Microorganism, microbial agent and application thereof

Abstract

The invention discloses a microorganism, a microbial agent and application thereof. The microorganism is Candida sp. And is preserved in the China General Microbiological Culture Collection Center (CGMCC) on May 27, 2024, and the preservation number is CGMCC No.30793. The invention further discloses a preparation method of the Candida sp. The new candida strain obtained through screening is high in growth speed, salt resistance and acid resistance, capable of inhibiting growth of pathogenic bacteria and high in nitrate metabolism capacity, and a food or feed production method developed through the new strain and the microbial agent is high in salt tolerance, high in fermentation efficiency, short in production period and suitable for industrial production. Fermented food prepared from the new strain is rich in saccharomycetes content, low in nitrate content, nutritional, healthy and unique in flavor.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to microorganisms, microbial agents and applications thereof. Background Art

[0002] Traditional fermented peppers rely on microorganisms attached to the surface of food raw materials for fermentation, and salt is usually added to reduce the water activity of peppers, inhibit the growth of spoilage bacteria, extend the shelf life of peppers, and improve the flavor of peppers. With the global advocacy of a low-sodium diet, reduced-salt fermentation has received more and more attention. Reduced-salt fermented peppers usually add 5 to 12% salt, but during the fermentation process, most yeasts still cannot avoid the reduction in the number of viable bacteria caused by salt stress. As a result, under natural fermentation conditions, microorganisms grow slowly and the production cycle of fermented foods is long, making it difficult to meet the needs of large-scale production of reduced-salt fermented foods.

[0003] Therefore, screening yeasts with good salt resistance, acid resistance and good fermentation performance is of great significance for the development of salt-reduced fermented foods and their fermentation processes. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art to a certain extent. To this end, the present invention provides a microorganism Candida sp., a microbial agent and an application thereof. The new strain of Candida sp. screened by the present invention has a fast growth rate, strong salt and acid resistance, can inhibit the growth of pathogens, and has a strong ability to metabolize nitrates. The production method of food or feed developed using the new strain and microbial agent of the present invention has high salt tolerance, high fermentation efficiency, and a short production cycle. The fermented food prepared using the new strain has rich yeast content, low nitrate content, and is nutritious, healthy, and has a unique flavor.

[0005] In a first aspect of the present invention, the present invention provides a microorganism. According to an embodiment of the present invention, the microorganism is Candida sp., which was deposited in the General Microbiological Center of China Microorganism Culture Collection Administration on May 27, 2024, with a deposit number of CGMCC No.30793.

[0006] Collection information:

[0007] Strain name: FVPHBJ24143

[0008] Classification: Candida sp.

[0009] Date of deposit: May 27, 2024

[0010] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0011] Storage address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101

[0012] Deposit number: CGMCC No.30793

[0013] The new strain of Candida sp. FVPHBJ24143 screened by the present invention has a fast growth rate, strong salt and acid resistance, can inhibit the growth of pathogens, and has a strong ability to metabolize nitrate. The production method of food or feed developed by using the new strain and microbial agent of the present invention has high salt tolerance, high fermentation efficiency, and short production cycle. The fermented food prepared by using the new strain has rich yeast content, low nitrate content, and is nutritious, healthy, and unique flavor.

[0014] In a second aspect of the present invention, the present invention provides a microbial agent. According to an embodiment of the present invention, the microorganism is included.

[0015] Those skilled in the art will appreciate that the features and advantages described above for microorganisms are also applicable to the microbial agent and will not be described in detail here.

[0016] In the third aspect of the present invention, the present invention proposes a food additive or feed additive. According to an embodiment of the present invention, it includes the aforementioned microorganisms. The food additive or feed additive according to the embodiment of the present invention can be used to adjust the acidity of food or feed, improve food flavor characteristics, reduce nitrate content in the product, improve product quality, adjust the yeast content in food or feed, and can also effectively inhibit the growth of pathogens such as Staphylococcus aureus and Escherichia coli, thereby improving product safety.

