Culture medium and culture method of araliaceae plant embryonic stem cells and method for producing saponin at high yield by using araliaceae plant embryonic stem cells

Abstract

The invention discloses a culture medium and a culture method of araliaceae plant embryogenic stem cells and a method for producing saponin at high yield by using the araliaceae plant embryogenic stem cells. The culture medium comprises a basic culture medium, and 200 mg / L-500 mg / L of cerium nitrate is added into the basic culture medium; the basic culture medium is selected from one of an MS culture medium and a B5 culture medium. The MS culture medium is further added with amphotericin B with the concentration of 0.8 to 1.3 mg / L and double antibodies with the mass concentration of 0.9 to 1.2 percent, and the double antibodies are 100X mycillin mixed liquor, 6-BA with the concentration of 0.8 to 1.2 mg / L and NAA with the concentration of 0.8 to 1.3 mg / L; or 0.098 mg / L to 0.120 mg / L of 6-BA, 13 mg / L to 18 mg / L of cane sugar, 0.48 mg / L to 0.52 mg / L of methyl jasmonate and 0.099 mg / L to 0.130 mg / L of triacontanol are also added into the B5 culture medium. The cerous nitrate is added into the culture medium of the araliaceae plant embryonic stem cells, the culture of the araliaceae plant embryonic stem cells is obviously promoted, and the culture quantity of the embryonic stem cells can be obviously increased, so that efficient and rapid culture is realized, and the culture medium has universality.

Description

Technical Field

[0001] The invention belongs to the technical field of plant tissue culture, and in particular relates to a culture medium and a culture method for embryonic stem cells of Araliaceae plants and a method for high-yield saponin. Background Art

[0002] Araliaceae plants are dicotyledonous plants, mostly trees, shrubs or woody vines, rarely perennial herbs, with or without thorns. Araliaceae plants have many economic uses. Many species have important economic significance in medicine, such as ginseng, Panax notoginseng, Acanthopanax, Aralia, and edible earth angelica, which are famous medicinal materials; Schefflera, Schefflera, White balsam, Red hair Acanthopanax, Acanthopanax, Sessile Acanthopanax, Yellow hair Aralia, Liaodong Aralia, Tiger thorn Aralia, Tree ginseng, Variable leaf tree ginseng, Acer serrata, Short stem Acer serrata, Thorny grass, Luo umbrella, Big ginseng, Palm leaf Liangwang tea, Apostichopus, Polygonum, Five leaf ginseng, Ivy, etc. are commonly used Chinese herbal medicines in the folk. Some species such as Acanthopanax, Acanthopanax, etc. have seeds containing oil and can be pressed for soap making. Some species such as Acanthopanax, Acanthopanax, and edible earth angelica have tender leaves that can be used as vegetables. Types of trees: their wood has various uses. The thorny wood can be used to make furniture and railway sleepers, the Schefflera arborvitae is suitable for making steamers and sieves, and the pith of the wood can be used to make handicrafts. Some species have beautiful crowns or branches and leaves, such as the umbrella maple, Schefflera arborvitae, and ivy, which are often cultivated for ornamental purposes. Schefflera arborvitae is a nectar plant in the south in winter.

[0003] At present, the utilization of Araliaceae plants has increased significantly, so the rapid propagation of Araliaceae plants is an urgent problem to be solved. Most of the current propagation methods are still based on traditional sowing and then transplanting, which is inefficient. Although callus induction technology has been used, it is still limited by the callus itself and cannot be applied to large-scale production.

[0004] Plant embryonic stem cells (PESC) are undifferentiated cells with eternal vitality in plants, mainly located in the plant's stem apical meristem, root apical meristem and vascular cambium. PESC is the source of plant vitality, allowing plants to grow continuously for hundreds of years. Plant embryonic stem cells are the most primitive omnipotent stem cells in plants, and have huge advantages over plant cambium (CMC) stem cells. Plant embryonic stem cells are undifferentiated, have strong division ability, extremely high cell proliferation rate, extremely high cell activity, and high and stable content of secondary metabolic components; plant cambium stem cells are also derived from embryonic stem cells and have achieved initial differentiation. Relatively speaking, they have weak division ability, low cell proliferation rate and cell activity, and secondary metabolic components will decrease from generation to generation. Therefore, it is necessary to develop plant embryonic stem cell technology to adapt to large-scale production.

[0005] In addition, saponin is a type of glycoside whose aglycone is triterpenoid or spirosterane compound, most of which have antibacterial, antipyretic, sedative, anticancer, hypoglycemic, hypotensive, cardiovascular and renal function improvement, immunity enhancement and other functions. Ginsenoside is a steroid compound, also known as triterpenoid saponin. It is mainly found in ginseng medicinal materials. Ginsenoside is regarded as the active ingredient in ginseng, with multiple active functions, and thus becomes the target of research. Therefore, how to quickly and efficiently produce saponins of Araliaceae plants, especially active ingredient products such as ginsenoside, is of great significance.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies of the prior art and provide a culture medium, a culture method and a method for high production of saponins of embryonic stem cells of Araliaceae plants. The culture medium of the present invention adds cerium nitrate, which has a significant promoting effect on the culture of embryonic stem cells of Araliaceae plants, and can significantly increase the culture amount of embryonic stem cells, thereby achieving efficient and rapid culture. Furthermore, adding methyl jasmonate to the culture medium can increase the production amount of saponins produced by embryonic stem cells of Araliaceae plants, and is suitable for large-scale production of saponins.

[0008] In order to solve the above technical problems, the basic concept of the technical solution adopted by the present invention is:

[0009] The invention provides a culture medium for embryonic stem cells of Araliaceae plants. The culture medium comprises a basic culture medium, to which 200 mg / L-500 mg / L of cerium nitrate is added; the basic culture medium is selected from one of MS culture medium and B5 culture medium.

[0010] The culture medium of the Araliaceae plant embryonic stem cells of the present invention adds cerium nitrate of a certain mass concentration, which has a significant promoting effect on the culture of the Araliaceae plant embryonic stem cells, can significantly increase the culture amount of the embryonic stem cells, thereby achieving efficient and rapid culture. The culture medium containing cerium nitrate of the present invention has universal applicability to the culture of Araliaceae plant stem cells.

[0011] In a further embodiment, the basal medium is MS medium, to which is added 0.8-1.3 mg / L amphotericin B and a double antibody with a mass concentration of 0.9-1.2%, wherein the double antibody is a 100X penicillin-streptomycin mixture, 0.8-1.2 mg / L 6-BA and 0.8-1.3 mg / L NAA;

[0012] In a further embodiment, 1.0 mg / L amphotericin B, 1.0% bispecific antibody, 1.0 mg / L 6-BA and 1.0 mg / L NAA are added to the MS culture medium.

[0013] Amphotericin B added to the culture medium can play an antifungal role, and the double antibiotic can play an antibacterial role to prevent the culture medium from being contaminated with bacteria; 6-BA (6-benzylaminopurine) and NAA (naphthaleneacetic acid) can promote differentiation. Therefore, the synergistic effect of the various components in the culture medium can well promote stem cell culture and increase the culture amount of embryonic stem cells.

[0014] Alternatively, in another culture medium scheme, the basal culture medium is B5 culture medium, to which 0.098-0.120 mg / L 6-BA, 13-18 mg / L sucrose, 0.48-0.52 mg / L methyl jasmonate and 0.099-0.130 mg / L triacontanol are further added;

[0015] In a further embodiment, 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol are added to the B5 medium.

[0016] 6-BA (6-benzylaminopurine), methyl jasmonate and triacontanol can further promote differentiation. Therefore, the components in the culture medium work synergistically to promote stem cell culture and increase the culture amount of embryonic stem cells.

[0017] The present invention also provides a method for culturing embryonic stem cells of Araliaceae plants, comprising:

[0018] (1) Explant pretreatment: Take tender stems of Araliaceae plants, wash and disinfect them, and cut off the stem tips for pretreatment;

[0019] (2) Obtaining embryonic stem cells: peeling off meristems from the shoot apex treated in step (1), soaking them in an ascorbic acid solution to prevent browning, and then transferring them to a culture medium for culturing, wherein the culture medium includes a basal culture medium, and 200 mg / L-500 mg / L of cerium nitrate is added to the basal culture medium; the basal culture medium is selected from one of MS culture medium and B5 culture medium; filtering after the culturing to obtain a filtrate containing embryonic stem cells;

[0020] (3) Expanding the culture: transferring the filtrate containing embryonic stem cells obtained in step (2) into a culture medium for culture. After the culture is completed, the culture medium containing embryonic stem cells is divided into several portions, transferred to several culture containers, and then the culture medium is added to each of the containers for subculture.

[0021] (4) Collection: centrifuging the embryonic stem cell culture medium obtained by subculture in step (3) and discarding the supernatant to obtain embryonic stem cells of Araliaceae plants; alternatively, drying, crushing, and sieving the obtained embryonic stem cells to obtain Araliaceae plant stem cell powder.

[0022] In a further embodiment, in steps (2) and (3),

[0023] The culture medium comprises: a basic culture medium is an MS culture medium, to which is added 200 mg / L-500 mg / L of cerium nitrate, 0.8-1.3 mg / L of amphotericin B, and a double antibody with a mass concentration of 0.9-1.2%, wherein the double antibody is a 100X penicillin-streptomycin mixture, 0.8-1.2 mg / L of 6-BA, and 0.8-1.3 mg / L of NAA;

[0024] Alternatively, the culture medium comprises: the basic culture medium is B5 culture medium, to which 200 mg / L-500 mg / L of cerium nitrate, 0.098-0.120 mg / L of 6-BA, 13-18 mg / L of sucrose, 0.48-0.52 mg / L of methyl jasmonate and 0.099-0.130 mg / L of triacontanol are added.

[0025] As a specific embodiment, the culture medium includes: the basic culture medium is MS culture medium, to which 200 mg / L-500 mg / L cerium nitrate, 1.0 mg / L amphotericin B, and a double antibody with a mass concentration of 1.0%, wherein the double antibody is a 100X penicillin-streptomycin mixture, 1.0 mg / L 6-BA, and 1.0 mg / L NAA are added;

[0026] Alternatively, the culture medium includes: the basic culture medium is B5 culture medium, to which 200 mg / L-500 mg / L cerium nitrate, 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol are added.

