RT-RAA primer pair and probe combination for detecting bovine coronavirus

Abstract

The invention provides a method for rapidly detecting bovine coronavirus, in which a primer pair and a probe for detecting bovine coronavirus based on recombinase isothermal amplification fluorescence method amplification are used, the primer pair is used for amplifying all or part of a fragment with a sequence of SEQ ID NO: 1, and the probe is used for detecting a product amplified by the primer. The primer and the probe provided by the invention are suitable for detection based on a recombinase isothermal amplification fluorescence method, and have the characteristics of simplicity, rapidness, sensitive reaction and good specificity, the RAA technology effectively fills the blank of a scheme for realizing rapid, accurate and convenient BCoV detection in a grass-roots farm and a low-resource configuration environment, and a new means is provided for rapid BCoV detection clinically.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection of animal diseases, and specifically relates to an RT-RAA primer pair and a probe combination for detecting bovine coronavirus. Background Art

[0002] Bovine coronavirus (BCoV) can cause diarrhea in calves, winter dysentery in adult cattle, and respiratory diseases in cattle of all ages. The virus can be transmitted through the digestive tract and respiratory tract, causing diarrhea and death in calves, decreased production performance in adult cattle, and reduced milk production in dairy cows. BCoV has the characteristics of cross-species transmission. It can not only infect cattle, sheep, cats and other wild ruminants, but also studies have reported that BCoV antibodies have been detected in human serum. BCoV can slow down the growth and development of calves, reduce the production performance of adult cattle, lead to decreased milk production in dairy cows and reduced meat production in beef cattle, and ultimately cause a serious decline in the economic benefits of cattle farms, damaging the sustainable development of animal husbandry. The virus is distributed globally, seriously affecting the healthy development of the global cattle industry. From a global perspective, the incidence of BCoV is 70%-100%, the mortality rate is 35%-52%, and more than 30% of newborn calf diarrhea cases are related to BCoV infection. Therefore, the establishment of a rapid, sensitive and field-suitable detection method is of great significance for the early detection and identification of BCoV. However, bovine coronavirus BCoV can cause both diarrhea and respiratory symptoms in clinical practice, and it is difficult to distinguish it from other common pathogens of farm diseases (such as BVDV, BRSV, BRV and IBRV, etc.) through clinical symptoms. In recent years, the emerging fluorescent RT-RAA method has high sensitivity, strong specificity, good stability, simple experimental operation process, short time consumption, relatively low dependence on experimental equipment, and can quickly perform on-site detection.

[0003] Recombinase-aided amplification (RAA) is a new nucleic acid detection technology that has emerged in recent years. This technology can achieve rapid amplification of nucleic acids under constant temperature conditions. Its principle is to use recombinases obtained from bacteria or fungi to bind tightly to primer DNA at room temperature to form a complex of enzyme and primer. When the primer searches for a complementary sequence that matches it perfectly on the template DNA, it opens the double-stranded structure of the template DNA with the help of single-stranded DNA binding protein, and forms a new complementary DNA chain under the action of DNA polymerase, and the amplified product grows exponentially. Using fluorescent probe labeling, RAA technology can achieve real-time quantitative result analysis.

[0004] However, RAA technology has very strict requirements for the design of probes and primers. Since the target nucleic acid sequence is usually present in a relatively low concentration in the sample, it is necessary to design highly specific primers and probes to avoid false positive test results caused by nonspecific amplification. In addition, there may be some reaction inhibitors in the sample, such as inhibitors in blood or feces, which may affect the results of the isothermal nucleic acid amplification reaction. Therefore, the design of primers and probes for this technology is the main limiting factor for the clinical application of RAA technology. Summary of the invention

[0005] The purpose of the present invention is to provide an RT-RAA primer pair and probe combination for detecting bovine coronavirus, that is, a primer pair and probe for rapid detection of bovine coronavirus by recombinase-aided amplification (RAA) to complete the simple, rapid, sensitive and specific detection of BCoV.

[0006] The present invention first provides an RT-RAA primer pair and probe combination for detecting bovine coronavirus, wherein the primer pair is used to amplify all or part of a fragment of SEQ ID NO: 1, and the probe is used to detect the product amplified by the primers.