[0017] In a fourth aspect of the present invention, the present invention provides a food or feed. According to an embodiment of the present invention, the food comprises: at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives; the feed comprises: at least one of the aforementioned microorganisms, the aforementioned microbial agents, and the aforementioned feed additives.

[0018] Those skilled in the art will appreciate that the features and advantages described above for microorganisms, microbial agents, food additives or feed additives are also applicable to the food or feed and will not be elaborated herein.

[0019] In the fifth aspect of the present invention, the present invention proposes the use of the aforementioned microorganisms, the aforementioned microbial agents, the aforementioned food additives or feed additives in the preparation of food or feed.

[0020] Those skilled in the art will appreciate that the features and advantages described above for microorganisms, microbial agents, food additives or feed additives are also applicable to this use and will not be described in detail here.

[0021] In a sixth aspect of the present invention, the present invention provides a method for preparing food or feed. According to an embodiment of the present invention, the method comprises: fermenting at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives or feed additives with food raw materials or feed raw materials to obtain the food or feed. The preparation method according to the embodiment of the present invention has high salt tolerance, high fermentation efficiency, short production cycle, and high application value.

[0022] In the seventh aspect of the present invention, the present invention provides a method for inhibiting the growth of pathogens in vitro. According to an embodiment of the present invention, the aforementioned microorganism, the aforementioned microbial agent, or the aforementioned food additive or feed additive is co-cultured with a sample containing pathogens. According to the method of the embodiment of the present invention, Candida FVPHBJ24143 has the effect of inhibiting the growth of Staphylococcus aureus and Escherichia coli, and can be used to inhibit the growth of pathogens in vitro. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0024] Figure 1 The morphological identification result of Candida CGMCC No.30793 in Example 2 of the present invention;

[0025] Figure 2 is the growth curve of Candida CGMCC No.30793 in Example 3 of the present invention;

[0026] Figure 3 The absorbance values ​​(OD) of Candida CGMCC No.30793 before and after culture in different pH medium in Example 3 of the present invention are 600 ) Investigation results;

[0027] Figure 4 The results of the investigation of the number of viable bacteria of Candida CGMCC No.30793 in culture medium with different pH values ​​in Example 3 of the present invention are as follows;

[0028] Figure 5 The absorbance values ​​(OD) of Candida albicans CGMCC No. 30793 before and after culture in medium containing different salt concentrations in Example 3 of the present invention are 600 ) Investigation results;

[0029] Figure 6The results of the investigation of the number of viable bacteria of Candida CGMCC No.30793 in Example 3 of the present invention in culture medium containing different salt concentrations;

[0030] Figure 7 The viable bacteria count in the process of preparing fermented vegetables using Candida CGMCC No.30793 vegetable starter in Example 4 of the present invention;

[0031] Figure 8 This is the result of the investigation on the growth inhibition of Escherichia coli by Candida CGMCC No.30793 during the vegetable fermentation process in Example 5 of the present invention;

[0032] Fig. 9 The results of the investigation on the growth inhibition of Staphylococcus aureus by Candida CGMCC No.30793 during the vegetable fermentation process in Example 5 of the present invention are as follows;

[0033] Fig.10 This is the result of investigating the ability of Candida CGMCC No. 30793 to metabolize nitrate in Example 6 of the present invention. DETAILED DESCRIPTION

[0034] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0035] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0036] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention but not excluding other contents.

[0037] As used herein, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0038] Terms and Definitions

[0039] In this article, the term "YPD medium" refers to a yeast culture medium, which contains yeast extract, peptone and glucose. Depending on the content of the coagulant (usually agarose), it is divided into two types: YPD solid culture medium and YPD liquid culture medium.

[0040] As used herein, the term "Candida" refers to a yeast belonging to the genus Candida, class Blastomycetes, order Cryptococcates, family Cryptococcaceae, phylum Ascomycota, with a creamy, smooth, milky white colony and pseudohyphae.

[0041] In this article, the term "NaNO3" refers to nitrate, which is added to the culture medium to test the ability of the strain to metabolize nitrate.

[0042] In this article, the term “OD 600 " is a standard method for determining bacterial concentration, in which the number of bacteria is estimated by comparing the turbidity of the bacterial suspension with a standard curve.