[0027] In a further embodiment, the pH value of the culture medium is controlled to be 5.8-6.8, preferably 6.2.

[0028] In a further embodiment, the culture medium in step (3) is the same as the culture medium in step (2);

[0029] In a further embodiment, in step (3), the culture is subcultured once or multiple times.

[0030] In a further scheme, in step (1), the pretreatment of the cut stem tip includes: first treating the stem tip with a sucrose solution with a mass concentration of 20% for 24 hours, cleaning the sucrose solution on the surface of the stem tip after the treatment, and then transferring the stem tip to a sucrose solution with a mass concentration of 1.5% for treatment for 10 minutes, and finally transferring it to a sucrose solution with a mass concentration of 3%, and adding a basic culture medium containing IAA with a mass concentration of 0.08%.

[0031] In a further embodiment, in step (1), cleaning and disinfection comprises:

[0032] Rinse the stem tip with clean water, then clean it with a 75% alcohol-water solution, clean it with sterile water, then disinfect it with a disinfectant containing 0.5% sodium hypochlorite by volume, and then clean it with sterile water.

[0033] In a further embodiment, in steps (2) and (3), the culture temperature is 20-25°C, the shaking speed is 80-200 r / min, and the culture time is 3-7 days.

[0034] As a specific implementation, in step (2), the culture temperature is 22° C., the shaking speed is 110 r / min, and the culture time is 3 days.

[0035] As a specific implementation, in step (3), the culture temperature is 22° C., the shaking speed is 110 r / min, and the culture time for one subculture is 2 days.

[0036] As a more specific embodiment, the method for culturing embryonic stem cells of Araliaceae plants comprises the following specific steps:

[0037] (1) Explant pretreatment: Select plants of the Araliaceae family with tender stems, rinse them with clean water first, and use a brush to scrub the hard-to-clean parts, then use a 75% alcohol aqueous solution to clean them for 20 seconds, then use sterile water to clean them three times, then use a disinfectant containing 0.5% sodium hypochlorite to disinfect them for 5 minutes, and then use sterile water to clean them three times; cut off all the cleaned stem tips, treat them with a 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, then pour out the sucrose solution, and use sterilized filter paper to clean the stem tips by siphoning; then transfer the entire stem tip of Panax notoginseng to a 1.5% sucrose solution for 10 minutes, and finally transfer it to a sucrose solution with a sucrose content of about 3%, and add a basal medium containing 0.08% IAA (indoleacetic acid);

[0038] (2) Obtaining embryonic stem cells: The treated shoot tips were carefully peeled off from the meristem part in a biosafety cabinet, and treated to prevent browning as soon as possible. After all the peeling was completed, the slices were cut into very small pieces and transferred to a conical flask containing MS medium containing 1.0 mg / L amphotericin B, 1.0% double antibiotics, 1.0 mg / L 6-BA, and 1.0 mg / L NAA for culture (or, the medium contained 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.5 0mg / L methyl jasmonate and 0.100mg / L triacontanol B5 medium), in addition, cerium nitrate in the concentration range of 200mg / L-500mg / L is added to the medium, the pH value of the medium is 6.2, the conical flask is placed in a vertical constant temperature oscillator, the speed is 110r / min, the temperature is 22°C, and the shaking table culture is carried out for 3 days; after the culture is completed, the larger flakes and fragments are first filtered out with a No. 2 sieve, and then a 40um cell filter is used for secondary filtration and separation, and the filtrate is the filtrate containing embryonic stem cells;

[0039] (3) Expansion culture of embryonic stem cells: The obtained filtrate containing embryonic stem cells was transferred to a conical flask, and MS medium containing 1.0 mg / L amphotericin B and 1.0% double antibody by mass concentration, 1.0 mg / L 6-BA, and 1.0 mg / L NAA was added (or the medium was B5 medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate, and 0.100 mg / L triacontanol). In addition, cerium nitrate at a concentration of 200 mg / L-500 mg / L was added to the medium. The conical flask was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the culture was completed, The culture medium containing embryonic stem cells is uniformly transferred from one flask to three flasks, and MS culture medium (or B5 culture medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol) is added thereto, and cerium nitrate in the concentration range of 200 mg / L-500 mg / L is added to the culture medium until the amount of the culture medium in each flask reaches about 1 / 3, and then the culture medium is subcultured in a constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0040] (4) Collection of embryonic stem cells: The embryonic stem cells are subcultured for 48 hours and then collected. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of the Araliaceae plant. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small grinder to obtain Araliaceae plant stem cell powder.

[0041] The present invention also provides a method for inducing embryonic stem cells of Araliaceae plants to produce high saponins, comprising:

[0042] Inoculating Araliaceae embryonic stem cells into a basal culture medium, adding a methyl jasmonate aqueous solution to a final concentration of 25-100 μmol / L, and performing shaking induction culture; after a certain period of time, centrifuging and drying the obtained Araliaceae embryonic stem cells to obtain Araliaceae embryonic stem cell powder with high saponin production;

[0043] Alternatively, a mixed solution of methyl jasmonate and indoleacetic acid is added to the basal culture medium to make the final concentration of methyl jasmonate 25-100 μmol / L and the final concentration of indoleacetic acid 50 μmol / L, and the culture is induced by shaking; after a certain period of time, the obtained Araliaceae embryonic stem cells are centrifuged and dried to obtain Araliaceae embryonic stem cell powder with high saponin production;

[0044] In a further scheme, the temperature of the shaking induction culture is 23°C, the shaking speed is 100r / min, and the culture time is 5 days.

[0045] The invention adds a certain concentration of methyl jasmonate to the culture medium, which can increase the production of saponin in embryonic stem cells of Araliaceae plants, is suitable for large-scale production of saponin, and greatly improves efficiency and economic benefits.

[0046] In a further embodiment, embryonic stem cells of Araliaceae plants can be obtained by methods in the prior art, or by the culture method described above in the present invention.

[0047] As an embodiment, the method for inducing high saponin production of embryonic stem cells of Araliaceae plants is specifically as follows:

[0048] Add MS culture medium containing Araliaceae embryonic stem cells into a conical flask, then add methyl jasmonate aqueous solution thereto to make the final concentration be 25-100 μmol / L, then put the conical flask into a shaker at a temperature of 23°C and a rotation speed of 100 r / min for shaking culture; after 5 days, centrifuge and dry the Araliaceae embryonic stem cells obtained by induced culture, and finally obtain Araliaceae embryonic stem cell powder with high saponin yield.

[0049] Detection of saponin content (taking notoginseng saponin content detection as an example):

[0050] Preparation of standard: Weigh standard saponins separately, dissolve them in 70% methanol aqueous solution, and then dilute to a final concentration of 1 mg / mL standard solution;

[0051] Preparation of test samples: Weigh the Araliaceae plant embryonic stem cell powder to be tested, and dissolve it in 70% methanol to a final concentration of 2.5 mg / mL.

[0052] Detection method: Use Waters Xevo TQ-S mass spectrometer, acetonitrile as mobile phase A, water as mobile phase B, and gradient elution according to the elution program; column temperature 25°C; flow rate 1.5mL / min; detection wavelength 203nm; the separation degree of ginsenoside Rg1 and ginsenoside Re should be greater than 1.5; the number of theoretical plates calculated based on the ginsenoside Rg1 peak should be no less than 6000. Accurately absorb the sample to be tested and the standard solution for determination, and the different contents of various saponins in the embryonic stem cell powder of Araliaceae plants can be obtained by analysis and calculation.

[0053] In the present invention, the Araliaceae plants include ginseng, wild ginseng, American ginseng, tree ginseng, variegated tree ginseng, large ginseng, sea cucumber, five-leaf ginseng, Panax notoginseng, thorny thorn, tongtuo wood, angelica, Schefflera arborvitae, Schefflera chinensis, white balsam pear, Acanthopanax senticosus, Acanthopanax senticosus, sessile Acanthopanax, Aralia chinensis, yellow-haired Aralia chinensis, Liaodong Aralia elata, tiger thorn Aralia elata, umbrella maple, short-stemmed umbrella maple, thorny tongcao, Luo umbrella, palm leaf Liangwang tea, multi-core wood, ivy;

[0054] Preferably, the Araliaceae plants include ginseng, wild ginseng, Panax notoginseng, and American ginseng.

[0055] After adopting the above technical solution, the present invention has the following beneficial effects compared with the prior art:

[0056] 1. The present invention adds cerium nitrate in a concentration of 200 mg / L-500 mg / L to the culture medium for culturing embryonic stem cells of Araliaceae plants. Experiments have found that the addition of cerium nitrate in this concentration range has a significant promoting effect on the culture of embryonic stem cells of Araliaceae plants and can significantly increase the culture amount of stem cells.

[0057] 2. The present invention has conducted experiments on the culture of embryonic stem cells of various Araliaceae plants, such as ginseng, Panax notoginseng, etc., and found that the culture medium containing cerium nitrate of the present invention is universal for the culture of Araliaceae plant stem cells and has the effect of promoting the generation of embryonic stem cells.

[0058] 3. The present invention adds methyl jasmonate to a culture medium containing embryonic stem cells of Araliaceae plants, and finds that methyl jasmonate can increase the production of saponins in embryonic stem cells of Araliaceae plants, and is suitable for large-scale production.

[0059] The specific implementation modes of the present invention are further described in detail below in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] The accompanying drawings are part of the present invention and are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention, but do not constitute an improper limitation of the present invention. Obviously, the drawings described below are only some embodiments. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work. In the accompanying drawings:

[0061] Figure 1 This is a schematic diagram of the gene identification results of wild ginseng embryonic stem cells in Example 13 of the present invention.

[0062] It should be noted that these drawings and textual descriptions are not intended to limit the conceptual scope of the present invention in any way, but are intended to illustrate the concept of the present invention for those skilled in the art by referring to specific embodiments. DETAILED DESCRIPTION

[0063] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. The following embodiments are used to illustrate the present invention but are not used to limit the scope of the present invention.

