Application of compound C4 in preparation of medicine for treating gastric cancer

Abstract

The invention relates to application of a compound C4 in preparation of a medicine for treating gastric cancer. The invention provides the possibility of the compound C4 in treating new indications of gastric cancer for the first time, and through further transformation research, the treatment level of epigenetic targeted drugs for gastric cancer can be improved, and the prognosis of patients can be improved.

Description

Technical Field

[0001] The present invention belongs to the field of cancer treatment, and particularly relates to application of compound C4 in preparing drugs for treating gastric cancer. Background Art

[0002] Gastric cancer (GC) is one of the most common digestive tract malignancies and the leading cause of cancer death. Traditional treatments for gastric cancer are surgery and chemotherapy. With the development of DNA sequencing technology, multi-omics integration, and precision oncology medicine, molecular targeted therapy, immunotherapy, and epigenetic therapy have shown great therapeutic potential. The key to epigenetics is the multiple modifications of histones and nucleic acids, which synergistically regulate chromatin structure and gene expression. Its dysregulation drives abnormal transcription processes that lead to the occurrence and development of cancer. Therefore, targeting epigenetic regulators has become the focus of cancer treatment research. In-depth exploration of epithelial therapeutic targets and realization of clinical transformation are of great significance for improving the prognosis of GC patients. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide the use of compound C4 in the preparation of drugs for treating gastric cancer. For the first time, the possibility of a new indication for compound C4 in the treatment of gastric cancer is proposed. Through further translational research, it will help to improve the therapeutic level of epigenetic targeted drugs for gastric cancer and improve patient prognosis.

[0004] The present invention proposes the use of compound C4 in the preparation of a drug for treating gastric cancer, wherein the structural formula of the compound C4 is:

[0005] From Chemdiv, ID 3253-2867.

[0006] Preferably, the compound C4 inhibits cell proliferation by effectively targeting KLF4-SIN3A binding.

[0007] Preferably, the drug further comprises a pharmaceutically acceptable carrier and / or excipient.

[0008] More preferably, the pharmaceutically acceptable carrier and / or excipient comprises at least one of a diluent, a binder, a surfactant, a humectant, an adsorption carrier, a lubricant, a filler, and a disintegrant.

[0009] Preferably, the dosage form of the drug includes at least one of tablets, pills, powders, solutions, suspensions, emulsions, and granules.

[0010] Preferably, the effective therapeutic dosage concentration of the drug is 5 mg / kg.

[0011] Preferably, the administration of the drug includes intravenous injection.

[0012] Beneficial Effects

[0013] The present invention first confirms that SIN3A is associated with the high malignancy and poor prognosis of gastric cancer patients and can promote the proliferation and growth of gastric cancer cells. Secondly, through a series of molecular biology and cell biology, it is proved that SIN3A promotes cell proliferation by forming a SIN3A / HDAC1 / KLF4 complex, inhibiting KLF4 acetylation, and reducing KLF4's inhibition of cell cycle-related gene transcription, thereby promoting gastric cancer growth. Subsequently, the present invention inferred the KLF4-SIN3A binding site PAH3 through molecular experiments, and used computer algorithms to simulate the local spatial structure of PAH3. C4 with ID 3253-2867 was screened out from the Chemdiv database according to the occupancy fraction at the PAH3 site. The IC50 of this compound in gastric cancer cell lines within 24 hours was less than 10 μM. Cell experiments confirmed that the efficacy of C4 was positively correlated with SIN3A expression, and IP experiments confirmed that C4 could inhibit SIN3A-KLF4 binding at effective concentrations. In terms of safety, this study used rats to perform pharmacokinetic testing of C4, which confirmed that C4 was rapidly cleared in the body and had a short residence time, with a half-life of 0.62 hours. Acute toxicity tests were performed on mice, and the results showed that the effective therapeutic dose concentration of C4, 5 mg / kg, was far lower than the median lethal dose concentration. The pharmacodynamics of C4 was further evaluated in patient-derived organoids (PDOs) and patient-derived xenografts (PDXs), and compared with traditional HDAC inhibitors Vorinostat and Panobinostat. It was found that with the increase in SIN3A expression level, gastric cancer PDOs became more sensitive to C4, C4 could reduce the proportion of KI67-positive cells in PDXs, and it was not inferior to traditional HDAC inhibitors in fighting tumors. Based on this, the present invention proposes a new indication for C4 to treat gastric cancer for the first time. Through further translational research, it will help to improve the treatment level of epigenetic targeted drugs for gastric cancer and improve patient prognosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1The levels of SIN3A and survival prognosis of patients are shown; A is the expression level of SIN3A in gastric cancer tumor tissues and non-tumor tissues detected by Western blotting; B is a representative image of IHC staining of SIN3A in gastric cancer tumor tissues and non-tumor tissues, scale bar 100μm (200X), scale bar 40μm (400X); C is the percentage of IHC staining intensity; D is the overall survival rate of gastric cancer patients with different SIN3A expression levels in tumor tissues; E is the overall survival rate of gastric cancer patients with different SIN3A expression levels in the GSE54129 database; F is the overall survival rate of gastric cancer patients with different SIN3A expression levels in the TCGA database. **p<0.01, ****p<0.0001.