[0007] As a specific record of the embodiment, the sequence information of the primer pair and probe r is as follows:

[0008] BCV-RAA-F: 5′-TCCCAGCTACTGAAGCTAAAGGGTACTGGTA-3′ (SEQ ID NO: 2);

[0009] BCV-RAA-R: 5′-CGGTGCCATACTGGTCTTTGGCATGCGGTCC-3′ (SEQ ID NO: 3);

[0010] The sequence of BCV-RAA-Probe is as follows: 5′-TCCTTTAAAACAGCCGATGGCAACCAGCGCAATGCTGCCACGATGGTA-3′ (SEQ ID NO: 4);

[0011] The probe BCV-RAA-Probe is labeled with a FAM luminescent group at the 29th base G from the 5′ end, the 30th base C is replaced by tetrahydrofuran THF, the 32nd base A is labeled with a BHQ1 quenching group, and the 3′ end is modified with a C3-spacer blocking.

[0012] The primer pair and probe provided by the present invention can be used to prepare a kit for detecting bovine coronavirus.

[0013] In yet another aspect, the present invention provides a method for detecting bovine coronavirus, wherein the method uses the above-mentioned kit for detection.

[0014] The bovine coronavirus real-time fluorescent RT-RAA detection method provided by the present invention has high sensitivity, strong specificity, good stability, simple experimental operation process, short time consumption, relatively low dependence on experimental equipment, can quickly perform on-site detection, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Real-time fluorescence RT-RAA F3 / R3 primer temperature test results;

[0016] Figure 2 :Real-time fluorescence RT-RAA sensitivity test results;

[0017] Figure 3 :Real-time fluorescence RT-RAA specificity test results;

[0018] Figure 4 : Real-time fluorescence RT-RAA repeatability test results. DETAILED DESCRIPTION

[0019] The present invention establishes a BCoV fluorescent RT-RAA detection method in order to provide technical support for the on-site rapid diagnosis of BCoV.

[0020] The present invention is described in detail below in conjunction with embodiments and drawings.

[0021] Example 1: Design and screening of primers and probes

[0022] The present invention compares the representative reference strains of bovine coronavirus recorded in Genbank, and selects the conserved region in the N gene as the target. The gene sequence is as follows:

[0023] ATGTCTTTTACTCCTGGTAAGCAATCCAGTAGTAGAGCGTCCTCTGGAAATCGTTCTGGTAATGGCAT

[0024] CCTTAAGTGGGCCGATCAGTCCGACCAATCTAGAAATGTTCAAACCAGGGGTAGAAGAGCTCAACCCAAG

[0025] CAAACTGCTACTTCTCAGCAACCATCAGGAGGGAATGTTGTACCCTACTATTCTTGGTTCTCTGGAATTACT

[0026] CAGTTTCAAAAGGGAAAGGAGTTTGAATTTGCAGAGGGACAAGGTGTGCCTATTGCACCAGGAGTCCCAG

[0027] CTACTGAAGCTAAAGGGTACTGGTACAGACACAACAGACGTTCCTTTAAAACAGCCGATGGCAACCAGCG

[0028] TCAATTGCTGCCACGATGGTATTTTTACTATCTTGGAACAGGACCGCATGCCAAAGACCAGTATGGCACCGA

[0029] CATTGACGGAGTCTTCTGGGTCGCTAGTAACCAGGCTGATGTCAATACCCCGGCTGACATTCTCGATCGGGA

[0030] CCCAAGTAGCGATGAGGCTATTCCGACTAGGTTTCCGCCTGGCACGGTACTCCCTCAGGGTTACTATATTGA

[0031] AGGCTCAGGAAGGTCTGCTCCTAATTCCAGATCTACTTCACGCGCATCCAGTAGAGCCTCTAGTGCAGGATC

[0032] GCGCAGTAGAGCCAATTCTGGCAATAGAACCCCTACCTCTGGTGTAACACCTGATATGGCTGATCAAATTGC

[0033] TAGTCTTGTTCTGGCAAAACTTGGCAAGGATGCCACTAAGCCACAGCAAGTAACTAAGCAGACTGCCAAG

[0034] GAAATCAGACAGAAAATTTTGAATAAGCCCCGCCAGAAGAGGAGCCCCAATAAACAATGCACTGTTCAGC

[0035] AGTGTTTTGGGAAGAGAGGCCCCAATCAGAATTTTGGTGGTGGAGAAATGTTAAAACTTGGAACTAGTGAT

[0036] CCACAGTTCCCCATTCTTGCAGAACTCGCACCTACAGCTGGTGCGTTTTTCTTTGGATCAAGATTAGAGTTG

[0037] GCCAAAGTGCAGAATTTGTCTGGGAATCTTGACGAGCCCCAGAAGGATGTTTATGAATTGCGCTATAATGGC

[0038] GCAATTAGATTTGATAGTACACTTTCAGGTTTTGAGACCATAATGAAGGTGTTGAATGAGAATTTGAATGCAT

[0039] ACCAACAACAGGATGGTACGATCAATATGAGTCCAAAACCACAGCGTCAGCGTGGTCAGAAGAACGGACA

[0040] AGGAGAAAATGATAATAATAAGTGTTGCAGCGCCCAAAAGCCGTGTGCAGCAAAATAAGATTAGAGAGTTGA

[0041] CTGCAGAGGACATCAGCCTTCTTAAGAAGATGGATGAGCCCTTTACTGAAGACACCTCAGAAATATAA

[0042] (SEQ ID NO: 1).