[0064] Example 1

[0065] The Araliaceae plant used in this embodiment is Panax notoginseng, and the method for culturing Panax notoginseng embryonic stem cells is specifically described as follows:

[0066] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the soil and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a mass concentration of about 3%, and add B5 culture medium containing IAA (indoleacetic acid) with a mass concentration of 0.08%;

[0067] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the portion containing the meristem of Panax notoginseng in a biosafety cabinet, and the portion is treated to prevent browning as soon as possible. After all the peeling is completed, the portion is cut into very small slices, and the slices are transferred to a conical flask containing a culture medium for culture. The culture medium is a B5 culture medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate, and 0.100 mg / L triacontanol. In addition, cerium nitrate at a concentration of 300 mg / L is added to the culture medium. The pH value of the culture medium is 6.2. The conical flask is placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0068] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and B5 medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol was added. In addition, cerium nitrate at a concentration of 300 mg / L was added to the medium. The conical flask was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the end, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and B5 culture medium to which 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate, 0.100 mg / L triacontanol and 300 mg / L cerium nitrate were added, until the amount of culture medium in each flask reached about 1 / 3; subculture was performed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0069] (4) Collection of embryonic stem cells: After the embryonic stem cells are subcultured for 48 hours, they can be collected. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation is completed, the supernatant is discarded to obtain the embryonic stem cells of Panax notoginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small grinder to obtain Panax notoginseng stem cell powder.

[0070] Example 2

[0071] The Araliaceae plant used in this embodiment is Panax notoginseng, and the method for culturing Panax notoginseng embryonic stem cells is specifically described as follows:

[0072] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the dirt and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a sucrose mass content of about 3%, and add MS culture medium containing 0.08% IAA;

[0073] (2) Obtaining embryonic stem cells: The part containing the meristem of Panax notoginseng was carefully peeled off from the shoot tip treated in step (1) in a biological safety cabinet, and the part was treated to prevent browning as soon as possible. After all the parts were peeled off, they were cut into very small slices and transferred to three Erlenmeyer flasks containing culture medium for culture. The culture medium contained 1.0 mg / L amphotericin B and 1.0% double antibiotic (100X penicillin-streptomycin mixture) and 1.0 mg / L 6-BA, 1.0 mg / L N MS medium of AA, and cerium nitrate with a concentration of 200 mg / L, 300 mg / L, and 500 mg / L was added to the medium respectively, the pH value of the medium was 6.2, the conical flask was placed in a vertical constant temperature oscillator, the speed was 110 r / min, the temperature was 22°C, and the shaking table culture was carried out respectively, and the culture time was 3 days; after the culture was completed, the larger flakes and fragments were first filtered out with a No. 2 sieve, and then a 40um cell filter membrane was used for secondary filtration and separation, and the filtrate was the filtrate containing embryonic stem cells;

[0074] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and MS culture medium containing 1.0 mg / L amphotericin B and 1.0% double-antibody with a mass concentration of 1.0 mg / L, 1.0 mg / L 6-BA, and 1.0 mg / L NAA was added. The conical flasks were divided into three groups, and the culture medium of each group was added with cerium nitrate at a concentration of 200 mg / L, 300 mg / L, and 500 mg / L, respectively. The conical flasks were placed in a vertical constant temperature oscillator with a rotation speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the culture was completed, , respectively, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and then 1.0 mg / L amphotericin B, 1.0% double-antibody, 1.0 mg / L 6-BA, and 1.0 mg / L NAA MS culture medium were added thereto, and then the flasks were divided into three groups, and 200 mg / L, 300 mg / L, and 500 mg / L cerium nitrate were added to the culture medium of each group, respectively, until the amount of the culture medium in each flask reached about 1 / 3, and then the culture was subcultured in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0075] (4) Collection of embryonic stem cells: The embryonic stem cells are expanded and cultured for 48 hours and then collected separately. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of the Araliaceae plant. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small pulverizer to obtain Panax notoginseng stem cell powder cultured in a culture medium containing different concentrations of cerium nitrate.

[0076] Test Example 1

[0077] This test example involves the effect of cerium nitrate on the culture of Panax notoginseng embryonic stem cells. Four comparative examples are set:

[0078] Comparative Example 1: No cerium nitrate was added to the B5 medium, and the rest was the same as in Example 1;

[0079] Comparative Example 2: 700 mg / L cerium nitrate was added to the B5 medium, and the rest was the same as in Example 1;

[0080] Comparative Example 3: No cerium nitrate was added to the MS medium, and the rest was the same as in Example 2;

[0081] Comparative Example 4: 700 mg / L cerium nitrate was added to the MS medium, and the rest was the same as in Example 2.

[0082] The embryonic stem cells obtained in Examples 1-2 and Comparative Examples 1-4 were weighed and measured. Five experiments were performed and the average value was taken. The results are shown in Table 1.

[0083] Table 1 Comparison results of weight of Panax notoginseng stem cells

[0084]

[0085] It can be concluded from the above table that the embryonic stem cells obtained by culturing in the MS medium with the addition of 200mg / L, 300mg / L, and 500mg / L cerium nitrate are at least 20% more than the comparative example 3 without the addition of cerium nitrate, and when the concentration of cerium nitrate added is 300mg / L, 113.02g of embryonic stem cells are obtained; when the concentration of cerium nitrate added is 700mg / L, the weight of the embryonic stem cells obtained will be less than that of the blank group and the addition of 200mg / L, 300mg / L, and 500mg / L. Similarly, the embryonic stem cells obtained by culturing in the B5 medium with the addition of 300mg / L cerium nitrate are more than those of the blank group (Comparative Example 1), while the weight of the embryonic stem cells obtained by adding the B5 medium with a cerium nitrate concentration of 700mg / L is less than that of the blank group. Therefore, it is shown that the addition of 700mg / L cerium nitrate will inhibit the stem cell culture. Cerium nitrate in the concentration range of 200-500mg / L is beneficial to the culture of Panax notoginseng stem cells and can produce a large number of Panax notoginseng stem cells in a short time.

[0086] Example 3

[0087] The Araliaceae plant used in this embodiment is Panax notoginseng, and the method for culturing Panax notoginseng embryonic stem cells is specifically described as follows:

[0088] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the soil and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a mass concentration of about 3%, and add B5 culture medium containing IAA (indoleacetic acid) with a mass concentration of 0.08%;

[0089] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the portion containing the meristem of Panax notoginseng in a biosafety cabinet, and subjected to anti-browning treatment as soon as possible. After all the peeling is completed, it is cut into very small slices and transferred to a conical flask containing a culture medium for culture. The culture medium is a B5 culture medium containing 0.098 mg / L 6-BA, 13 mg / L sucrose, 0.48 mg / L methyl jasmonate and 0.099 mg / L triacontanol. In addition, cerium nitrate at a concentration of 300 mg / L is added to the culture medium. The pH value of the culture medium is 6.2. The conical flask is placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0090] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and B5 medium containing 0.098 mg / L 6-BA, 13 mg / L sucrose, 0.48 mg / L methyl jasmonate and 0.099 mg / L triacontanol was added. In addition, cerium nitrate at a concentration of 300 mg / L was added to the medium. The conical flask was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 2 days. After the end, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and B5 culture medium to which 0.098 mg / L 6-BA, 13 mg / L sucrose, 0.48 mg / L methyl jasmonate, 0.099 mg / L triacontanol and 300 mg / L cerium nitrate were added until the amount of culture medium in each flask reached about 1 / 3; subculture was performed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0091] (4) Collection of embryonic stem cells: After the embryonic stem cells are subcultured for 48 hours, they can be collected. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation is completed, the supernatant is discarded to obtain the embryonic stem cells of Panax notoginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small grinder to obtain Panax notoginseng stem cell powder.

[0092] Example 4

[0093] The Araliaceae plant used in this embodiment is Panax notoginseng, and the method for culturing Panax notoginseng embryonic stem cells is specifically described as follows:

[0094] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the soil and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a mass concentration of about 3%, and add B5 culture medium containing IAA (indoleacetic acid) with a mass concentration of 0.08%;

[0095] (2) Obtaining embryonic stem cells: The part containing the meristem of Panax notoginseng is carefully peeled off from the shoot tip treated in step (1) in a biosafety cabinet, and the part is treated to prevent browning as soon as possible. After all the parts are peeled off, they are cut into very small slices and transferred to a conical flask containing culture medium for culture. The culture medium is B5 culture medium containing 0.120 mg / L 6-BA, 18 mg / L sucrose, 0.52 mg / L methyl jasmonate and 0.130 mg / L triacontanol. In addition, cerium nitrate at a concentration of 300 mg / L is added to the culture medium. The pH value of the culture medium is 6.2. The conical flask is placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0096] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and B5 medium containing 0.120 mg / L 6-BA, 18 mg / L sucrose, 0.52 mg / L methyl jasmonate and 0.130 mg / L triacontanol was added. In addition, cerium nitrate at a concentration of 300 mg / L was added to the medium. The conical flask was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 2 days. After the end, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and B5 culture medium to which 0.120 mg / L 6-BA, 18 mg / L sucrose, 0.52 mg / L methyl jasmonate, 0.130 mg / L triacontanol and 300 mg / L cerium nitrate were added until the amount of culture medium in each flask reached about 1 / 3; subculture was performed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0097] (4) Collection of embryonic stem cells: After the embryonic stem cells are subcultured for 48 hours, they can be collected. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation is completed, the supernatant is discarded to obtain the embryonic stem cells of Panax notoginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small grinder to obtain Panax notoginseng stem cell powder.