[0043] The present invention provides a microorganism, a microbial agent, a food additive or a feed additive and its use, a method for preparing food or feed, and a method for inhibiting the growth of pathogenic bacteria in vitro, which will be described in detail below.

[0044] Bacteria

[0045] The present invention proposes a microorganism. According to an embodiment of the present invention, the microorganism is Candida avidus, which was deposited in the General Microbiological Center of China National Microbiological Culture Collection Committee on May 27, 2024, with a deposit number of CGMCC No. 30793.

[0046] According to an embodiment of the present invention, the 16S rDNA sequencing result of the microorganism is shown as SEQ ID NO:1.

[0047] The new Candida strain screened by the present invention has a fast growth rate, strong salt and acid resistance, can inhibit the growth of pathogens, and has a strong ability to metabolize nitrate. The production method of food or feed developed using the new strain and microbial agent of the present invention has high salt tolerance, high fermentation efficiency, and short production cycle. The fermented food prepared using the new strain has rich yeast content, low nitrate content, and is nutritious, healthy, and unique flavor.

[0048] Herein, the terms "Candida sp. FVPHBJ24143", "Candida sp. FVPHBJ24143", and "Candida sp. CGMCC No. 30793" are synonymous.

[0049] Microbial Agents

[0050] The present invention provides a microbial agent, which includes the aforementioned microorganisms according to an embodiment of the present invention.

[0051] Those skilled in the art will appreciate that the features and advantages described above for microorganisms are also applicable to the microbial agent and will not be described in detail here.

[0052] It should be noted that the microbial agent of the present invention may be a liquid microbial agent, including but not limited to fermentation products, etc.; it may also be a solid microbial agent, including but not limited to freeze-dried powder, etc.

[0053] It should be noted that, in the microbial agent of the present invention, the Candida CGMCC No. 30793 exists in the form of living cells and / or non-living cells.

[0054] As used herein, "living cells" refer to cells that have the ability to metabolize, reproduce or replicate.

[0055] Exemplarily, the living cells may be immobilized cells. Herein, "immobilized cells" refer to living cells that are fixed on a carrier and can carry out life activities such as growth, development, reproduction, inheritance and metabolism within a certain spatial range.

[0056] In this article, "non-living cells" refer to cells that do not have the ability to metabolize, reproduce and replicate, including but not limited to dry bacteria. Exemplarily, the microbial agent is a freeze-dried powder.

[0057] In some specific embodiments, the Candida CGMCC No. 30793 exists in the form of living cells, dried bacteria, immobilized cells or any other forms.

[0058] In some specific embodiments, the dry bacteria are obtained by freeze-drying the Candida CGMCC No. 30793.

[0059] In some specific embodiments, the microbial agent may also contain strains acceptable to food and feed.

[0060] In some specific embodiments, the microbial agent further includes an auxiliary material or carrier acceptable in food, or an auxiliary material or carrier acceptable in animal feed.

[0061] As used herein, "acceptable in food" refers to substances or compositions that can be consumed by humans, which may be adjusted according to the food requirements of different countries.

[0062] In this context, "adjuvant or carrier acceptable in animal feed" refers to a substance or composition that can be consumed by animals, which may be adjusted according to the animal feed requirements of different countries.

[0063] Food additives or feed additives

[0064] The present invention provides a food additive or feed additive. According to an embodiment of the present invention, the aforementioned microorganism is included. The food additive or feed additive according to the embodiment of the present invention can be used to adjust the acidity of food or feed, improve food flavor characteristics, reduce nitrate content in the product, improve product quality, adjust yeast content in food or feed, and effectively inhibit the growth of pathogens such as Staphylococcus aureus and Escherichia coli, thereby improving product safety.

[0065] Food or feed

[0066] The present invention provides a food or feed. According to an embodiment of the present invention, the food includes: at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives; the feed includes: at least one of the aforementioned microorganisms, the aforementioned microbial agents, and the aforementioned feed additives.