[0015] Figure 2 It shows that SIN3A can promote the growth of gastric cancer cells in vitro and in vivo; A is the measurement of cell proliferation by CCK-8; B is the measurement of cell proliferation by colony formation assay; C is the GSEA analysis of cell cycle based on different SIN3A expression groups using the TCGA database; D is the detection of cell cycle by flow cytometry; EG are images and quantification (tumor volume at the specified time, tumor weight at the end point) of subcutaneous tumors formed by HGC27 / NC, HGC27 / shSIN3A, MKN45 / vector and MKN45 / oeSIN3A transplanted into nude mice. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figure 3The results show that the SIN3A / HDAC1 complex inhibits the regulation of KLF4 on downstream cell cycle-related genes by binding to the TSS region; A is the distribution of KLF4 binding peaks in AGS / NC and AGS / shSIN3A groups; B is the heat map of the distribution of KLF4 binding peaks in AGS / NC and AGS / shSIN3A groups; C is the distribution of KLF4 binding peaks in the TSS region in AGS / NC and AGS / shSIN3A groups; D is the heat map of the distribution of KLF4 binding peaks in the TSS region in AGS / NC and AGS / shSIN3A groups; E is the KEGG analysis of KLF4 binding peaks in the GS / NC group; F is the KEGG analysis of KLF4 binding peaks in the AGS / shSIN3A group; G is the distribution of KLF4 binding difference peaks in the chromatin between AGS / NC and AGS / shSIN3A groups; H is the distribution of KLF4 binding difference peaks in the chromatin between AGS / NC and AGS / shSIN3A groups KEGG enrichment of the peaks; IJ is qPCR detection of the expression of KLF4 downstream binding genes in AGS / NC, AGS / shSIN3A, HGC27 / NC and HGC27 / shSIN3A groups; KL is ChIP-qPCR detection of the expression of KLF4 downstream binding genes in AGS / NC and AGS / shSIN3A cells; M is a dual luciferase reporter gene assay showing that when P300, HDAC1 or SIN3A were transfected into the indicated cells, the transcription level of the downstream gene HDAC1 did not change; N is a dual luciferase reporter gene assay showing that after transfection of KLF4 / KLF4-MUT1, P300, SIN3A and HDAC1, the transcription level of HDAC1 increased, while KLF4-MUT2 did not change the transcription level of HDAC1, and in HDAC1-mut cells, the three KLF4 plasmids did not change the transcription of HDAC1. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001

[0016] Figure 4 The identification and characterization of drugs targeting SIN3A-KLF4 and the verification of their pharmacokinetics are shown; A is a plasmid map; B is Western blotting to detect the FLAG of the above sample; C is the IP experiment of ani-FLAG in the above sample; D is the inhibition rate of the above cell line after 24h treatment with compound C4 (6uM); E is the IC50 of compound C4 in the above cell line; F is the computer-assisted competitive binding of compound C4 to simulate the SIN3A-KLF4 binding site; G is Western blot and IB detection of the effects of the above drugs in the above cell line; H is IP showing that compound C4 blocked the interaction between SIN3A and KLF4. *p<0.05, **p<0.01, ***p<0.001.