[0098] Example 5

[0099] The Araliaceae plant used in this embodiment is Panax notoginseng, and the method for culturing Panax notoginseng embryonic stem cells is specifically described as follows:

[0100] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the dirt and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a sucrose mass content of about 3%, and add MS culture medium containing 0.08% IAA;

[0101] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the portion containing the meristem of Panax notoginseng in a biological safety cabinet, and the portion is treated to prevent browning as soon as possible. After all the portions are peeled off, the portions are cut into very small slices, and the slices are transferred to three Erlenmeyer flasks containing culture medium for culture. The culture medium is an MS culture medium containing 0.8 mg / L amphotericin B and 0.9% double antibiotic (100X penicillin-streptomycin mixture) by mass concentration, 0.8 mg / L 6-BA, and 0.8 mg / L NAA. In addition, cerium nitrate is added to the culture medium at a concentration of 300 mg / L. The pH value of the culture medium is 6.2. The Erlenmeyer flasks are placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C., and cultured on a shaking table for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0102] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and MS culture medium containing 0.8 mg / L amphotericin B and 0.9% double-antibody with a mass concentration of 0.8 mg / L 6-BA and 0.8 mg / L NAA was added. The conical flasks were divided into three groups, and 300 mg / L cerium nitrate was added to the culture medium of each group. The conical flasks were placed in a vertical constant temperature oscillator with a rotation speed of 110 r / min and a temperature of 22°C for shaking culture. The culture time was 2 days. After the culture was completed, , respectively, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and MS culture medium containing 0.8 mg / L amphotericin B, 0.9% double-antibody, 0.8 mg / L 6-BA, and 0.8 mg / L NAA was added thereto, and then the flasks were divided into three groups, and 300 mg / L cerium nitrate was added to the culture medium of each group, until the amount of the culture medium in each flask reached about 1 / 3, and then the culture medium was subcultured in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0103] (4) Collection of embryonic stem cells: The embryonic stem cells are expanded and cultured for 48 hours and then collected separately. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of the Araliaceae plant. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small pulverizer to obtain Panax notoginseng stem cell powder cultured in a culture medium containing different concentrations of cerium nitrate.

[0104] Example 6

[0105] The Araliaceae plant used in this embodiment is Panax notoginseng, and the method for culturing Panax notoginseng embryonic stem cells is specifically described as follows:

[0106] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the dirt and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a sucrose mass content of about 3%, and add MS culture medium containing 0.08% IAA;

[0107] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the part containing the meristem of Panax notoginseng in a biological safety cabinet, and the part is treated to prevent browning as soon as possible. After all the parts are peeled off, they are cut into very small slices and transferred to three Erlenmeyer flasks containing culture medium for culture. The culture medium is an MS medium containing 1.3 mg / L amphotericin B and 1.2% double antibiotic (100X penicillin-streptomycin mixture) by mass concentration, 1.2 mg / L 6-BA, and 1.3 mg / L NAA. In addition, cerium nitrate is added to the culture medium at a concentration of 300 mg / L. The pH value of the culture medium is 6.2. The Erlenmeyer flasks are placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0108] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and MS culture medium containing 1.3 mg / L amphotericin B, 1.2% double-antibody, 1.2 mg / L 6-BA, and 1.3 mg / L NAA was added. The conical flasks were divided into three groups, and 300 mg / L cerium nitrate was added to the culture medium of each group. The conical flasks were placed in a vertical constant temperature oscillator with a rotation speed of 110 r / min and a temperature of 22°C for shaking culture. The culture time was 2 days. After the culture was completed, , respectively, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and MS culture medium containing 1.3 mg / L amphotericin B, 1.2% double-antibody, 1.2 mg / L 6-BA, and 1.3 mg / L NAA was added thereto, and then the flasks were divided into three groups, and 300 mg / L cerium nitrate was added to the culture medium of each group until the amount of the culture medium in each flask reached about 1 / 3, and then the culture medium was subcultured in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0109] (4) Collection of embryonic stem cells: The embryonic stem cells are expanded and cultured for 48 hours and then collected separately. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of the Araliaceae plant. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small pulverizer to obtain Panax notoginseng stem cell powder cultured in a culture medium containing different concentrations of cerium nitrate.

[0110] Test Example 2

[0111] In this test example, the embryonic stem cells obtained in Examples 1-6 were weighed and measured. Five experiments were conducted and the average value was taken. The results are shown in Tables 2 and 3.

[0112] Table 2 Comparison of weight of Panax notoginseng stem cells using B5 medium

[0113] Example 1 Example 3 Example 4 Added cerium nitrate concentration / mg / L 300 300 300 Added ingredient concentration middle Low High Medium type B5 B5 B5 6-BA concentration / mg / L 0.100 0.098 0.120 Sucrose concentration / mg / L 15 13 18 Methyl jasmonate concentration / mg / L 0.50 0.48 0.52 Triacontanol concentration / mg / L 0.100 0.099 0.130 Average weight / g 83.17 82.79 83.02

[0114] It can be seen from the above table that when the concentrations of relevant components added to the B5 culture medium are controlled at 0.098-0.120 mg / L 6-BA, 13-18 mg / L sucrose, 0.48-0.52 mg / L methyl jasmonate and 0.099-0.130 mg / L triacontanol, a large number of Panax notoginseng stem cells can be produced in a short time, which is beneficial to the culture of embryonic stem cells.

[0115] Table 3 Comparison of weight of Panax notoginseng stem cells using MS medium

[0116]

[0117]

[0118] It can be seen from the above table that when the concentration of relevant components is controlled at 0.8-1.3 mg / L amphotericin B, the mass concentration of double-antibody is 0.9-1.2%, 0.8-1.2 mg / L 6-BA and 0.8-1.3 mg / L NAA in the MS culture medium, a large number of Panax notoginseng stem cells can be produced in a short time, which is beneficial to the culture of embryonic stem cells.

[0119] Test Example 3

[0120] This test example involves an experiment on the effect of the concentration of relevant components added to the culture medium on the culture of Panax notoginseng embryonic stem cells. Four comparative examples are set up:

[0121] Comparative Example 5

[0122] The Araliaceae plant used in this comparative example is Panax notoginseng, which relates to a method for culturing Panax notoginseng embryonic stem cells. The difference from Example 1 is that the concentration of the added related components is reduced. The specific steps are as follows:

[0123] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the soil and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a mass concentration of about 3%, and add B5 culture medium containing IAA (indoleacetic acid) with a mass concentration of 0.08%;

[0124] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the portion containing the meristem of Panax notoginseng in a biological safety cabinet, and the portion is treated to prevent browning as soon as possible. After all the peeling is completed, the portion is cut into very small slices, and the slices are transferred to a conical flask containing a culture medium for culture. The culture medium is a B5 culture medium containing 0.050 mg / L 6-BA, 5 mg / L sucrose, 0.10 mg / L methyl jasmonate and 0.050 mg / L triacontanol, and 300 mg / L cerium nitrate is added to the culture medium. The pH value of the culture medium is 6.2. The conical flask is placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0125] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and B5 medium containing 0.050 mg / L 6-BA, 5 mg / L sucrose, 0.10 mg / L methyl jasmonate and 0.050 mg / L triacontanol was added. In addition, cerium nitrate at a concentration of 300 mg / L was added to the medium. The conical flask was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the end, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and B5 culture medium to which 0.050 mg / L 6-BA, 5 mg / L sucrose, 0.10 mg / L methyl jasmonate, 0.050 mg / L triacontanol and 300 mg / L cerium nitrate were added until the amount of culture medium in each flask reached about 1 / 3; subculture was performed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0126] (4) Collection of embryonic stem cells: After the embryonic stem cells are subcultured for 48 hours, they can be collected. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation is completed, the supernatant is discarded to obtain the embryonic stem cells of Panax notoginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small grinder to obtain Panax notoginseng stem cell powder.

[0127] Comparative Example 6

[0128] The Araliaceae plant used in this comparative example is Panax notoginseng, which relates to a method for culturing Panax notoginseng embryonic stem cells. The difference from Example 1 is that the concentration of the added relevant components is increased. The specific steps are as follows:

[0129] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the soil and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a mass concentration of about 3%, and add B5 culture medium containing IAA (indoleacetic acid) with a mass concentration of 0.08%;

[0130] (2) Obtaining embryonic stem cells: The part containing the meristem of Panax notoginseng is carefully peeled off from the shoot tip treated in step (1) in a biological safety cabinet, and the part is treated to prevent browning as soon as possible. After all the peeling is completed, it is cut into very small slices, and transferred to a conical flask containing culture medium for culture. The culture medium is B5 culture medium containing 0.200 mg / L 6-BA, 20 mg / L sucrose, 1.00 mg / L methyl jasmonate and 2.000 mg / L triacontanol, and 300 mg / L cerium nitrate is added to the culture medium. The pH value of the culture medium is 6.2. The conical flask is placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0131] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and B5 medium containing 0.200 mg / L 6-BA, 20 mg / L sucrose, 1.00 mg / L methyl jasmonate and 2.000 mg / L triacontanol was added. In addition, cerium nitrate at a concentration of 300 mg / L was added to the medium. The conical flask was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the end, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and B5 culture medium to which 0.200 mg / L 6-BA, 20 mg / L sucrose, 1.00 mg / L methyl jasmonate, 2.000 mg / L triacontanol and 300 mg / L cerium nitrate were added until the amount of culture medium in each flask reached about 1 / 3; subculture was performed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0132] (4) Collection of embryonic stem cells: After the embryonic stem cells are subcultured for 48 hours, they can be collected. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation is completed, the supernatant is discarded to obtain the embryonic stem cells of Panax notoginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small grinder to obtain Panax notoginseng stem cell powder.

[0133] Comparative Example 7

[0134] The Araliaceae plant used in this comparative example is Panax notoginseng, which is related to a method for culturing Panax notoginseng embryonic stem cells. The difference from Example 2 is that the concentration of the added related components is reduced. The specific steps are as follows:

[0135] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the dirt and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a sucrose mass content of about 3%, and add MS culture medium containing 0.08% IAA;

[0136] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the portion containing the meristem of Panax notoginseng in a biological safety cabinet, and the portion is treated to prevent browning as soon as possible. After all the peeling is completed, the portion is cut into very small slices, and the slices are transferred to three Erlenmeyer flasks containing culture medium for culture. The culture medium is an MS medium containing 0.5 mg / L amphotericin B and 0.1% double antibiotic (100X penicillin-streptomycin mixture) by mass concentration, 0.5 mg / L 6-BA, and 0.5 mg / L NAA. In addition, cerium nitrate is added to the culture medium at a concentration of 300 mg / L. The pH value of the culture medium is 6.2. The Erlenmeyer flasks are placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C., and cultured on a shaking table for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0137] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and MS culture medium containing 0.5 mg / L amphotericin B and 0.1% double-antibody with a mass concentration of 0.5 mg / L 6-BA and 0.5 mg / L NAA was added. The conical flasks were divided into three groups, and 300 mg / L cerium nitrate was added to the culture medium of each group. The conical flasks were placed in a vertical constant temperature oscillator with a rotation speed of 110 r / min and a temperature of 22°C for shaking culture. The culture time was 2 days. After the culture was completed, , respectively, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and MS culture medium containing 0.5 mg / L amphotericin B, 0.5% double-antibody, 0.5 mg / L 6-BA, and 0.5 mg / L NAA was added thereto, and then the flasks were divided into three groups, and 300 mg / L cerium nitrate was added to the culture medium of each group until the amount of the culture medium in each flask reached about 1 / 3, and then the culture medium was subcultured in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0138] (4) Collection of embryonic stem cells: The embryonic stem cells are expanded and cultured for 48 hours and then collected separately. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of the Araliaceae plant. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small pulverizer to obtain Panax notoginseng stem cell powder cultured in a culture medium containing different concentrations of cerium nitrate.

