform real-time fluorescent PCR reaction to detect whether the sample to be tested contains Lonicera japonica;

[0029] Using the fourth primer set and the fourth probe to perform real-time fluorescence PCR reaction to detect whether the sample to be tested contains Lonicera japonica;

[0030] The fifth primer set and the fifth probe are used to perform a real-time fluorescent PCR reaction to detect whether the sample to be tested contains honeysuckle.

[0031] Preferably, the volume ratio of the upstream primer, downstream primer and probe in each primer set is 0.75:0.75:0.5.

[0032] Preferably, the steps include:

[0033] (1) DNAs of Lonicera japonica, Lonicera chinensis, Lonicera truncatula, and Lonicera truncatula from Flos Lonicerae and Flos Lonicerae were extracted respectively and used as DNA templates for PCR reactions;

[0034] (2) using any of the extracted DNA as a template, preparing a corresponding PCR reaction system, wherein the PCR system comprises a primer set and a probe corresponding to the template DNA as described in any one of claims 1 to 2, placing the reaction system in a fluorescent quantitative PCR instrument, and starting the reaction;

[0035] (3) Perform specific identification based on the reaction results.

[0036] Preferably, the CTAB method is used to extract DNA in step (1).

[0037] Preferably, in step (2), the PCR reaction system is: 12.5 μl of 2×SuperReal PreMix (Probe), 0.75 μl of upstream primer, 0.75 μl of downstream primer, 0.5 μl of probe, 2 μl of DNA template, and RNase-Free ddH2O to make up to 25 μl.

[0038] Preferably, a two-step reaction procedure is used in the PCR reaction, and the amplification process is: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 10 seconds, annealing and extension at 55°C for 20 seconds, and 40 cycles.

[0039] A fourth object of the present invention is to provide a kit comprising the primer set and probe as described in any one of the above items.

[0040] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0041] 1. The present invention uses real-time fluorescence quantitative PCR technology and adopts five primer probe sets of red gland honeysuckle, south China honeysuckle, gray felt honeysuckle and yellow brown honeysuckle in honeysuckle and Chinese honeysuckle, which can successfully detect the components of red gland honeysuckle, south China honeysuckle, gray felt honeysuckle and yellow brown honeysuckle in honeysuckle and Chinese honeysuckle respectively with good specificity effect.

[0042] 2. The real-time fluorescence PCR qualitative detection method for detecting a mixture of honeysuckle and Chinese honeysuckle provided by the present invention provides technical support for the rapid identification of adulterated Chinese honeysuckle in honeysuckle, and achieves a rapid and accurate identification effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings:

[0044] Figure 1 This is a typical fluorescence amplification curve of honeysuckle.

[0045] Figure 2 This is a typical fluorescence amplification curve of Red Gland Honeysuckle.

[0046] Figure 3 This is a typical fluorescence amplification curve of Lonicera japonica.

[0047] Figure 4 This is a typical fluorescence amplification curve of Lonicera japonica.

[0048] Figure 5 This is a typical fluorescence amplification curve of Lonicera japonica.

[0049] Figure 6 This is the fluorescence amplification curve of honeysuckle in the mixed sample.

[0050] Figure 7 This is the fluorescence amplification curve of red gland honeysuckle in the mixed sample.

[0051] Figure 8 This is the fluorescence amplification curve of the mixed sample Lonicera japonica.

[0052] Fig. 9 This is the fluorescence amplification curve of Lonicera japonica in the mixed sample.

[0053] Fig.10 This is the fluorescence amplification curve of Lonicera japonica in the mixed sample. DETAILED DESCRIPTION

[0054] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0055] In the present invention, according to the differences in gene sequences in the gene information of red gland honeysuckle, south China honeysuckle, gray felt honeysuckle and yellow brown honeysuckle in honeysuckle and mountain honeysuckle, specific primers and probes of the five species are designed respectively by using professional software, and the primers and probes are produced by a professional company and then verified by real-time fluorescence PCR experiments, and finally specific primers and probes that can accurately identify the five species are developed.

[0056] Example 1: Primer probe sequence product

[0057] Based on the specific genes of Lonicera japonica, Lonicera chinensis, Lonicera grisea, and Lonicera tawny in Flos Lonicerae and Flos Lonicerae, specific primers and probes were designed and produced and verified using Primer Express 5.0 software. The synthesis and labeling of all primers and probes were completed by Beijing Qingke Biotechnology Co., Ltd. The sequences of real-time fluorescence PCR primers and probes are shown in Table 1.

[0058] Table 1 Primer and probe sequences for real-time fluorescence quantitative PCR

[0059]

[0060]

[0061] Embodiment 2:

[0062] This embodiment provides a method for detecting honeysuckle and four species of honeysuckle provenances, wherein the honeysuckle provenances include red gland honeysuckle, south China honeysuckle, gray felt honeysuckle and yellow brown honeysuckle.