[0067] Those skilled in the art will appreciate that the features and advantages described above for microorganisms, microbial agents, food additives or feed additives are also applicable to the food or feed and will not be elaborated herein.

[0068] According to an embodiment of the present invention, the food or feed may further include an auxiliary material or carrier acceptable to the food or feed, thereby further obtaining a food or feed product with healthy nutrition and unique flavor.

[0069] In some specific embodiments, the aforementioned microorganisms, the aforementioned microbial agents or the aforementioned food additives are added or inoculated into food or feed.

[0070] Exemplarily, the food includes but is not limited to: fermented peppers, fermented cabbage, fermented cucumbers, and fermented radishes.

[0071] use

[0072] The present invention proposes the use of the aforementioned microorganism, the aforementioned microbial agent, the aforementioned food additive or feed additive in the preparation of food or feed.

[0073] Those skilled in the art will appreciate that the features and advantages described above for microorganisms, microbial agents, food additives or feed additives are also applicable to this use and will not be described in detail here.

[0074] Method for preparing food or feed

[0075] The present invention provides a method for preparing food or feed. According to an embodiment of the present invention, the method comprises: fermenting at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives or feed additives with food raw materials or feed raw materials to obtain the food or feed. The preparation method according to the embodiment of the present invention has high salt tolerance, high fermentation efficiency, short production cycle, and high application value.

[0076] According to an embodiment of the present invention, before fermentation, the food raw material or feed raw material is mixed with sodium chloride, and the amount of sodium chloride added is 5-25wt%, preferably 5-20wt%, based on the mass of the food raw material or feed raw material.

[0077] According to an embodiment of the present invention, the pH of the fermentation treatment is 2.5-6.5, preferably 3-6, and more preferably 4-6.

[0078] The amount of sodium chloride added and pH treatment conditions during the fermentation process are further optimized to obtain better quality food or feed products.

[0079] Method for inhibiting the growth of pathogenic bacteria in vitro

[0080] The present invention provides a method for inhibiting the growth of pathogens in vitro. According to an embodiment of the present invention, the aforementioned microorganism, the aforementioned microbial agent, or the aforementioned food additive or feed additive is co-cultured with a sample containing pathogens. According to the method of the embodiment of the present invention, Candida FVPHBJ24143 has the effect of inhibiting the growth of Staphylococcus aureus and Escherichia coli, and can be used to inhibit the growth of pathogens in vitro.

[0081] According to an embodiment of the present invention, the pathogenic bacteria include: at least one of Staphylococcus aureus and Escherichia coli.

[0082] The method according to the embodiment of the present invention can effectively inhibit the growth of the above-mentioned pathogens.

[0083] Unless otherwise specified, the formula of the YPD solid culture medium used in the embodiments of the present invention is: 20 g of peptone, 10 g of yeast extract, 20 g of glucose, 10 g of agar, and 1 L of distilled water.

[0084] Unless otherwise specified, the formula of the YPD liquid culture medium used in the embodiments of the present invention is: 20 g of peptone, 10 g of yeast extract, 20 g of glucose, and 1 L of distilled water.

[0085] Unless otherwise specified, the formulas of the enrichment medium (EM) and nitrate medium (NM) used in the embodiments of the present invention are shown in Table 1. After the preparation, the pH of the medium is adjusted to 7.0-7.3. The configuration of the added trace elements is shown in Table 2.

[0086] Table 1 Composition of enriched medium (EM) and nitrate medium (NM)

[0087]

[0088]

[0089] Table 2 Trace element composition

[0090] Element Content (g / L) Element Content (g / L) FeCl3·6H2O 1.50 ZnSO4·7H2O 0.12 H3BO3 0.15 KI 0.18 CuSO4·5H2O 0.03 MnCl2·4H2O 0.12 Na2MoO4·2H2O 0.06 CoCl2·6H2O 0.15 Disodium EDTA 10.00 NaHCO3 3.00

[0091] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0092] Example 1: Acquisition of Candida CGMCC No.30793

[0093] The Candida CGMCC No. 30793 of the invention is separated and obtained from the naturally fermented chili sauce of Hebei Province.