[0043] The DNA plasmid was constructed based on the above BCoV N gene sequence, and the recombinant plasmid size was 1346bp. The highly conservative BCoV N gene sequence was used as the target gene fragment for detection, and primers and probes were designed for screening and detection.

[0044] 1. Primer design

[0045] According to the RAA primer design principle and the BCoV N gene sequence, the primer design includes an upstream primer and a downstream primer. The design sequences of the upstream primer and the downstream primer are as follows:

[0046] BCV-RAA-F1: 5′-TCCTGGTAAGCAATCCAGTAGTAGAGCGTCC-3′;

[0047] BCV-RAA-F2: 5′-GACCAATCTAGAAATGTTCAAACCAGGGGTA-3′;

[0048] BCV-RAA-F3: 5′-TCCCAGCTACTGAAGCTAAAGGGTACTGGTA-3′;

[0049] BCV-RAA-R1: 5′-CGGAATAGCCTCATCGCTACTTGGGTCCCGA-3′;

[0050] BCV-RAA-R2: 5′-CGACCCAGAAGACTCCGTCAATATCGGTGCC-3′;

[0051] BCV-RAA-R3: 5′-CGGTGCCATACTGGTCTTTGGCATGCGGTCC-3′;

[0052] BCV-RAA-Probe: 5′-TCCTTTAAAACAGCCGATGGCAACCAGCGCAATGCTGCCACG ATGGTA-3′;

[0053] The above primers were combined into 9 primer combinations, namely combination 1, F1R1; combination 2, F2R1; combination 3, F3R1; combination 4: F1R2; combination 5, F2R2; combination 6: F3R3; combination 7: F1R3; combination 8: F2R3; combination 9, F3R3. Among the 9 primer probe combinations, the combination 9 F3 / R3 primer pair had the earliest peak and the strongest fluorescence signal. Therefore, the primer pair of combination 9 was selected as the best primer combination for subsequent experiments. Its specific sequence information is as follows:

[0054] BCV-RAA-F3: 5′-TCCCAGCTACTGAAGCTAAAGGGTACTGGTA-3′ (SEQ ID NO. 2);

[0055] BCV-RAA-R3: 5'-CGGTGCCATACTGGTCTTTGGCATGCGGTCC-3' (SEQ ID NO. 3).

[0056] 2. Probe design

[0057] (1) According to the RAA primer design principle and based on the BCoV N gene sequence, the probe sequence designed was: 5′-TCCTTTAAAACAGCCGATGGCAACCAGCGCAATGCTGCCACGATG GTA-3′; (SEQ ID NO. 4).

[0058] (2) Selection of fluorescent modification groups and fluorescence quenching groups

[0059] The experimental instrument used was the RAA-F1620 fluorescent gene detector produced by Jiangsu Qitian Biological Science Instrument Co., Ltd. The fluorescence detected was FAM fluorescence, so the fluorescent modification group was selected as FAM and the fluorescence quenching group was selected as BHQ1.

[0060] (3) The modification method of the probe comprises: the 29th base G of the probe BCV-RAA-Probe from the 5′ end is labeled with a FAM luminescent group, the 30th base C is replaced by tetrahydrofuran THF, the 32nd base A is labeled with a BHQ1 quenching group, and the 3′ end is modified with a C3-spacer blocking group;

[0061] 5′-TCCTTTAAAACAGCCGATGGCAACCAGCG[FAM-dt]C[THF-da]AA[BH Q1-dt]TGCTGCCACGATGGTA[SPACERC3]-3′.

[0062] 3. Primers, probes and plasmids were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0063] 4. The detection reagent for rapid detection of bovine coronavirus based on recombinase isothermal amplification fluorescence method includes RAA fluorescence basic reaction reagent, reaction buffer, purified water, magnesium acetate, positive quality control, negative quality control, primers and probes; RAA fluorescence basic reaction reagent is a freeze-dried powder that has been freeze-dried at low temperature, purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd., with a product number of F00R01A, and a reaction specification of 50μL. It is re-dissolved with reaction buffer before use, and the reaction buffer is a matching reagent for RAA fluorescence basic reaction reagent. The synthesized pMD-18T-BCoV-N gene plasmid was measured for concentration and copy number calculation using a Nanodrop 2000 spectrophotometer, and the standard was prepared by concentration gradient dilution for standby use. The negative quality control is ddH2O or purified water. The concentrations of the upstream primer and the downstream primer are 10μM; the concentration of the probe is 10μM.