[0017] Figure 5 The in vitro and in vivo experiments confirmed the anti-tumor effect of compound C4; wherein, A is the expression level of SIN3A and KI67 in PDO detected by IF (scale bar 20 μm); B is the representative figure of compound C4 treatment of PDO and IC50 (scale bar 100 μm); CD is the tumors taken out and weighed after euthanasia of each group of PDX mice, and the subcutaneous tumor size was recorded with a caliper every 7 days after inoculation; E is the tumor inhibition rate of compound C4 in 2 PDX patients; F is a representative figure of HE, SIN3A, and KI67 staining of 2 PDX tumor tissues (scale bar 50 μm); G is the IC50 value of Vorinostat and Panobinostat in gastric cancer cell lines; H is a representative figure of PDX tumors in each group treated with Vorinostat and Panobinostat; I is the tumor taken out and weighed after euthanasia of mice; J is the subcutaneous tumor size measured with a caliper every 7 days after inoculation; K is the tumor inhibition rate of Vorinostat and Panobinostat in 2 PDX patients. *p<0.05, **p<0.01, ****p<0.0001. DETAILED DESCRIPTION

[0018] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0019] The experimental operation steps involved in the present invention are as follows:

[0020] Cell cycle assay

[0021] Cells were seeded into six-well plates and treated at least one day in advance. The cells were transferred to flow cytometry tubes, centrifuged at 1500×g for 5 minutes, and washed 2-3 times with PBS. Then the supernatant was discarded, 1mL PBS was added to each tube, and 3mL pre-cooled anhydrous ethanol was slowly added. Place in a 4°C refrigerator overnight. The next day, wash 2-3 times with pre-cooled PBS. After the last centrifugation, 100μL of liquid remained in the tube. 300μL of cycle reagent was added to each tube and incubated at 37°C for 30 minutes. Flow cytometry analysis was performed after placing at room temperature away from light.

[0022] Cell viability assay

[0023] Cell viability was assessed using the CCK8 assay kit. Cells were seeded in 96-well plates containing 200 μl of RPMI-1640 medium at a density of 2 × 10 3cells / well. On the second day after inoculation, the original culture medium was discarded and 100 μl of RPMI-1640 culture medium containing 10% CCK-8 solution was added to each well. The cells were then incubated at 37°C for 2 hours. The absorbance was measured at the designated time using a microplate reader at 450 nm.

[0024] Drug Screening

[0025] The Apopdb2receptor tool of OpenEye was used to process and generate receptor files for OEDock virtual screening. In the receptor, the docking region was defined using MOE-SiteFinder, and the length, width, and height were To ensure that all possible conformations of each compound can dock with the receptor, the plug-in omega2 in OpenEye software was used to generate the three-dimensional conformations of the compound. Molecular docking was performed using the OEDock program, and virtual screening used three compound databases: ChemDiv, TargetmolL1000, and TargetMol L6020). These databases were processed by molecular washing to remove impurities such as salts, metal ions, and small fragments. The three-dimensional structures of all compounds were generated by energy minimization, and then all compounds were protonated and charged by the AMBER10-EHT force field. In order to ensure that all possible conformations of the compound are involved in molecular docking, the plug-in omega2 (Ver 3.0.1.2) in the openeye software was used to generate multiple conformations of the compound, and no more than 50 conformations were generated for each compound. Finally, three multi-conformation files of each database were saved, which contained 3D structure, compound information, and ID.

[0026] Dual-luciferase reporter assay

[0027] The full-length sequences of HDAC1 and HDAC1-MUT promoters were synthesized and incorporated into the PGL3-BASIC plasmid. pcDNA3.1 plasmid, PGL3-plasmid and PRL-TK plasmid were transfected into HEK293T cells using Lipofectamine 3000 transfection reagent (Invitrogen). Three days after transfection, a dual-luciferase reporter gene assay was performed.

[0028] IC50 calculation

[0029] Cells were seeded onto 96-well plates (200 μL per well) at a density of 10,000 cells per well. The drug was added to the cells with ten serial two-fold dilutions of increasing dose. After 48 hours of culture, CCK-8 was added for incubation and absorbance was determined at 450 nm (OD450). The drug concentration was converted to Log10 values, and cell viability was standardized according to the OD450 value of cells with 0 mg / ml drug. After nonlinear regression analysis using GraphPad Prism, IC50 values ​​were calculated.