[0094] The collection and isolation process of the strain: take naturally fermented chopped pepper and add it to sterilized physiological saline, mix it well and then dilute it and spread it on YPD solid culture medium, and culture it at pH 6.0±0.2 and 30°C for 24 to 48 hours. Pick out single colonies of different sizes and shapes and streak them on fresh YPD solid culture medium plates, and culture them at 30°C for 24 to 48 hours. Repeat the streak purification culture several times until the colonies in the plate are consistent in morphology. After no foreign bacteria are found under microscopic examination, the strain is named FVPHBJ24143 and identified.

[0095] Obtaining bacterial solution: Use an inoculation loop to pick up a single colony and place it in YPD liquid medium, and culture at 37°C until the bacterial solution OD 600 =1.0~1.5, the strain is preserved.

[0096] Preservation of strains: 600 =1.0~1.5 bacterial solution and sterile 50% glycerol were mixed in a freezing tube at a ratio of 1:1 and stored at -80℃.

[0097] Example 2: Identification of Candida CGMCC No.30793

[0098] The culture separated and purified in Example 1 was further confirmed to be a pure culture by streaking and smear microscopy, and then the strain morphology and physiological and biochemical identification, 16S rDNA gene PCR amplification and sequencing analysis were performed.

[0099] 1. Morphological and physiological and biochemical identification

[0100] Refer to the Manual of Identification of Common Fungal Systems to identify the strains to be tested by morphological characteristics, physiological and biochemical properties, etc.

[0101] The morphological identification results are shown in Figure 1 .

[0102] The identification results showed that the colony morphology of strain FVPHBJ24143 on YPD agar medium was characterized by a creamy, smooth, milky white colony with pseudohyphae ( Figure 1 ), the final pH was 3.0 in YPD liquid medium.

[0103] 2. PCR amplification and sequencing analysis of 16S rDNA gene

[0104] The strain FVPHBJ24143 was identified by 16S rDNA sequence. PCR amplification conditions: 95℃ pre-denaturation for 10min, followed by 30 cycles: 94℃ denaturation for 30s, 56℃ annealing for 30s, 72℃ extension for 1.5min (1kb / min), 72℃ post-extension for 5min; stored at 4℃. The obtained PCR products were detected by 1% agarose gel electrophoresis. The PCR reaction system is shown in Table 3.

[0105] Table 3 PCR reaction system

[0106] PCR reaction system composition Volume (μL) Primer 27F (10 μmol / L) 2 Primer 1492R (10 μmol / L) 2 2×Gold Star Best Mixed 25 DNA template 2 <![CDATA[ddH2O]]> 19 Total volume 50

[0107] The strain FVPHBJ24143 was sent to Shanghai Sangon Biotech Co., Ltd. for 16S rDNA sequence detection. The measured sequence was compared in GenBank, and the phylogenetic tree was constructed using MEGA11.0.13 for the strain to be tested and other strains in the genus.

[0108] The results showed that the isolated strain FVPHBJ24143 was in the same branch as other strains of Candida, and had a 99% homology with the 16S rDNA sequence of Unclassifed Saccharomycetales, [Candida] sp.

[0109] Combined with the results of physiological and biochemical identification, the strain FVPHBJ24143 was further confirmed to be Candida, and the sequence accession number was CGMCC No.30793.

[0110] The final identification confirmed that the isolated strain FVPHBJ24143 was a strain of Candida, named Candida FVPHBJ24143 (hereinafter referred to as "Candida CGMCC No.30793"), which was deposited in the "General Microbiology Center of China National Microbiological Culture Collection Administration" on May 27, 2024, with the deposit number CGMCC No.30793.

[0111] The 16S rDNA sequencing result of Candida albicans CGMCC No.30793 is shown in SEQ ID NO:1.