[0139] Comparative Example 8

[0140] The Araliaceae plant used in this comparative example is Panax notoginseng, which relates to a method for culturing Panax notoginseng embryonic stem cells. The difference from Example 2 is that the concentration of the added relevant components is increased. The specific steps are as follows:

[0141] (1) Pretreatment of explants: Select Panax notoginseng with tender stems in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the dirt and other attachments on the surface, then clean the surface of Panax notoginseng with a volume concentration of 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% volume sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a mass concentration of 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of Panax notoginseng to a mass concentration of 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a sucrose mass content of about 3%, and add MS culture medium containing 0.08% IAA;

[0142] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the part containing the meristem of Panax notoginseng in a biological safety cabinet, and the part is treated to prevent browning as soon as possible. After all the parts are peeled off, they are cut into very small slices and transferred to three Erlenmeyer flasks containing culture medium for culture. The culture medium is an MS medium containing 2.0 mg / L amphotericin B and 2.0% double antibiotic (100X penicillin-streptomycin mixture) by mass concentration, 2.0 mg / L 6-BA, and 2.0 mg / L NAA. In addition, cerium nitrate is added to the culture medium at a concentration of 300 mg / L. The pH value of the culture medium is 6.2. The Erlenmeyer flasks are placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0143] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and MS culture medium containing 2.0 mg / L amphotericin B, 2.0% double-antibody, 2.0 mg / L 6-BA, and 2.0 mg / L NAA was added. The conical flasks were divided into three groups, and 300 mg / L cerium nitrate was added to the culture medium of each group. The conical flasks were placed in a vertical constant temperature oscillator with a rotation speed of 110 r / min and a temperature of 22°C for shaking culture. The culture time was 2 days. After the culture was completed, , respectively, the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and MS culture medium containing 2.0 mg / L amphotericin B, 2.0% double-antibody, 2.0 mg / L 6-BA, and 2.0 mg / L NAA was added thereto, and then the flasks were divided into three groups, and 300 mg / L cerium nitrate was added to the culture medium of each group, until the amount of the culture medium in each flask reached about 1 / 3, and then the culture medium was subcultured in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0144] (4) Collection of embryonic stem cells: The embryonic stem cells are expanded and cultured for 48 hours and then collected separately. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of the Araliaceae plant. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small pulverizer to obtain Panax notoginseng stem cell powder cultured in a culture medium containing different concentrations of cerium nitrate.

[0145] The embryonic stem cells obtained in Examples 1-2 and Comparative Examples 5-8 were weighed and measured. Five experiments were performed and the average value was taken. The results are shown in Tables 4 and 5.

[0146] Table 4 Weight comparison results of Panax notoginseng stem cells using B5 medium

[0147] Example 1 Comparative Example 5 Comparative Example 6 Added cerium nitrate concentration / mg / L 300 300 300 Added ingredient concentration middle Low high 6-BA concentration / mg / L 0.100 0.050 0.200 Sucrose concentration / mg / L 15 5 20 Methyl jasmonate concentration / mg / L 0.50 0.10 1.00 Triacontanol concentration / mg / L 0.100 0.050 2.000 Medium type B5 B5 B5 Average weight / g 83.17 63.14 69.21

[0148] As can be seen from the above table, when the concentration of the relevant components added to the B5 medium is low, that is, the B5 medium containing 0.050 mg / L 6-BA, 5 mg / L sucrose, 0.10 mg / L methyl jasmonate and 0.050 mg / L triacontanol, the embryonic stem cells obtained by culture are reduced by more than 20% compared with Example 1. When the concentration of the relevant components added is high, that is, the B5 medium containing 0.200 mg / L 6-BA, 20 mg / L sucrose, 1.00 mg / L methyl jasmonate and 2.000 mg / L triacontanol, the embryonic stem cells obtained by culture are reduced by more than 15% compared with Example 1.

[0149] Table 5 Comparison of weight of Panax notoginseng stem cells using MS medium

[0150] Example 2 Comparative Example 7 Comparative Example 8 Added cerium nitrate concentration / mg / L 300 300 300 Added ingredient concentration middle Low high Medium type MS MS MS Amphotericin B concentration / mg / L 1.0 0.5 2.0 Double antibody concentration / % 1.0 0.1 2.0 6-BA concentration / mg / L 1.0 0.5 2.0 NAA concentration / mg / L 1.0 0.5 2.0 Average weight / g 113.02 73.66 76.88

[0151] As can be seen from the above table, when the concentration of the relevant components added to the MS medium is low, that is, the MS medium containing 0.5 mg / L amphotericin B, 0.1% double antibody, 0.5 mg / L 6-BA, and 0.5 mg / L NAA, the embryonic stem cells obtained by culture are reduced by more than 30% compared with Example 2. When the concentration of the relevant components added is high, that is, the MS medium containing 2.0 mg / L amphotericin B, 2.0% double antibody, 2.0 mg / L 6-BA, and 2.0 mg / L NAA, the embryonic stem cells obtained by culture are reduced by more than 30% compared with Example 2.

[0152] It can be seen from the above test results that when the concentration of the added relevant components is too low or too high, the weight of the obtained embryonic stem cells is less than that of the medium concentration.

[0153] Example 7

[0154] The Araliaceae plant used in this embodiment is ginseng, and the method for culturing ginseng embryonic stem cells is specifically described as follows:

[0155] (1) Pretreatment of explants: Select ginseng with tender stems in good growth condition, rinse with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the dirt and other attachments on the surface, then clean the surface of the ginseng with a 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire ginseng stem tip to a 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a 3% sucrose aqueous solution, and add B5 culture medium containing 0.08% IAA (indoleacetic acid);

[0156] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the part containing ginseng meristem in a biosafety cabinet, and the part is treated to prevent browning as soon as possible. After all the peeling is completed, it is cut into very small slices, and transferred to a conical flask containing culture medium for culture. The culture medium is B5 culture medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol, and 300 mg / L cerium nitrate is added to the culture medium, and the pH value is 6.2. The conical flask is placed in a vertical constant temperature oscillator with a rotation speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0157] (3) Expansion of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and B5 medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol was added. In addition, cerium nitrate at a concentration of 300 mg / L was added to the medium, and the medium was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C for shaking culture. The culture time was 2 days. The culture results were After the flask is completed, the culture medium containing embryonic stem cells is evenly transferred from one flask to three flasks, and B5 culture medium to which 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate, 0.100 mg / L triacontanol and 300 mg / L cerium nitrate are added until the amount of culture medium in each flask reaches about 1 / 3; subculture is performed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0158] (4) Collection of embryonic stem cells: The embryonic stem cells are subcultured for 48 hours and then collected. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of Panax notoginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small grinder to obtain ginseng stem cell powder.

[0159] Example 8

[0160] The Araliaceae plant used in this embodiment is ginseng, and the method for culturing ginseng embryonic stem cells is specifically described as follows:

[0161] (1) Pretreatment of explants: Select ginseng with tender stems in good growth condition, rinse with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the dirt and other attachments on the surface, then clean the surface of the ginseng with a 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire ginseng stem tip to a 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a sucrose content of about 3%, and add MS culture medium containing 0.08% IAA;

[0162] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) was carefully peeled off from the part containing the ginseng meristem in a biological safety cabinet, and the part was treated to prevent browning as soon as possible. After all the parts were peeled off, they were cut into very small slices and transferred to three conical flasks containing culture medium for culture. The culture medium contained 1.0 mg / L amphotericin B and 1.0% double antibody (100X penicillin-streptomycin mixture) and 1.0 mg / L 6-BA, 1.0 mg / L MS medium containing NAA, and cerium nitrate at concentrations of 200 mg / L, 300 mg / L, and 500 mg / L was added to the medium, respectively, and the pH value was 6.2. The conical flask was placed in a vertical constant temperature oscillator, with a speed of 110 r / min and a temperature of 22°C, and the shaking culture was carried out for 3 days; after the culture was completed, the larger flakes and fragments were first filtered out with a No. 2 sieve, and then a 40 um cell filter was used for secondary filtration and separation, and the filtrate was the filtrate containing embryonic stem cells;

[0163] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and MS medium containing 1.0 mg / L amphotericin B, 1.0% double-antibody, 1.0 mg / L 6-BA, and 1.0 mg / L NAA was added. In addition, cerium nitrate was added to the medium at concentrations of 200 mg / L, 300 mg / L, and 500 mg / L, respectively. The medium was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the culture was completed, The culture medium containing embryonic stem cells was uniformly transferred from one flask to three flasks, and MS culture medium containing 1.0 mg / L amphotericin B, 1.0% double-antibody, 1.0 mg / L 6-BA, and 1.0 mg / L NAA was added thereto, and 200 mg / L, 300 mg / L, and 500 mg / L cerium nitrate were added to the culture medium, respectively, until the amount of the culture medium in each flask reached about 1 / 3, and the culture was subcultured in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0164] (4) Collection of embryonic stem cells: The embryonic stem cells are subcultured for 48 hours and then collected separately. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain ginseng embryonic stem cells. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small pulverizer to obtain ginseng stem cell powder cultured in a culture medium containing different concentrations of cerium nitrate.

[0165] Test Example 4

[0166] This test example involves the effect of cerium nitrate on the culture of ginseng embryonic stem cells. Four comparative examples are set:

[0167] Comparative Example 9: No cerium nitrate was added to the B5 culture medium, and the rest was the same as in Example 7.

[0168] Comparative Example 10: 700 mg / L cerium nitrate was added to B5 culture medium, and the rest was the same as in Example 7.

[0169] Comparative Example 11: No cerium nitrate was added to the MS culture medium, and the rest was the same as in Example 8.