[0030] GSEA analysis

[0031] Gene set enrichment analysis (GSEA) was performed to identify significantly enriched pathways based on the MSIGDB database (C2.CP.Kegg.v7.2.2.symbols.gmt gene set). The top 20 positively correlated pathways were plotted using the R package GPLOT2.

[0032] Immunohistochemistry (IHC)

[0033] The tissues were fixed in 4% paraformaldehyde and embedded in paraffin. The paraffin-wrapped tissue blocks were dehydrated, hydrated and subjected to antigen retrieval. After washing, the slides were treated with 3% hydrogen peroxide for 15 min and washed with BSA for 15 min at room temperature. Subsequently, anti-SIN3A antibody (1:1200) and anti-KI67 antibody (1:400) were added to the sections at 4°C overnight. The streptavidin peroxidase method was used for signal detection, followed by staining with diaminobenzidine (DAB) and counter-staining with hematoxylin. Observed under an optical microscope and photographed.

[0034] Immunoprecipitation (IP)

[0035] Immunoprecipitation was performed using the Pierce Crosslink IP / CO-IP kit (88805, Thermo). Antibodies to SIN3A and KLF4 (10 μg) were covalently linked to magnetic protein A / G beads as immunoprecipitation antibodies. Finally, the antigens were eluted and subjected to Western blot analysis with antibodies against SIN3A, KLF4, RUNX1, KLF5, HDAC1, HDAC1, HDAC2, P300, and KLF4-AC.

[0036] Lentiviral transduction

[0037] For SIN3A knockdown, the target shRNA sequence was subcloned into the ZV102 shRNA lentiviral vector (U6-shRNA-PGK-PURO). The shRNA knockdown sequence for SIN3A is:

[0038] “GATCCGGTGGAACAGAATCGTTATTTCTTCCTGTCAGAAAATAACGATTCTGTTCCACC TTTTTG”. The human full-length SIN3A cDNA was subcloned into the FV026 lentiviral vector.

[0039] Hematoxylin and eosin (H&E) analysis

[0040] Mouse tumors were fixed with 4% paraformaldehyde. Paraffin-embedded samples were stained with H&E (Sigma). The stained sections were observed and photographed under a microscope.

[0041] Patient-derived organoid (PDO) model construction

[0042] Tumor and paired non-tumor tissues from gastric cancer patients were removed and washed with PBS to remove fat and connective tissue. The tissue was cut into 2 mm fragments with a scalpel and washed repeatedly with PBS. The remaining transparent tissue was digested with PBS+EDTA (2mM) at 4°C for 20 minutes with shaking. The tissue was collected, resuspended in 10mL PBS, and filtered repeatedly through a 70μm cell strainer. The supernatant was centrifuged and 100μL Matrigel was added to the precipitate. Approximately 500 to 1000 cells were inoculated in each well of a preheated 96-well plate, which contained 20μL Matrigel. 0.1 mL of organoid culture medium was added to each well, consisting of advanced DMEM / F12 + serum-free B27, N2, N-acetylcysteine, recombinant mouse epithelial growth factor (EGF 50 ng / mL), Noggin (100 ng / mL), R-Spondin (1 μg / mL), Glutamax-I supplement (1:100), penicillin / streptomycin (400 μg / m) and HEPES (10 μM). The culture was incubated in a humidified incubator at 37°C with 5% CO2.

[0043] Patient-derived xenograft (PDX) model construction

[0044] Fresh gastric cancer tissues were collected and washed three times with PBS containing 1× penicillin / streptomycin, and then adipose tissue, connective tissue, and gastric mucus were removed. The tumor tissues were then cut into 1-2 mm fragments with sterilized scissors and subcutaneously inoculated into nude mice to establish PDX models.

[0045] Acute toxicity of C4 to mice

[0046] Compound C4 was accurately weighed at 17.5 mg (50 mg / kg group), 14 mg (40 mg / kg group), 11.2 mg (32 mg / kg group), 8.75 mg (25 mg / kg group), and 7 mg (20 mg / kg group), and 3.5 mL of solution was prepared with 20% DMSO + 30% PEG 400 + 50% (containing 20% ​​hydroxypropyl-β-cyclodextrin) pH = 8 PBS buffer. Fifty ICR mice were randomly divided into five groups, with 10 males and half females in each group. Mice were injected with 20, 25, 32, 40, and 50 mg / kg C4 via the tail vein, respectively. The death of mice within 24 hours was observed and recorded.