[0112] CTTCCGTAGGGGTGAACCTGCGGAAGGATCATTACTGAAAAACAAAAAACTTGTTTTTGTTTGAACAAACTTAACCAAACATTTTATTTTGCATTCTACGAATGAAATCTATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCACCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGACTTGCAGACGTGAAT CATCGAATCTTTGAACGCACCTTGCGCCCTGGTCATGCCAGGGCATGCCTGTTTGAGCGGAGTTCTTCTCAAACCTTACGGTTTTGGTTTTGAAGACTTAAATATAGCTGCTGTATAATTAAACTAATACAGATTCTATTCCCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAA(SEQ ID NO:1)

[0113] Example 3: Investigation of growth characteristics, acid production ability, acid resistance and salt resistance of Candida CGMCC No.30793

[0114] Examination of the basic characteristics of the strains, such as growth characteristics, acid production capacity, acid resistance, and salt resistance, can help to screen out microbial strains with potential for specific applications.

[0115] In this example, the experimental strains were prepared as follows: Candida CGMCC No. 30793 was streaked on a YPD agar plate for 24 to 48 hours, and a single colony was picked and grown in a YPD liquid medium for 16 to 20 hours for activation to obtain an activated strain.

[0116] 1. Investigation of strain growth characteristics and acid production capacity

[0117] The activated strain was inoculated into YPD liquid medium at 1% inoculation rate, and cultured at 30°C. The absorbance value was measured at 600nm every 1h until the stable period. The growth curve was drawn with the culture time as the horizontal axis and the corresponding absorbance value as the vertical axis ( Figure 2 ).

[0118] The results showed that: (1) In the first 24 hours of culture, Candida CGMCC No.30793 was in the growth adaptation period, with slow growth and metabolism; after 24 hours, it entered the logarithmic growth period. (2) The pH of the bacterial solution was basically maintained below 4.0 when it reached the stable period.

[0119] 2. Investigation of acid resistance of strains

[0120] The activated strain was inoculated into YPD liquid medium with different pH values ​​(pH values ​​were 5.0, 4.5, 4.0, 3.5, 3.0, and 2.5) at a 1% inoculum, and cultured at 30°C for 24 h. The absorbance values ​​(OD) at 600 nm of the activated strain before and after culture in the medium with different pH values ​​were measured. 600 )( Figure 3 The number of live yeast cells before and after the activated strain culture was determined using the culturable bacteria determination method ( Figure 4 ).

[0121] The results showed that Candida albicans CGMCC No.30793 had a high tolerance to acid. When the pH value of YPD liquid medium was 4-5, it grew well; when the pH value dropped to 3.0, it still maintained a high survival rate, and the number of viable bacteria was maintained at 10 6 CFU / g and above.

[0122] 3. Investigation of salt tolerance of strains

[0123] The activated strains were inoculated into YPD liquid medium containing different NaCl concentrations (0%, 4%, 8%, 10%, 15%, 20%, 25%) at a 1% inoculum and cultured at 3°C ​​for 24 h. The absorbance values ​​(OD 600 )( Figure 5 ), and the culturable bacteria determination method was used to determine the number of live yeast cells before and after the activated strain was cultured ( Figure 6 ).

[0124] The results showed that Candida albicans CGMCC No.30793 could still grow in YPD liquid medium with a salt concentration greater than 20%; in YPD liquid medium with a salt concentration of 25%, the number of viable bacteria was maintained at 10 6 CFU / g and above.

[0125] 4. Comparative study on salt tolerance of Candida albicans CGMCC No.30793 and known Candida albicans

[0126] The inventors collected and sorted out the data on the salt tolerance of Candida known in existing patents, as shown in Table 4.

[0127] Table 4 Salt tolerance of Candida in patents

[0128] Patent Number Salt tolerance (%) years CN202110674420.8 5-15 2021 CN202010578543.7 10-12 2020 CN201811617006.8 ≤5 2018 CN201611248784.5 1-5 2016

[0129] The results show that the salt tolerance of the Candida CGMCC No. 30793 in the present invention is 20%, which is higher than the known Candida involved in the currently disclosed patents.

[0130] Example 4: Application of Candida CGMCC No.30793 in the preparation of fermented vegetable food

[0131] The metabolic activities of specific microorganisms can increase the nutritional value and flavor of fermented foods and extend their shelf life.