[0170] Comparative Example 12: 700 mg / L cerium nitrate was added to the MS medium, and the rest was the same as in Example 8.

[0171] The embryonic stem cells obtained in Examples 7-8 and Comparative Examples 9-12 were weighed and measured. Five experiments were performed and the average value was taken. The results are shown in Table 6.

[0172] Table 6 Comparison results of weight of ginseng embryonic stem cells

[0173]

[0174] From the above table, it can be concluded that the embryonic stem cells obtained by culturing in the MS medium with the addition of 200mg / L, 300mg / L, and 500mg / L cerium nitrate are at least 12% more than the blank group (Comparative Example 11), and when the concentration of cerium nitrate added is 300mg / L, 118.92g of embryonic stem cells are obtained; when the concentration of cerium nitrate added is 700mg / L, the weight of the embryonic stem cells obtained will be less than that of the blank group and the addition of 200mg / L, 300mg / L, and 500mg / L. Similarly, the embryonic stem cells obtained by culturing in the B5 medium with the addition of 300mg / L cerium nitrate are more than those of the blank group (Comparative Example 9), and the weight of the embryonic stem cells obtained by adding the B5 medium with a concentration of 700mg / L cerium nitrate is less than that of the blank group. Therefore, it is shown that the addition of 700mg / L cerium nitrate will inhibit the culture of stem cells; cerium nitrate in the concentration range of 200-500mg / L is beneficial to the culture of ginseng stem cells and can produce a large number of ginseng stem cells in a short time.

[0175] Example 9

[0176] The Araliaceae plant used in this embodiment is wild ginseng, and the method for culturing wild ginseng embryonic stem cells is as follows:

[0177] (1) Pretreatment of explants: Select wild ginseng with tender stems in good growth condition, rinse with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the soil and other attachments on the surface, then clean the surface of the wild ginseng with a 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of the wild ginseng to a 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a 3% sucrose aqueous solution, and add B5 culture medium containing 0.08% IAA (indoleacetic acid);

[0178] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the part containing the wild ginseng meristem in a biological safety cabinet, and the part is treated to prevent browning as soon as possible. After all the peeling is completed, it is cut into very small slices and transferred to a conical flask containing a culture medium for culture. The culture medium is a B5 culture medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol. In addition, cerium nitrate at a concentration of 300 mg / L is added to the culture medium, and the pH value is 6.2. The conical flask is placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells.

[0179] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and B5 medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol was added. In addition, cerium nitrate at a concentration of 300 mg / L was added to the medium. The conical flask was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the culture is completed, the culture medium containing embryonic stem cells is evenly transferred from one flask to three flasks, and B5 culture medium to which 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate, 0.100 mg / L triacontanol and 300 mg / L cerium nitrate are added until the amount of culture medium in each flask reaches about 1 / 3; subculture is performed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C.;

[0180] (4) Collection of embryonic stem cells: After the embryonic stem cells are subcultured for 48 hours, they can be collected. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation is completed, the supernatant is discarded to obtain the embryonic stem cells of wild ginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small grinder to obtain wild ginseng stem cell powder.

[0181] Example 10

[0182] The Araliaceae plant used in this embodiment is wild ginseng, and the method for culturing wild ginseng embryonic stem cells is as follows:

[0183] (1) Pretreatment of explants: Select wild ginseng with tender stems in good growth condition, rinse with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the soil and other attachments on the surface, then clean the surface of the wild ginseng with a 75% alcohol aqueous solution for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% sodium hypochlorite for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of the wild ginseng to a 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a sucrose content of about 3%, and add MS culture medium containing 0.08% IAA;

[0184] (2) Obtaining embryonic stem cells: The shoot tip treated in step (1) was carefully peeled off from the part containing the wild ginseng meristem in a biosafety cabinet, and the part was treated to prevent browning as soon as possible. After all the parts were peeled off, they were cut into very small slices and transferred to three triangular flasks containing culture medium for culture. The culture medium contained 1.0 mg / L amphotericin B and 1.0% double antibody (100X penicillin-streptomycin mixture) and 1.0 mg / L 6-BA, 1.0 mg / L L of NAA MS medium, and cerium nitrate at concentrations of 200 mg / L, 300 mg / L, and 500 mg / L was added to the medium respectively, and the pH value was 6.2. The conical flask was placed in a vertical constant temperature oscillator with a rotation speed of 110 r / min and a temperature of 22°C for shaking culture for 3 days; after the culture was completed, the larger flakes and fragments were first filtered out with a No. 2 sieve, and then a 40 um cell filter was used for secondary filtration and separation, and the filtrate was the filtrate containing embryonic stem cells;

[0185] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to three conical flasks, and MS medium containing 1.0 mg / L amphotericin B, 1.0% double-antibody, 1.0 mg / L 6-BA, and 1.0 mg / L NAA was added. In addition, cerium nitrate was added to the medium at concentrations of 200 mg / L, 300 mg / L, and 500 mg / L, respectively. The culture medium was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the culture was completed, , the culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks respectively, and MS culture medium with a concentration of 1.0 mg / L amphotericin B, a mass concentration of 1.0% double-antibody, 1.0 mg / L 6-BA, and 1.0 mg / L NAA was added thereto, and cerium nitrate with concentrations of 200 mg / L, 300 mg / L, and 500 mg / L was added to the culture medium respectively until the amount of the culture medium in each flask reached about 1 / 3, and the culture was subcultured in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0186] (4) Collection of embryonic stem cells: The embryonic stem cells are expanded and cultured for 48 hours and then collected separately. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of wild ginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small pulverizer to obtain wild ginseng stem cell powder cultured in a culture medium containing different concentrations of cerium nitrate.

[0187] Test Example 5

[0188] This test example involves the effect of cerium nitrate on the culture of wild ginseng embryonic stem cells. Four comparative examples are set:

[0189] Comparative Example 13: No cerium nitrate was added to the B5 culture medium, and the rest was the same as in Example 9.

[0190] Comparative Example 14: 700 mg / L cerium nitrate was added to B5 culture medium, and the rest was the same as in Example 9.

[0191] Comparative Example 15: No cerium nitrate was added to the MS culture medium, and the rest was the same as in Example 10.

[0192] Comparative Example 16: 700 mg / L cerium nitrate was added to the MS medium, and the rest was the same as in Example 10.

[0193] The embryonic stem cells obtained in Examples 9-10 and Comparative Examples 13-16 were weighed and measured. Five experiments were performed and the average value was taken. The results are shown in Table 7.

[0194] Table 7 Comparison results of wild ginseng embryonic stem cell weight

[0195]

[0196]

[0197] It can be concluded from the above table that the embryonic stem cells obtained by culturing in the MS medium with the addition of 200mg / L, 300mg / L, and 500mg / L cerium nitrate are at least 7% more than the blank group (Comparative Example 15), and when the concentration of cerium nitrate added is 300mg / L, 100.34g of embryonic stem cells are obtained; when the concentration of cerium nitrate added is 700mg / L, the weight of the embryonic stem cells obtained will be less than that of the blank group and the addition of 200mg / L, 300mg / L, and 500mg / L. Similarly, the embryonic stem cells obtained by culturing in the B5 medium with the addition of 300mg / L cerium nitrate are more than those of the blank group (Comparative Example 13), while the weight of the embryonic stem cells obtained by adding the B5 medium with a cerium nitrate concentration of 700mg / L is less than that of the blank group. Therefore, it is shown that the addition of 700mg / L cerium nitrate will inhibit stem cell culture. Cerium nitrate in a concentration range of 200-500mg / L is beneficial to the culture of wild ginseng stem cells and can produce a large number of wild ginseng stem cells in a short time.

[0198] Embodiment 11

[0199] The Araliaceae plant used in this embodiment is American ginseng, and the method for culturing American ginseng embryonic stem cells is as follows:

[0200] (1) Pretreatment of explants: Select American ginseng with tender stems in good growth condition, rinse with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the soil and other attachments on the surface, then clean the surface of the American ginseng with a 75% alcohol aqueous solution by volume for 20 seconds, then wash it with sterile water for 3 times, then disinfect it with a disinfectant containing 0.5% sodium hypochlorite by volume for 5 minutes, and then wash it with sterile water for 3 times; cut off all the cleaned stem tips, treat the stem tips with a 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of the American ginseng to a 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a sucrose mass concentration of about 3%, and add B5 culture medium containing 0.08% IAA (indoleacetic acid) by mass concentration;

[0201] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) is carefully peeled off from the part containing the meristem of American ginseng in a biological safety cabinet, and the part is treated to prevent browning as soon as possible. After all the peeling is completed, it is cut into very small slices, and transferred to a conical flask containing a culture medium for culture. The culture medium is a B5 culture medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol, and 300 mg / L cerium nitrate is added to the culture medium, and the pH value is 6.2. The conical flask is placed in a vertical constant temperature oscillator with a rotation speed of 110 r / min and a temperature of 22° C. for shaking culture for 3 days. After the culture is completed, the larger slices and fragments are first filtered out with a No. 2 sieve, and then a 40 um cell filter is used for secondary filtration and separation. The filtrate is the filtrate containing embryonic stem cells;

[0202] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and B5 medium containing 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol was added. In addition, cerium nitrate at a concentration of 300 mg / L was added to the medium. The conical flask was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the culture was completed, the culture medium containing embryonic stem cells was evenly transferred from one conical flask to three conical flasks, and B5 medium added with 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol and 300 mg / L cerium nitrate was continued to be added thereto until the amount of the culture medium in each conical flask reached about 1 / 3. Subculture was performed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0203] (4) Collection of embryonic stem cells: The embryonic stem cells are expanded and cultured for 48 hours and then collected. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of American ginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small grinder to obtain American ginseng stem cell powder.