[0047] Pharmacokinetics of C4 in rats

[0048] Weigh 12.5 mg of C4 accurately, prepare 8.0 mL of solution with 20% DMSO + 20% PEG 400 + 60% (containing 20% ​​hydroxypropyl-β-cyclodextrin) pH = 8 PBS buffer, and administer intravenously at 5 mg / kg. Collect whole blood in heparinized tubes at 2, 5, 10, 20, 30, 45 min, 1, 2, and 4 h after administration, centrifuge at 8000 rpm for 5 min, separate plasma, and store at -20°C for testing. Take 30 μL of drug-containing rat plasma, add 30 μL of 20 ng / mL internal standard diazepam and 60 μL of acetonitrile, shake for 5 min, centrifuge at 12,000 rpm, 4°C for 10 min, and take 60 μL of supernatant in a 5 μL injection bottle.

[0049] RNA extraction and quantitative real-time PCR (RT-PCR)

[0050] Cells were lysed with TRIzol reagent, and total RNA was extracted with chloroform and isopropanol. cDNA was synthesized using a reverse transcription kit according to the manufacturer's protocol, and RNA levels were relatively quantified using the SYBR Green Master Mix Kit. GAPDH was selected as an internal reference, and the expression level was normalized to the internal reference and determined by the 2-ΔΔCT method.

[0051] Western blotting

[0052] After washing with PBS, cells were lysed in RIPA buffer on ice. Protein concentration was quantified using a BCA protein assay kit. Subsequently, equal amounts of protein were separated by SDS-PAGE and transferred to a PVDF membrane. The membrane was blocked with 5% skim milk for 1 h and incubated with primary antibodies overnight at 4 °C. After washing three times with TBST, the membrane was incubated with secondary antibodies at room temperature for 1 h and washed again. The blot was visualized using a chemiluminescent detection kit.

[0053] Xenograft tumor models

[0054] Four to six-week-old male BALB / c nude mice were used to construct the xenograft model. 6 HGC27 / NC, HGC27 / shSIN3A, MKN45 / vector, and MKN45 / oeSIN3A cells were suspended in 0.1 mL PBS and injected subcutaneously into nude mice. Tumor growth was detected seven days later and monitored every seven days. Tumor volume (mm3) was determined by measuring the longest diameter (a) and the shortest width (b) and calculated using the following formula: volume (mm 3 )=0.5×a×b 2 .

[0055] Example 1

[0056] The level of SIN3A and survival prognosis of patients

[0057] (1) Subjects: Tumor and adjacent non-tumor tissue specimens were collected from 95 patients with gastric cancer who underwent D2 gastrectomy in the Department of Gastrointestinal Surgery of our hospital. Patients who had received preoperative treatment such as radiotherapy or chemotherapy were excluded from the study. All samples were approved by the Ethics Committee of Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine and obtained with the informed consent of the patients. The general information, tumor grade, survival prognosis and other relevant information of the patients were collected. The public database TCGA-STAD and the previous cohort GSE54129 data of our hospital were used.

[0058] (2) Detection steps: Western blotting, IHC staining, and survival analysis.

[0059] (3) Detection results: The expression of SIN3A in gastric cancer tissues was higher than that in paired normal tissues, and the expression in high-grade tumors was higher than that in low-grade tumors. Patients with high SIN3A expression had a poorer survival prognosis ( Figure 1 AF).

[0060] Example 2

[0061] SIN3A can promote the growth of gastric cancer cells in vitro and in vivo

[0062] (1) Experimental subjects: human gastric cancer AGS cells, SGC7901 cells, GES1 cells, HGC 27 cells, NCI-N87 cells, HS746T cells, MKN45 cells, MGC803 cells and FU97 cells.

[0063] (2) Detection steps: The expression level of SIN3A in gastric cancer cells and immortalized gastric epithelial cells was detected by western blotting, NC / shSIN3A / oeSIN3A cell lines were constructed by lentiviral transfection, cell proliferation was measured by CCK-8 and colony formation assays, GSEA analysis was performed based on the differential expression of SIN3A using the TCGA database, cell cycle was detected by flow cytometry, and nude mouse subcutaneous tumor models of HGC27 / NC, HGC27 / shSIN3A, MKN45 / vector, and MKN45 / oeSIN3A were constructed and their size and weight were measured.