[0064] Example 2: Preparation of bovine coronavirus plasmid standards

[0065] The cDNA obtained by reverse transcription of BCoV RNA was used as a template for RT-PCR amplification. The amplified target fragment was purified and cloned into the pMD18-T vector, and sequenced and identified by Sangon Biotech (Shanghai) Co., Ltd. The recombinant plasmid with correct sequencing was used as a plasmid standard and named pMD-18T-BCoV-N. The concentration was determined by Nanodrop 2000 spectrophotometer and calculated by the formula (copies·μL -1 )=6.02×10 23 × concentration (ng·μL -1 )×10-9 / fragment length × 660) to calculate the copy number, and the original concentration of the plasmid standard was 2.4 × 10 10 copies / μL.

[0066] Example 3: Determination of the Optimal Reaction Temperature of the Bovine Coronavirus RT-RAA Method

[0067] According to the RT-RAA nucleic acid amplification (fluorescence method) manual, the reaction system was configured, and 25 μL of fluorescent base RT-RAA buffer, 0.6 μL of probe (10 μmol / L), 2.1 μL of upstream and downstream primers (10 μmol / L), 14.2 μL of pure water, 1 μL of template and 5 μL of magnesium acetate solution were added to the reaction unit, totaling 50 μL system. After oscillating and mixing with a constant temperature oscillating mixer, amplification was performed using a constant temperature nucleic acid amplification detector, reacting for 20 minutes, and reading the test results. According to the positive determination method in the RAA-F1620 detection instrument, the threshold method was selected to determine the positive and negative of the curve. When the automatic threshold is set to 300 and the qualitative threshold is set to 20, within 20 minutes, the wells with a fluorescence value greater than 300 will be judged as positive, and the rest will be judged as negative.

[0068] In order to screen the optimal reaction temperature, the above optimal primer combination (F3 / R3) was used to perform fluorescent RT-RAA amplification on the plasmid standard at 40°C, 41°C, and 42°C, respectively. The optimal reaction temperature was determined based on the peak time and fluorescence intensity of the amplification curve. Figure 1 As shown, when the primer pair was tested at 41°C, the peak was the fastest and the fluorescence signal was the strongest. Therefore, 41°C was determined to be the optimal reaction temperature for the test.

[0069] Example 4: Sensitivity verification of bovine coronavirus RT-RAA method

[0070] In order to test the sensitivity of the selected primer pair and probe combination, a positive standard plasmid named pMD-18T-BCoV-N was constructed. 7 copies / μL, and then diluted 10-fold to 2.4×10 6 copies / μL, 2.4×10 5 copies / μL, 2.4×10 4 copies / μL, 2.4×10 3 copies / μL, 2.4×10 2 copies / μL, 2.4×10 1 copies / μL, 2.4×10 0copies / μL was used as a template for the sensitivity experiment, and a negative control was set. RT-RAA nucleic acid amplification was performed according to the aforementioned sample addition method. The test results are shown in Figure 2 As shown in Figure 2, the RAA primer and probe combination designed by the present invention has a strong sensitivity. The fluorescence RT-RAA method can detect a concentration of 2.4×10 1 copies / μL of plasmid standards, indicating that this method has high sensitivity.

[0071] Example 5: Specific detection of screened primer probes

[0072] In order to verify the specificity of the present invention, the nucleic acids of bovine infectious rhinotracheitis virus, bovine viral diarrhea virus, bovine respiratory syncytial virus, bovine rotavirus and bovine coronavirus were extracted according to the instructions of the nucleic acid extraction reagent as reaction templates at a concentration of 2.4×10 4 The pMD-18T-BCoV-N plasmid standard with 10 copies / μL was used as the positive control, and sterile water was used as the negative control for fluorescent RT-RAA amplification.

[0073] Test results such as Figure 3 As shown: The results showed that only the bovine coronavirus positive samples and the positive quality control products had obvious amplification, and the positive nucleic acids of bovine respiratory syncytial virus (BRSV), bovine infectious rhinotracheitis virus (IBRV), bovine viral diarrhea (BVDV), and bovine rotavirus (BRV) had no obvious amplification, showing good specificity.