[0063] The specific detection method is as follows:

[0064] 1. DNA extraction

[0065] Honeysuckle and four species of honeysuckle (red gland honeysuckle, south China honeysuckle, gray felt honeysuckle, and yellow-brown honeysuckle) were purchased from the market as experimental samples. The genomic DNA of honeysuckle and four species of honeysuckle (red gland honeysuckle, south China honeysuckle, gray felt honeysuckle, and yellow-brown honeysuckle) were extracted respectively and used as DNA templates for subsequent PCR reactions.

[0066] The extraction process is:

[0067] (1) Weigh 50 mg of each sample into a 2 mL centrifuge tube, add 700 μL of CTAAB buffer, vortex to mix, and incubate at 65°C for 60 min. During this time, invert the centrifuge tube three times to mix.

[0068] (2) Add 700 μL of chloroform-isoamyl alcohol (24:1), vortex and mix well, and let stand for 10 min. During this time, invert the centrifuge tube 3 times to mix well. Centrifuge at 12,000 g for 5 min.

[0069] (3) Transfer the supernatant to a 1.5 mL centrifuge tube, add 0.6 times the volume of the supernatant and precooled isopropanol at 4°C, incubate at -20°C for 5 min, centrifuge at 12,000 g for 5 min, and carefully discard the supernatant.

[0070] (4) Add 1000 μL of 70% ethanol, tilt the centrifuge tube, gently rotate it for several turns, and centrifuge it at 12,000 g for 1 min at 4°C. Carefully discard the supernatant; add 20 μL of RNase A (10 μg / mL) and incubate at 37°C for 30 min.

[0071] (5) Add 600 μL of sodium chloride solution and incubate at 65°C for 10 min. Add 600 μL of Tris-saturated phenol-chloroform-isoamyl alcohol (25:24:1), mix by inversion, centrifuge at 12,000 g for 5 min, and transfer the upper aqueous phase to a 1.5 ml centrifuge tube.

[0072] (6) Add 0.6 times the volume of the upper aqueous phase obtained in (5) and precooled to 4°C isopropanol, invert to mix, and let stand at 4°C for 30 min; centrifuge at 12,000 g for 10 min at 4°C and carefully discard the supernatant.

[0073] (7) Add 1000 μL of 70% ethanol precooled at 4°C, tilt the centrifuge tube, gently rotate it for several turns, centrifuge it at 12000g for 2 min at 4°C, and carefully discard the supernatant; repeat the washing process with 70% ethanol precooled at 4°C in the same way. Evaporate the liquid at room temperature.

[0074] (8) Add 75 μL TE buffer to dissolve the DNA and store at -20°C until use.

[0075] 2. Real-time fluorescence PCR reaction system and conditions

[0076] The primers and probes are respectively the first primer set and the first probe; the second primer set and the second probe; the third primer set and the third probe; the fourth primer set and the fourth probe; the fifth primer set and the fifth probe. Using the DNA solutions obtained in step 1 as templates, five PCR reaction systems are prepared with the primer sets and corresponding probes in Table 1.

[0077] Each DNA template was subjected to PCR reaction in 5 PCR reaction systems, specifically:

[0078] (1) Dissolve 2× SuperReal PreMix (Probe) (stored at -30 to -15°C), DNA template, primers and RNase-Free ddHO 2 O and equilibrate all reagents at room temperature and mix thoroughly.

[0079] (2) Place on ice to prepare the Real-Time PCR reaction solution. Reaction system: 2×SuperReal PreMix (Probe) 12.5 μl, forward primer 0.75 μl, reverse primer 0.75 μl, fluorescent probe 0.5 μl, DNA template 2 μl, RNase-Free ddH2 0 to make up to 25 μl.

[0080] (3) A two-step PCR reaction procedure was used for the reaction.

[0081] Specifically: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s, annealing and extension at 55°C for 20 s, and 40 cycles.

[0082] (4) Cover the reaction tube and mix gently. Centrifuge briefly to ensure that all components are at the bottom of the tube.

[0083] (5) Place the reaction system in a fluorescent quantitative PCR instrument and start the reaction.

[0084] 3. Effectiveness and specificity testing

[0085] (1) DNA extracted from honeysuckle, red gland honeysuckle, south China honeysuckle, gray felt honeysuckle and yellow brown honeysuckle by CTAB method was used for internal reference gene detection, wherein the internal reference primer set used for internal reference gene detection consists of an upstream primer as shown in SEQ ID NO: 11 and a downstream primer as shown in SEQ ID NO: 12, and the sequence of the internal reference probe is shown in Table 1.