[0064] (3) Detection results: Reduced SIN3A expression significantly inhibited the proliferation of AGS and HGC27 cells, while SIN3A overexpression promoted the proliferation of MKN45 and HS-746T cells. Gene set enrichment analysis (GSEA) showed that the cellular SIN3A level was positively correlated with the cell cycle pathway. Flow cytometry analysis showed that silencing SIN3A led to a decrease in the proportion of cells in the S phase and a significant increase in the proportion of cells in the G1 phase, while SIN3A overexpression promoted the G1 / S transition. The construction of a cell line-derived xenograft (CDX) model found that the tumors formed in the HGC27 / shSIN3A group were significantly smaller than those formed in the HGC27 / NC group (p<0.0001) and had a lower average weight (p=0.0023). Similarly, the tumors formed in the MKN45 / oeSIN3A group were significantly larger than those formed in the MKN45 / vector group (p<0.0001), and the average weight was also higher than that formed in the MKN45 / vector group (p=0.0247). IHC results showed that KI67 expression was downregulated after SIN3A knockdown, while KI67 expression was upregulated after SIN3A overexpression, these findings suggest that SIN3A plays an oncogenic role in GC. Figure 2 AG)

[0065] Example 3

[0066] The SIN3A / HDAC1 complex inhibits KLF4 regulation of downstream cell cycle-related genes by binding to the TSS region. (1) Experimental subjects: human gastric cancer AGS cells.

[0067] (2) Detection steps: AGS / NC and AGS / shSIN3A cell lines were constructed using lentivirus, and KLF4 transcription factor CUT&Tag detection, regulatory gene annotation, KEGG enrichment analysis and differential peak analysis were performed on AGS / NC and AGS / shSIN3A cell lines. ChIP-qPCR was used to detect the binding ability of KLF4 to HDAC1 in AGS / NC and AGS / shSIN3A cell lines, and dual luciferase reporter gene assay was used to find the binding site of KLF4 on HDAC1.

[0068] (3) Detection results: CUT&Tag-seq suggested that the SIN3A / HDAC1 complex inhibited the binding ability of KLF4 to the TSS region. KEGG enrichment analysis of KLF4-binding genes showed that cell cycle-related pathways were significantly enriched in both groups. In AGS / shSIN3A cells, the chromatin open levels of cell cycle-related genes CDC6, BUB3, YWHAZ, HDAC1, MCM3, CDKN2A, CDKN2D, and YWHAE, which were differentially regulated by KLF4, were significantly increased. Compared with AGS / NC, the transcription level of HDAC1 in the AGS / shSIN3A group was significantly downregulated (p<0.05). ChIP-qPCR showed that the binding ability of KLF4 to HDAC1 in the AGS / shSIN3A group was significantly enhanced. When KLF4 / KLF4-MUT1, P300, SIN3A and HDAC1 were co-transfected into HEK293T / HDAC1-WT cells, the transcription level of HDAC1 was significantly increased, but this effect was not found in HEK293T / HDAC1-mut cells, indicating that the mutation site in the HDAC1 promoter region is the binding site of KLF4 ( Figure 3 AN).

[0069] Example 4

[0070] Identify and characterize drugs targeting SIN3A-KLF4 and validate their pharmacokinetic and safety profiles

[0071] (1) Experimental subjects: Chemdiv, database of approved drugs and natural compounds, mice and rats.

[0072] (2) Detection steps: Based on the SIN3A domain, the full-length SIN3A-FLAG plasmid (1-1273aa) and 6 SIN3A-FLAG truncated plasmids were transfected into HEK293T, and the Anti-FLAG IP experiment was used to find the key binding site between SIN3A and KLF4. A computer algorithm was used to simulate the local spatial structure of the SIN3A-KLF4 binding site PAH3. More than 1.5 million drugs were screened from Chemdiv, approved drugs and natural compound databases, and ranked according to their occupancy scores at the PAH3 site. The top 200 drugs and 8 compounds from natural products were verified for their actual inhibitory effect on cell growth, whether they were positively correlated with SIN3A expression, and whether they could inhibit SIN3A-KLF4 binding at effective concentrations. The pharmacokinetics and effective therapeutic dose of C4 were tested by administering C4 to mice through the tail vein.