[0074] Example 6: Repeatability verification of bovine coronavirus RT-RAA method

[0075] The concentration was selected as 2.4×10 5 copies / μL, 2.4×10 7 The plasmid standard with 100 copies / μL was used as the template and sterile water as the negative control. Fluorescence RT-RAA amplification was performed three times, and each dilution was repeated three times to test the repeatability and stability of the method. Figure 4 As shown, the amplification curves of the same concentration of plasmid standards in three repeated experiments have a high coincidence rate, and the differences in peak time and fluorescence value are small, indicating that this method has good repeatability.

[0076] Example 7: Detection and verification of clinical samples

[0077] A total of 89 clinical tissue samples were collected, and the 89 clinical samples to be tested were extracted according to the instructions of the nucleic acid extraction reagent, and the extracted RNA was stored at -80°C.

[0078] The RNA of the above samples was detected using the fluorescent RT-RAA method established by the present invention and the real-time fluorescent RT-PCR method established in the laboratory in the early stage (Gao Hui, Li Xiaocheng, Liu Ying, et al. Establishment and application of real-time fluorescent quantitative RT-PCR detection method for bovine coronavirus [J]. Heilongjiang Animal Husbandry and Veterinary Medicine (Second Half of the Month), 2022, (3): 86-91.) respectively, and the consistency rate of the two methods was calculated. For samples with inconsistent detection results by the two methods, ordinary PCR amplification and sequencing were performed for verification. The results (see Table 1) show that both the fluorescent RT-RAA detection method and the fluorescent RT-PCR detection method detected 59 positive samples and 30 negative samples, and the sample positive rate was 66.29%. The consistency rate of the two detection methods was 100.00%, indicating that the established fluorescent RT-RAA method and the fluorescent RT-PCR method have high consistency.

[0079] Table 1: Clinical test results

[0080]

[0081] Example 8: Comparison of detection results with existing methods

[0082] At present, a method for rapid detection of bovine coronavirus RT-RAA has been patented (application number: 202211722982.6). The primer probe disclosed in the invention is synthesized, and the fluorescent RT-RAA method established by the invention is used to detect the concentration of 2.4×10 4 The results showed that the fluorescent RT-RAA method established by the present invention began to peak at the 3rd minute, while the patented RT-RAA method began to peak at the 9th minute. It is proved that the primer pair of the present invention can amplify detectable products in the shortest time, thereby effectively avoiding false positives caused by long amplification time. Therefore, it can be judged that the fluorescent RT-RAA method established by the present invention is significantly better than other methods.

[0083] In summary, the present invention respectively designs primer pairs and probes for real-time fluorescent RT-RAA for the BCoV-N gene, and screens out upstream and downstream primers BCV-RAA-F3, BCV-RAA-R3 and probe BCV-RAA-Probe suitable for rapid detection of RAA. The real-time fluorescent RT-RAA kit for detecting bovine coronavirus based on the above primer pairs and probes described in the present invention only needs to react for 20 minutes at a constant temperature of 41°C to complete. The entire reaction process has low requirements for instruments and equipment, short time consumption, and simple operation. It is more suitable for grassroots on-site diagnosis and instant detection, and truly realizes portable rapid nucleic acid detection, which can provide technical support for rapid diagnosis, real-time monitoring and prevention and control of bovine coronavirus disease.

Claims

1. A primer pair and a probe for detecting bovine coronavirus based on recombinase isothermal amplification fluorescence method, wherein the primer pair is used to amplify all or part of a fragment with a sequence of SEQ ID NO: 1, and the probe is used to detect the product amplified by the primers.

2. The primer pair and probe according to claim 1, characterized in that: The upstream primer of the primer pair has a sequence of SEQ ID NO: 2, and the downstream primer has a sequence of SEQ ID NO:

3.

3. The primer pair and probe according to claim 1, characterized in that: The sequence of the probe is SEQ ID NO:

4.

4. The primer pair and probe according to claim 3, characterized in that: The probe is labeled with a FAM luminescent group at the 29th base G from the 5' end, the 30th base C is replaced by tetrahydrofuran THF, the 32nd base A is labeled with a BHQ1 quenching group, and the 3' end is modified with a C3-spacer blocking.

5. Use of the primer pair and probe according to any one of claims 1 to 4 in preparing a RAA fluorescence detection kit.

6. A RAA fluorescence detection kit, characterized in that: The kit comprises the primer pair and probe according to any one of claims 1 to 4.

7. A method for detecting bovine coronavirus, characterized in that: The method is to use the kit described in claim 6 for detection.

Images