[0086] The results show that:

[0087] All samples showed typical amplification curves in the internal reference reaction system, and the Ct values ​​were all less than 35. The blank control had no typical amplification curve, indicating that the extracted DNA was suitable for real-time fluorescence PCR amplification and the reaction system was effective. The results are shown in Table 2.

[0088] Table 2 Results of real-time fluorescence PCR effectiveness test of nucleic acid extracted from five medicinal materials by CTAB method

[0089]

[0090]

[0091] (2) The DNA extracts of Flos Lonicerae, Flos Lonicerae, Flos Lonicerae, Flos Lonicerae and Flos Lonicerae were amplified using the PCR reaction system formed by the primer sets and probes corresponding to Flos Lonicerae, Flos Lonicerae, Flos Lonicerae, Flos Lonicerae and Flos Lonicerae. The specificity results are shown in Table 3.

[0092] Table 3 Real-time fluorescence PCR specificity results of nucleic acid extracted by CTAB method from five medicinal materials

[0093]

[0094] The fluorescence amplification curves of honeysuckle, red gland honeysuckle, south China honeysuckle, gray felt honeysuckle and yellow brown honeysuckle in the five reaction systems were shown in Figure 2. Figures 1 to 5As shown, it can be seen that after the five samples were tested by the honeysuckle reaction system, only the honeysuckle produced an "S"-type fluorescence amplification curve; after the five samples were tested by the red gland honeysuckle reaction system, only the red gland honeysuckle produced an "S"-type fluorescence amplification curve; after the five samples were tested by the South China Honeysuckle reaction system, only the South China Honeysuckle produced an "S"-type fluorescence amplification curve; after the five samples were tested by the gray felt honeysuckle reaction system, only the gray felt honeysuckle produced an "S"-type fluorescence amplification curve; after the five samples were tested by the yellow-brown hair honeysuckle reaction system, only the yellow-brown hair honeysuckle produced an "S"-type fluorescence amplification curve.

[0095] The results showed that only the probe markers corresponding to the same provenance showed a typical S-shaped amplification curve. The Ct value of the honeysuckle signal was 18.69, the Ct value of the red gland honeysuckle signal was 20.22, the Ct value of the south China honeysuckle signal was 26.70, the Ct value of the gray felt honeysuckle signal was 15.06, and the Ct value of the yellow-brown honeysuckle signal was 17.75. And their Ct values ​​were all less than 35.

[0096] Embodiment 3:

[0097] In this embodiment, the inventors further studied the detection effects of mixing the samples together in different reaction systems, and the specific method was as follows:

[0098] The genomic DNA of honeysuckle, red gland honeysuckle, south China honeysuckle, gray felt honeysuckle and yellow brown honeysuckle extracted by CTAB method were mixed in a ratio of 1:1:1:1:1, and real-time fluorescence PCR was performed in the amplification system of honeysuckle and the four honeysuckle species, respectively. The fluorescence amplification curves are shown in Figure 2. Figures 6 to 10 .according to Figures 6 to 10 It can be seen that typical amplification curves less than 35 appeared in the five reaction systems. The Ct value of the honeysuckle signal was 20.75, the Ct value of the red gland honeysuckle signal was 22.37, the Ct value of the south China honeysuckle signal was 29.33, the Ct value of the gray felt honeysuckle signal was 17.48, and the Ct value of the yellow-brown honeysuckle signal was 19.80.

[0099] In summary, the present invention adopts real-time fluorescence quantitative PCR (RT-PCR), which has high sensitivity and specificity, and can quickly detect four provenances in honeysuckle and honeysuckle with high accuracy. The five primer probe sets of honeysuckle, red gland honeysuckle, south China honeysuckle, gray felt honeysuckle, and yellow-brown hair honeysuckle provided by the present invention can successfully detect the red gland honeysuckle, south China honeysuckle, gray felt honeysuckle, and yellow-brown hair honeysuckle components in honeysuckle and honeysuckle respectively, and the specific effect is good. At the same time, the real-time fluorescence PCR qualitative detection method for detecting mixed honeysuckle and honeysuckle provided by the present invention provides technical support for the rapid identification of four highly similar closely related species of the same genus that are adulterated with honeysuckle in honeysuckle.