[0132] In this embodiment, fermented vegetables were prepared using Candida CGMCC No.30793, and the specific method is as follows:

[0133] 1. Preparation of Candida CGMCC No.30793 starter

[0134] Candida CGMCC No.30793 was streaked on a YPD agar medium plate for 24 to 48 hours, and a single colony was picked and grown in a YPD liquid medium for 16 to 20 hours for activation. The activated Candida CGMCC No.30793 was inoculated into a YPD liquid medium at a 1% inoculum volume for 16 to 20 hours of expansion culture, and the bacterial solution was centrifuged, washed with sterile distilled water until no culture medium remained, and resuspended in sterile distilled water to a bacterial density of 1×10 10 ~1×10 11 CFU / mL, that is, Candida CGMCC No.30793 starter culture.

[0135] 2. Preparation of fermented vegetables

[0136] Take 50.0kg of fresh vegetables, select, wash, drain, and after crushing or not, add 4.5-7.5kg of salt and stir evenly, the amount of salt added accounts for 8%-12% of the total weight of fresh vegetables, inoculate 1% of the total weight of vegetables with Candida CGMCC No.30793 fermentation agent, and ferment at room temperature for 30 days in a sealed container to obtain fermented vegetables made with Candida CGMCC No.30793 as a fermentation agent. The number of live bacteria in the whole fermentation process is investigated, and the results are shown in Figure 7 .

[0137] The results showed that during the whole vegetable fermentation process, the number of viable bacteria of Candida CGMCC No.30793 remained at 10 5 CFU / mL and above.

[0138] For example, vegetables suitable for making fermented vegetables using Candida CGMCC No. 30793 include, but are not limited to, peppers, cabbages, cucumbers, radishes, and the like.

[0139] Example 5: Investigation of antibacterial properties of Candida CGMCC No.30793

[0140] Staphylococcus aureus is an important food-borne pathogen, widely distributed in nature, including human skin surface, respiratory tract, digestive tract, etc., and can produce enterotoxins under appropriate conditions, causing food poisoning. In the field of food preparation, it is very important to control the growth of Staphylococcus aureus and prevent it from producing toxins. In the field of food preparation, Escherichia coli can be used as an indicator of fecal contamination to reflect the sanitary conditions of food or water. In this embodiment, the antibacterial properties of Candida albicans CGMCC No.30793 to Escherichia coli and Staphylococcus aureus were investigated as follows.

[0141] 1. Inhibit the growth of E. coli

[0142] Add 200μl of distilled water and 10μl of Candida CGMCC No.30793 fermentation broth supernatant to wells A1-F1 of the 96-well plate, mix well, and add 100μl of LB medium to each of the remaining wells. Pipette 100μl of the mixture from wells A1-F1 and add it to wells A2-F2 and mix well. Pipette 100μl from wells A2-F2 and add it to wells A3-F3 and mix well. Repeat this process until wells A10-F10.

[0143] Take the cultured E. coli and use sterile water to prepare a bacterial suspension with a concentration equivalent to 0.5 McFarland turbidity standard. After diluting it with LB medium at 1:1000, add 100 μL of bacterial suspension to wells 1-10 and well 12 in each row and mix well. Place in a 37°C incubator and incubate for 16-20 hours. Measure the OD value every 1 hour until the bacterial density is basically stable and stop measuring.

[0144] The results showed that Candida CGMCC No.30793 could inhibit the growth of E. coli. Within 12 to 24 hours of observation, the concentration of E. coli in the experimental group was significantly lower than that in the control group ( Figure 8 ).

[0145] 2. Inhibit the growth of Staphylococcus aureus

[0146] Add 200μl of distilled water and 10μl of fermentation supernatant to wells A1-F1 of the 96-well plate and mix well. Add 100μl of LB medium to each of the remaining wells. Pipette 100μl of the mixture from wells A1-F1 and add it to wells A2-F2 and mix well. Pipette 100μl from wells A2-F2 and add it to wells A3-F3 and mix well. Repeat this process until wells A10-F10.