[0204] Example 12

[0205] The Araliaceae plant used in this embodiment is American ginseng, and the method for culturing American ginseng embryonic stem cells is as follows:

[0206] (1) Pretreatment of explants: Select American ginseng with tender stems that are in good growth condition, rinse them with clean water first, and carefully brush the key parts and some places that are difficult to rinse with a brush to clean the dirt and other attachments on the surface, then clean the surface of the American ginseng with a 75% alcohol aqueous solution by volume for 20 seconds, then wash it three times with sterile water, then disinfect it with a disinfectant containing 0.5% sodium hypochlorite by volume for 5 minutes, and then wash it three times with sterile water; cut off all the cleaned stem tips, treat the stem tips with a 20% sucrose aqueous solution at room temperature in a dark environment for 24 hours, pour out the sucrose solution, and clean the stem tips with sterilized filter paper using the siphon principle; then transfer the entire stem tip of the American ginseng to a 1.5% sucrose aqueous solution for 10 minutes, and finally transfer it to a sucrose aqueous solution with a sucrose content of about 3%, and add MS culture medium containing 0.08% IAA by mass concentration;

[0207] (2) Obtaining embryonic stem cells: The stem tip treated in step (1) was carefully peeled off from the part containing the meristem of American ginseng in a biological safety cabinet, and the part was treated to prevent browning as soon as possible. After all the parts were peeled off, they were cut into very small slices and transferred to 3 triangular flasks containing culture medium for culture. The culture medium contained 1.0 mg / L amphotericin B and 1.0% double antibody (100X penicillin-streptomycin mixture) and 1.0 mg / L 6-BA, 1.0 mg / L MS medium containing NAA, and cerium nitrate at concentrations of 200 mg / L, 300 mg / L, and 500 mg / L was added to the medium, respectively, and the pH value was 6.2. The conical flask was placed in a vertical constant temperature oscillator, with a speed of 110 r / min and a temperature of 22°C, and the shaking culture was carried out for 3 days; after the culture was completed, the larger flakes and fragments were first filtered out with a No. 2 sieve, and then a 40 um cell filter was used for secondary filtration and separation, and the filtrate was the filtrate containing embryonic stem cells;

[0208] (3) Expansion culture of embryonic stem cells: The filtrate containing embryonic stem cells obtained by the final filtration was transferred to a conical flask, and MS medium containing 1.0 mg / L amphotericin B, 1.0% double-antibody, 1.0 mg / L 6-BA, and 1.0 mg / L NAA was added. In addition, cerium nitrate was added to the medium at concentrations of 200 mg / L, 300 mg / L, and 500 mg / L, respectively. The culture medium was placed in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22° C. for shaking culture. The culture time was 2 days. After the culture was completed, the cells were divided into The culture medium containing embryonic stem cells was evenly transferred from one flask to three flasks, and MS culture medium with a concentration of 1.0 mg / L amphotericin B, a mass concentration of 1.0% double-antibody, 1.0 mg / L 6-BA, and 1.0 mg / L NAA was added thereto. In addition, cerium nitrate with concentrations of 200 mg / L, 300 mg / L, and 500 mg / L was added to the culture medium, respectively, until the amount of the culture medium in each flask reached about 1 / 3, and then the culture was subcultured in a vertical constant temperature oscillator at a speed of 110 r / min and a temperature of 22°C;

[0209] (4) Collection of embryonic stem cells: The embryonic stem cells are subcultured for 48 hours and then collected separately. The culture medium containing the embryonic stem cells is poured into a centrifuge bottle, which is then balanced and placed in a centrifuge at a speed of 2200 r / min for 10 minutes. After the centrifugation, the supernatant is discarded to obtain the embryonic stem cells of American ginseng. The obtained embryonic stem cells are freeze-dried or microwave-dried. After complete drying, they are crushed and sieved using a small pulverizer to obtain American ginseng stem cell powder cultured in a culture medium containing different concentrations of cerium nitrate.

[0210] Test Example 6

[0211] This test example involves the effect of cerium nitrate on the culture of American ginseng embryonic stem cells. Four comparative examples are set:

[0212] Comparative Example 17: No cerium nitrate was added to the B5 culture medium, and the rest was the same as in Example 11.

[0213] Comparative Example 18: 700 mg / L cerium nitrate was added to B5 culture medium, and the rest was the same as Example 11.

[0214] Comparative Example 19: No cerium nitrate was added to the MS culture medium, and the rest was the same as in Example 12.

[0215] Comparative Example 20: 700 mg / L cerium nitrate was added to the MS medium, and the rest was the same as in Example 12.

[0216] The embryonic stem cells obtained in Examples 11-12 and Comparative Examples 17-20 were weighed and measured. Five experiments were performed and the average value was taken. The results are shown in Table 8.

[0217] Table 8 Comparison results of weight of American ginseng embryonic stem cells

[0218]

[0219] From the above table, it can be concluded that the embryonic stem cells obtained by culturing in the MS medium with the addition of 200mg / L, 300mg / L, and 500mg / L cerium nitrate are at least 6% more than the blank group (Comparative Example 19), and when the concentration of cerium nitrate added is 300mg / L, 117.33g of embryonic stem cells can be obtained; when the concentration of cerium nitrate added is 700mg / L, the weight of the embryonic stem cells obtained will be less than that of the blank group and the addition of 200mg / L, 300mg / L, and 500mg / L. Similarly, the embryonic stem cells obtained by culturing in the B5 medium with the addition of 300mg / L cerium nitrate are more than those of the blank group (Comparative Example 17), while the weight of the embryonic stem cells obtained by adding the B5 medium with a cerium nitrate concentration of 700mg / L is less than that of the blank group. Therefore, it is shown that the addition of 700mg / L cerium nitrate will inhibit stem cell culture. Cerium nitrate in the concentration range of 200-500mg / L is beneficial to the culture of American ginseng stem cells and can produce a large number of American ginseng stem cells in a short time.

[0220] Embodiment 13

[0221] This example involves the gene identification of embryonic stem cells of Araliaceae plants, taking wild ginseng as an example, the specific steps are as follows:

[0222] 1. Extraction of plant RNA

[0223] The wild ginseng embryonic stem cells obtained by culture in Example 10 and the plant somatic cells extracted by the existing extraction method were centrifuged at room temperature for 5 minutes at 1000rpm, and then the supernatant was discarded and the culture medium was removed; washed once with pre-cooled PBS; about 100mg of cells were taken and 1mL TRIzol reagent was added; then the cell lysate was transferred to a 1.5mL RNase-free EP tube, placed on ice, and allowed to stand for 5 minutes; 200uL chloroform was added to each tube, and the mixture was allowed to stand on ice for 10 minutes after being fully mixed; centrifuged at 13000rpm for 15 minutes at 4°C; a new EP tube was taken, 500uL isopropanol was added, and pre-cooled on ice; after centrifugation, the upper aqueous phase was transferred to the new EP tube; allowed to stand on ice, and washed once with a 70% volume concentration ethanol aqueous solution and anhydrous ethanol; centrifuged at 12000rpm for 5 minutes, the supernatant was removed, and the RNA precipitate was air-dried or vacuum-dried for 5-10 minutes; the RNA was dissolved in 30-50uL Spectrophotometric analysis was performed in DEPC-treated deionized water to determine sample concentration and purity;

[0224] 2. Reverse transcription of cDNA

[0225] RNA was reverse transcribed into cDNA using the TAKARA cDNA Library Construction Kit;

[0226] 3. Fluorescence quantitative detection

[0227] cDNA transcribed from embryonic stem cells and somatic cells was diluted 10 times as template, and Actin was used as the internal reference gene to detect the expression of genes WUS and CLV3; TB Green Premix ExTaq II of Baoriyi Biotechnology (Beijing) Co., Ltd. was used for fluorescence quantitative PCR; the reaction system was cDNA 2μL, TB Green Premix Ex Taq II 10μL, upstream and downstream primers 0.8μL each and ddH2O 6.4μL; the reaction procedure was 95℃30s; 95℃5s, 55℃34s, 40 cycles; 2 biological replicates, 2 technical replicates; the 2-△△Ct method was used to process the relative expression of genes. The results are shown in Figure 1 shown.

[0228] The primers for the internal reference gene Actin are:

[0229] F:GCTCCATCCTTGCTTCTCTTAG,

[0230] R: CTGAACACACCACCTCCTTTAT.

[0231] The WUS primer was WUS-L: CCTCCCTCTGCCTTTCAAGA;

[0232] WUS-R:GAGAGGTTCCGGTGAGAGAG.

[0233] The primer for CLV3 is CLV3-F: ACGACTGGAGTGGTTCCTTT,

[0234] CLV3-R:TGTTCTTGAGTCGGGTTCCA.

[0235] from Figure 1 It can be seen that the expression levels of WUS and CLV3 genes in stem cells are significantly higher than those in somatic cells, indicating that the wild ginseng stem cells isolated and cultured in Example 10 are indeed embryonic stem cells.

[0236] Embodiment 14

[0237] This embodiment relates to a method for inducing high production of ginsenosides from embryonic stem cells of Araliaceae plants. Taking the Panax notoginseng obtained by culture in Example 2 as an example, the specific steps are as follows:

[0238] Add 400 mL of MS culture medium containing the same concentration of Panax notoginseng embryonic stem cells into 1000 mL conical flasks, and then add methyl jasmonate solution to make the final concentrations of 0, 25, 50, and 100 μmol / L, respectively. Then, place the conical flasks in a shaker at a temperature of 23°C and a speed of 100 r / min for shaking culture; after 5 days, the Panax notoginseng embryonic stem cells obtained by induced culture are centrifuged and dried, and finally the Panax notoginseng embryonic stem cell powder is obtained.

[0239] In this example, the content of total saponins of Panax notoginseng was determined, specifically as follows: standard substances Panax notoginseng saponin R1, ginsenoside Rg1, ginsenoside Re, ginsenoside Rb1, and ginsenoside Rd were weighed and dissolved in a methanol aqueous solution with a volume concentration of 70%, and then diluted to a standard solution with a final concentration of 1 mg / mL; a sample of Panax notoginseng embryonic stem cell powder to be tested was weighed and dissolved in a methanol aqueous solution with a volume concentration of 70% to a final concentration of 2.5 mg / mL;

[0240] A Waters Xevo TQ-S mass spectrometer was used with acetonitrile as mobile phase A and water as mobile phase B, and gradient elution was performed according to the method for content determination under the Panax notoginseng total saponins item in the Chinese Pharmacopoeia 2020 edition (Part 1); the column temperature was 25°C; the flow rate was 1.5 mL / min; the detection wavelength was 203 nm; the separation degree of ginsenoside Rg1 and ginsenoside Re should be greater than 1.5; the theoretical plate number calculated based on the ginsenoside Rg1 peak should not be less than 6000; the sample to be tested and the standard solution were accurately aspirated for determination, and the different contents of various saponins in the Panax notoginseng embryonic stem cell powder were obtained by analysis and calculation, and the results are shown in Table 9.