[0073] (3) Test results: Anti-FLAG IP experiments showed that the PAH3 site is the key binding site for SIN3A and KLF4. The IC50 of C4 in multiple gastric cancer cell lines at 24h was less than 10uM. The anti-cancer effect of C4 was positively correlated with SIN3A expression in AGS, HGC27, MKN45 and Hs-746T. IP experiments showed that C4 inhibited the binding of KLF4 and SIN3A ( Figure 4 After rats were injected with C4 (5 mg / kg) through the tail vein, another substance (preliminarily assumed to be the tautomer of C4) was formed. Compound C4 was quickly cleared from the body and had a short residence time, with a half-life of 0.62 h (Table 1). Acute toxicity tests showed that the effective therapeutic dose concentration of C4 (5 mg / kg) was much lower than the median lethal dose concentration (10 mice were injected with 50 mg / kg C4 through the tail vein, and 0 died, Table 2).

[0074] Table 1 Peak area ratios of tautomers and internal standard of compound 3253-2867 after intravenous injection in rats

[0075]

[0076] Table 2 Acute toxicity study of Compound 3253-2867 in mice

[0077] mg / kg Before treatment After treatment 20 10 10 25 10 10 32 10 10 40 10 10 50 10 10

[0078] Example 5

[0079] In vitro and in vivo experiments confirmed the anti-tumor effect of C3

[0080] (1) Experimental subjects: Human gastric cancer PDO and PDX models.

[0081] (2) Detection steps: 3 GC PDOs and 1 paired non-tumor tissue PDO were used to detect the SIN3A level of PDO and the IC50 of C4. PDX models were constructed using PDOs from two GC patients. 21 days after inoculation, 8 mice with similar tumor volumes were selected and randomly divided into two groups: DMSO group and C4 group (5 mg / kg, 50 μL). In addition, 15 mice with similar tumor volumes were randomly divided into three groups: MOCK group, Vorinostat (5 mg / kg, 50 μL) group and Panobinostat (5 mg / kg, 50 μL). The drugs were administered once every 3 days for a total of 5 times. Mice were killed 35 days after administration, the tumor weight was weighed, and IHC staining was performed on the mice.

[0082] (3) Test results: The results of PDO and PDX experiments showed that C4 can effectively inhibit the growth of gastric cancer tumors. As the expression level of SIN3A increased, gastric cancer PDOs became more sensitive to C4. Immunohistochemistry of SIN3A and KI67 showed that PDX1 and PDX2 expressed SIN3A, and C4 reduced the proportion of KI67-positive cells in PDXs. The inhibitory effect of C4 was compared with that of conventional HDAC inhibitors, and the results showed that the inhibitory effect of C4 on GC cells was stronger than that of Vorinostat and weaker than that of Panobinostat. Vorinostat had almost no inhibitory effect in PDX, while Panobinostat significantly inhibited tumor growth. Taking all factors into consideration, the inhibitory effect of C4 on GC PDX is not inferior to that of Vorinostat and Panobinostat ( Figure 5 AK).

Claims

1. Use of compound C4 in the preparation of a drug for treating gastric cancer, characterized in that: The structural formula of the compound C4 is:

2. The use according to claim 1, characterized in that: The compound C4 inhibits cell proliferation by effectively targeting KLF4-SIN3A binding.

3. The use according to claim 1, characterized in that: The medicine further comprises a pharmaceutically acceptable carrier and / or excipient.

4. The use according to claim 3, characterized in that: The pharmaceutically acceptable carrier and / or excipient includes at least one of a diluent, a binder, a surfactant, a wetting agent, an adsorption carrier, a lubricant, a filler, and a disintegrant.

5. The use according to claim 1, characterized in that: The dosage form of the drug includes at least one of tablets, pills, powders, solutions, suspensions, emulsions, and granules.

6. The use according to claim 1, characterized in that: The effective therapeutic dosage concentration of the drug is 5 mg / kg.

7. The use according to claim 1, characterized in that: The administration method of the drug includes intravenous injection.

Images