Claims

1. A primer set and probe for detecting the provenance of Lonicera japonica Lonicera, characterized in that: Composed of a first primer set, a first probe, a second primer set, a second probe, a third primer set, a third probe, a fourth primer set, a fourth probe, and a fifth primer set, a fifth probe; The first primer set consists of an upstream primer as shown in SEQ ID NO: 1 and a downstream primer as shown in SEQ ID NO: 2; The second primer set consists of an upstream primer as shown in SEQ ID NO: 3 and a downstream primer as shown in SEQ ID NO: 4; The third primer set consists of an upstream primer as shown in SEQ ID NO: 5 and a downstream primer as shown in SEQ ID NO: 5; The fourth primer set consists of an upstream primer as shown in SEQ ID NO: 7 and a downstream primer as shown in SEQ ID NO: 8; The fifth primer set consists of an upstream primer as shown in SEQ ID NO: 9 and a downstream primer as shown in SEQ ID NO: 10; The sequence of the first probe is CCTTTTGAACATTTTGTACATT, and both the 5′ and 3′ ends thereof are modified with fluorescent groups; The sequence of the second probe is AATTCGACTAATGATAA, and both the 5′ and 3′ ends thereof are modified with fluorescent groups; The sequence of the third probe is CGTACTCCAGAAAA, and both the 5′ and 3′ ends thereof are modified with fluorescent groups; The sequence of the fourth probe is TTACAAATAAAATAGATC, and both the 5′ end and the 3′ end thereof are modified with fluorescent groups; The sequence of the fifth probe is TCTTTATTACTTTCTTTAT, and both the 5′ end and the 3′ end thereof are modified with fluorescent groups.

2. A primer set and probe for detecting the provenance of Lonicera japonica Lonicera according to claim 1, characterized in that: Also included are an internal reference primer set and an internal reference probe; The internal reference primer set consists of an upstream primer as shown in SEQ ID NO: 11 and a downstream primer as shown in SEQ ID NO: 12; The sequence of the internal reference probe is TACATTGAATGTACAGAAATG, and both the 5′ and 3′ ends thereof are modified with fluorescent groups; Preferably, the modification group at the 5' end of the first, second, third, fourth and fifth probes is CY5, and the modification group at the 3' end is MGB; The modification group at the 5' end of the internal reference probe is FAM, and the modification group at the 3' end is MGB.

3. Use of the primer set and probe according to any one of claims 1 to 2 in detecting Lonicera japonica provenance in Flos Lonicerae, wherein the Lonicera japonica provenance includes Lonicera rubra, Lonicera chinensis, Lonicera grisea and Lonicera tawny.

4. A method for detecting the provenance of Lonicera japonica Lonicera, characterized in that: Using the first primer set and the first probe to perform a real-time fluorescent PCR reaction to detect whether the sample to be tested contains red gland honeysuckle; Using the second primer set and the second probe to perform a real-time fluorescent PCR reaction to detect whether the sample to be tested contains Lonicera japonica; Using the third primer set and the third probe to perform real-time fluorescent PCR reaction to detect whether the sample to be tested contains Lonicera japonica; Using the fourth primer set and the fourth probe to perform real-time fluorescence PCR reaction to detect whether the sample to be tested contains Lonicera japonica; The fifth primer set and the fifth probe are used to perform a real-time fluorescent PCR reaction to detect whether the sample to be tested contains honeysuckle.

5. A method for detecting the provenance of Lonicera japonica Lonicera according to claim 4, characterized in that: The volume ratio of the upstream primer, downstream primer, and probe in each primer set was 0.75:0.75:0.

5.

6. A method for detecting the provenance of Lonicera japonica Lonicera according to claim 4, characterized in that: The following steps are involved: (1) DNAs of Lonicera japonica, Lonicera chinensis, Lonicera truncatula, and Lonicera truncatula from Flos Lonicerae and Flos Lonicerae were extracted respectively and used as DNA templates for PCR reactions; (2) using any of the extracted DNA as a template, preparing a corresponding PCR reaction system, wherein the PCR system comprises a primer set and a probe corresponding to the template DNA as described in any one of claims 1 to 2, placing the reaction system in a fluorescent quantitative PCR instrument, and starting the reaction; (3) Perform specific identification based on the reaction results.

7. A method for detecting the provenance of Lonicera japonica Lonicera according to claim 6, characterized in that: In step (1), the CTAB method is used to extract DNA.

8. A method for detecting the provenance of Lonicera japonica Lonicera according to claim 6, characterized in that: In step (2), the PCR reaction system is: 2×SuperReal PreMix (Probe) 12.5 μl, upstream primer 0.75 μl, downstream primer 0.75 μl, probe 0.5 μl, DNA template 2 μl, RNase-Free ddH2O to make up to 25 μl.

9. A method for detecting the provenance of Lonicera japonica Lonicera according to claim 6, characterized in that: The PCR reaction used a two-step reaction procedure, and the amplification process was: 95°C pre-denaturation for 5 min; 95°C denaturation for 10 s, 55°C annealing and extension for 20 s, and 40 cycles.

10. A kit, characterized in that: It contains the primer set and probe according to any one of claims 1 to 2.

Images