[0241] Table 9 Notoginsenoside content

[0242]

[0243] It can be seen from the results in Table 9 that the addition of methyl jasmonate produces nearly 5 times the amount of saponins as compared to the blank. The addition of 50 μmol / L of methyl jasmonate can induce Panax notoginseng embryonic stem cells to produce more notoginseng saponins, thereby significantly increasing the content of total saponins.

[0244] The culture medium of the present invention can rapidly and efficiently culture embryonic stem cells of Araliaceae plants, and the cultured embryonic stem cells can be subsequently used to efficiently produce compounds such as ginsenosides that are currently in high demand, so as to adapt to large-scale production.

[0245] Embodiment 15

[0246] This embodiment relates to a method for inducing high production of ginsenosides from embryonic stem cells of Araliaceae plants. Taking the wild ginseng embryonic stem cells cultured in Example 10 as an example,

[0247] The specific steps are as follows: add 400 mL of MS culture medium containing wild ginseng embryonic stem cells at the same concentration into 1000 mL conical flasks, and then add a mixed solution of methyl jasmonate and indoleacetic acid to make the final concentrations of methyl jasmonate 0, 50, 100, and 200 μmol / L, respectively, and the final concentration of indoleacetic acid is 50 μmol / L; then put the conical flask into a shaker at a temperature of 23°C and a speed of 100 r / min for shaking culture; after 5 days, the wild ginseng embryonic stem cells obtained by induced culture are centrifuged and dried to finally obtain wild ginseng embryonic stem cell powder.

[0248] This example measures the content of total ginsenosides in wild ginseng. The measurement method is:

[0249] (1) Instruments and reagents:

[0250] Instrument: H-Class high performance liquid chromatograph;

[0251] (2) Reagents: methanol, 1% vanillin perchloric acid test solution, 77% sulfuric acid aqueous solution;

[0252] (3) Solution preparation:

[0253] Preparation of sample solution: accurately weigh 30 mg of sample powder, place in a 10 mL volumetric flask, add methanol and ultrasonically dissolve and dilute to scale, shake well, filter through a membrane, and take the filtrate to obtain the solution;

[0254] Preparation of standard solution: Accurately weigh appropriate amounts of ginsenoside Rg1 reference substance, ginsenoside Re reference substance and ginsenoside Rd reference substance, and add methanol to make 1 mL of ginsenoside Rg1 (C 42 H72 O 14 )0.3mg, ginsenoside Re(C 48 H 82 O 18 )0.5mg and ginsenoside Rd(C 48 H 82 O 18 )0.2mg solution, that is;

[0255] (4) Determination:

[0256] Accurately pipette 20 μL of sample solution and standard solution respectively, inject into liquid chromatograph, and measure to obtain the result.

[0257] The chromatographic conditions were as follows:

[0258] Octadecylsilane bonded silica gel was used as the filler; acetonitrile was used as the mobile phase A, 0.1% phosphoric acid solution was used as the mobile phase B, and elution was performed according to the program in Table 10; the column temperature was 30°C; the flow rate was 1.3 mL per minute; and the detection wavelength was 203 nm.

[0259] Table 10 Elution program

[0260] Time (minutes) Mobile phase A (%) Mobile phase B (%) 0～30 19 81 30～35 19→24 81→76 35～60 24→40 76→60

[0261] The total saponin content in wild ginseng cell powder was measured experimentally and is shown in Table 11.

[0262] Table 11 Experimental determination of total ginsenoside content

[0263]

[0264] Experimental conclusion: As can be seen from Table 11, the content of total ginsenosides in wild ginseng obtained from the culture medium with added methyl jasmonate solution is significantly higher than that from the culture medium without methyl jasmonate. In addition, when the concentration of added methyl jasmonate solution is 50 μmol / L, the effect is best, and more ginsenosides can be cultivated and produced.

[0265] The above is only a preferred embodiment of the present invention, and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with the present invention can make some changes or modify the technical contents suggested above into equivalent embodiments without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the solution of the present invention.

Claims

1. A culture medium for embryonic stem cells of Araliaceae plants, characterized in that: The culture medium comprises a basic culture medium, to which 200 mg / L-500 mg / L of cerium nitrate is added; the basic culture medium is selected from one of MS culture medium and B5 culture medium.

2. The culture medium according to claim 1, characterized in that The basic culture medium is MS culture medium, to which 0.8-1.3 mg / L amphotericin B and a double antibody with a mass concentration of 0.9-1.2% are added, wherein the double antibody is a 100X penicillin-streptomycin mixture, 0.8-1.2 mg / L 6-BA and 0.8-1.3 mg / L NAA.

3. The culture medium according to claim 2, characterized in that The MS culture medium was supplemented with 1.0 mg / L amphotericin B, 1.0% double-antibody with a mass concentration of 1.0%, 1.0 mg / L 6-BA and 1.0 mg / L NAA.

4. The culture medium according to claim 1, characterized in that The basic culture medium is B5 culture medium, to which 0.098-0.120 mg / L of 6-BA, 13-18 mg / L of sucrose, 0.48-0.52 mg / L of methyl jasmonate and 0.099-0.130 mg / L of triacontanol are added.

5. The culture medium according to claim 4, characterized in that The B5 medium was supplemented with 0.100 mg / L 6-BA, 15 mg / L sucrose, 0.50 mg / L methyl jasmonate and 0.100 mg / L triacontanol.

6. A method for culturing embryonic stem cells of Araliaceae plants, characterized in that: include: (1) Explant pretreatment: Take tender stems of Araliaceae plants, wash and disinfect them, and cut off the stem tips for pretreatment; (2) Obtaining embryonic stem cells: peeling off meristems from the shoot apex treated in step (1), soaking them in an ascorbic acid solution to prevent browning, and then transferring them to a culture medium for culturing, wherein the culture medium includes a basal culture medium, and 200 mg / L-500 mg / L of cerium nitrate is added to the basal culture medium; the basal culture medium is selected from one of MS culture medium and B5 culture medium; filtering after the culturing to obtain a filtrate containing embryonic stem cells; (3) Expanding the culture: transferring the filtrate containing embryonic stem cells obtained in step (2) into a culture medium for culture. After the culture is completed, the culture medium containing embryonic stem cells is divided into several portions, transferred to several culture containers, and then the culture medium is added to each of the containers for subculture. (4) Collection: centrifuging the embryonic stem cell culture medium obtained by subculture in step (3) and discarding the supernatant to obtain embryonic stem cells of Araliaceae plants; alternatively, drying, crushing, and sieving the obtained embryonic stem cells to obtain Araliaceae plant stem cell powder.

7. The culture method according to claim 6, characterized in that: In steps (2) and (3), The culture medium comprises: a basic culture medium is an MS culture medium, to which is added 200 mg / L-500 mg / L of cerium nitrate, 0.8-1.3 mg / L of amphotericin B, and a double antibody with a mass concentration of 0.9-1.2%, wherein the double antibody is a 100X penicillin-streptomycin mixture, 0.8-1.2 mg / L of 6-BA, and 0.8-1.3 mg / L of NAA; Alternatively, the culture medium comprises: the basic culture medium is B5 culture medium, to which 200 mg / L-500 mg / L of cerium nitrate, 0.098-0.120 mg / L of 6-BA, 13-18 mg / L of sucrose, 0.48-0.52 mg / L of methyl jasmonate and 0.099-0.130 mg / L of triacontanol are added.

8. The culture method according to claim 6 or 7, characterized in that: In step (1), the pretreatment of the cut stem tip includes: first treating the stem tip with a sucrose solution having a mass concentration of 20% for 24 hours, cleaning the sucrose solution on the surface of the stem tip after the treatment, then transferring the stem tip to a sucrose solution having a mass concentration of 1.5% for 10 minutes, and finally transferring it to a sucrose solution having a mass concentration of 3%, and adding a basal culture medium containing IAA having a mass concentration of 0.08%; In step (1), the cleaning and disinfection comprises: rinsing the stem tip with clean water, then cleaning it with an alcohol aqueous solution having a volume concentration of 75%, cleaning it with sterile water, then disinfecting it with a disinfectant containing sodium hypochlorite having a volume concentration of 0.5%, and then cleaning it with sterile water; In steps (2) and (3), the culture temperature is 20-25°C, the shaking speed is 80-200r / min, and the culture time is 3-7 days.

9. A method for inducing high saponin production in embryonic stem cells of Araliaceae plants, characterized in that: include: Inoculating Araliaceae embryonic stem cells into a basal culture medium, adding a methyl jasmonate aqueous solution to a final concentration of 25-100 μmol / L, and performing shaking induction culture; after a certain period of time, centrifuging and drying the obtained Araliaceae embryonic stem cells to obtain Araliaceae embryonic stem cell powder with high saponin production; Alternatively, a mixed solution of methyl jasmonate and indoleacetic acid is added to the basal culture medium to make the final concentration of methyl jasmonate 25-100 μmol / L and the final concentration of indoleacetic acid 50 μmol / L, and shaking induction culture is performed; after a certain period of time, the obtained Araliaceae embryonic stem cells are centrifuged and dried to obtain Araliaceae embryonic stem cell powder with high saponin production.

10. The culture medium according to any one of claims 1 to 5, or the culture method according to claim 6, or the method according to claim 9, characterized in that: The Araliaceae plants include ginseng, wild ginseng, American ginseng, tree ginseng, variegated tree ginseng, large ginseng, sea cucumber, five-leaf ginseng, Panax notoginseng, thorny thorn, angelica, Schefflera arborvitae, Schefflera chinensis, white sedge, Acanthopanax odoratus, Acanthopanax senticosus, Acanthopanax sessile, Aralia chinensis, Aralia chinensis, Aralia dasyphylla, Aralia liaotungensis, Aralia thorny, Acer truncatum, Acer scutellariae, Acer scutellariae, Acer scutellariae, Acer scutellariae, Acer truncatum, Acer scutellariae, Acer truncatum, Acer truncatum, Acer truncatum palmatum, Acer truncatum, and Ivy.

Images