[0147] Take the cultured Staphylococcus aureus and use sterile water to prepare a bacterial suspension with a concentration equivalent to 0.5 McFarland turbidity standard. After diluting it with LB medium at 1:1000, add 100 μL of bacterial suspension to wells 1-10 and well 12 in each row and mix well. Place in a 37°C incubator and incubate for 16-20 hours. Measure the OD value every 1 hour until the bacterial density is basically stable and stop measuring.

[0148] The results showed that Candida CGMCC No.30793 could inhibit the growth of Staphylococcus aureus. Within 12 to 24 hours of observation, the concentration of Staphylococcus aureus in the experimental group was significantly lower than that in the control group ( Fig. 9 ).

[0149] Example 6: Investigation of the ability of Candida CGMCC No.30793 to metabolize nitrate

[0150] In the food industry, controlling the levels of nitrate and nitrite is crucial for food safety. The Candida CGMCC No. 30793 of the present invention is often used in the preparation of fermented foods. Therefore, this example investigates the ability of Candida CGMCC No. 30793 to metabolize nitrate. The specific investigation method is as follows.

[0151] 1. Strain Preparation

[0152] The Candida CGMCC No.30793 strain stored at -80°C was inoculated into a conical flask containing 100 mL of enrichment medium (EM) and shaken in a constant temperature shaker at 25°C and 160 rpm for 24 hours for activation culture. After the activation culture was completed, the cell density was adjusted to about 2.0 (i.e., OD 600 =2.0), and obtain OD 600 =2.0 bacterial suspension.

[0153] 2. Investigation of the ability of strains to metabolize nitrate

[0154] Pipette 1mL OD 600 =2.0 bacterial suspension into a new 99mL EM conical flask, take the EM without bacterial suspension as blank control, shake well, measure its OD value at 600nm, measure the OD value at 600nm every 1h until the bacterial density is basically stable and stop measuring. 600 = 2.0 bacterial suspension was added to a new 95 mL nitrate medium (NM) conical flask, and the changes in nitrate content were analyzed to determine the ability of the strain to metabolize nitrate. The above experiments all included blank controls and three parallel groups.

[0155] The results showed that after the Candida CGMCC No.30793 culture reached the stable period, the NaNO3 metabolism was maintained above 70 mg / L ( Fig.10 ), and has a strong ability to metabolize nitrate.

[0156] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A microorganism, characterized in that The microorganism is Candida sp., which was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on May 27, 2024, with the deposit number CGMCC No.30793.

2. A microbial agent, characterized in that: The microorganism according to claim 1.

3. A food additive or feed additive, characterized in that: The microorganism according to claim 1.

4. A food or feed, characterized in that The food comprises: at least one of the microorganisms according to claim 1, the microbial agent according to claim 2, or the food additive according to claim 3; the feed comprises: at least one of the microorganisms according to claim 1, the microbial agent according to claim 2, and the feed additive according to claim 3.

5. The food or feed according to claim 4, characterized in that It further includes auxiliary materials or carriers acceptable to food or feed.

6. Use of the microorganism according to claim 1, the microbial agent according to claim 2, or the food additive or feed additive according to claim 3 in the preparation of food or feed.

7. A method for preparing food or feed, characterized in that include: The food or feed is obtained by fermenting at least one of the microorganism according to claim 1, the microbial agent according to claim 2, or the food additive or feed additive according to claim 3 with a food raw material or a feed raw material.

8. The method according to claim 7, characterized in that Before fermentation, the food raw material or feed raw material is mixed with sodium chloride, and the amount of sodium chloride added is 5 to 25 wt%, preferably 5 to 20 wt%, based on the mass of the food raw material or feed raw material; Optionally, the pH of the fermentation treatment is 2.5-6.5, preferably 3-6, more preferably 4-6.

9. A method for inhibiting the growth of pathogenic bacteria in vitro, characterized in that: include: The microorganism according to claim 1, the microbial agent according to claim 2, or the food additive or feed additive according to claim 3 is co-cultured with a sample containing pathogenic bacteria.

10. The method according to claim 9, characterized in that The pathogenic bacteria include: at least one of Staphylococcus aureus and Escherichia coli.

Images