Method for quantitatively analyzing gene copy number by adopting high-order multiple digital PCR (Polymerase Chain Reaction) technology

Abstract

The invention provides a method for quantitatively analyzing a gene copy number by adopting a high-order multiple digital PCR (Polymerase Chain Reaction) technology. The primer probe combination for copy number detection can specifically amplify and detect exons No.4, No.45 and No.65 of the DMD gene. The method comprises the step of judging the copy number of various target genes in the same fluorescence channel by using a digital PCR method. The method provided by the invention is simple and convenient in analysis, accurate and reliable in result, and capable of effectively detecting the copy number of various genes in the same fluorescence channel.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a method for quantitatively analyzing gene copy number by using high-order multiplex digital PCR technology. Background Art

[0002] As a new generation of PCR technology, digital PCR can perform absolute quantitative detection of target genes. With this unique advantage, digital PCR has been widely used in many fields such as clinical diagnosis, disease treatment, and drug development. However, the mainstream PCR instruments on the market can only detect 4 to 5 fluorescence channels at most, which means that one reaction can only detect 4 to 5 gene loci at most. If more gene target detection is required, the number of reactions can only be expanded, which not only increases the operation process and the detection cost, but also greatly increases the probability of contamination or other errors in the detection work.

[0003] The low detection flux greatly limits the application scope of digital PCR instruments. In order to improve the detection flux of digital PCR instruments, the method that is generally favored by the industry is to use the advantages of digital PCR quantitative detection and improve the detection flux through high-order multiplex detection technology. That is, different probe concentrations are set for different target genes in the same fluorescence channel, so that the fluorescence signal of each probe is concentrated in different fluorescence intensity areas. Different probes and gene sites can be identified according to the areas of different fluorescence intensities.

[0004] High-order multiplex detection technology can detect 2 to 4 fluorescence intervals in a single fluorescence channel, which increases the detection sites of digital PCR exponentially and greatly improves the detection throughput. It is the focus of current development in the field of digital PCR technology. However, due to the different combinations of different target genes in the chip reaction partitions, different concentrations of fluorescent probes may be distributed in the same reaction well. At this time, the fluorescence gradient in the well will deviate, affecting the detection of the target. Therefore, although high-order multiplex technology in the field of digital PCR can improve the detection throughput, it can only achieve a certain degree of qualitative detection of each target, and cannot achieve quantitative detection of each target. Summary of the invention

[0005] In order to solve the current problems of high-order multiplex technology and promote the development of the digital PCR field, the present invention has developed a detection method that can quantitatively analyze the results of high-order multiplex digital PCR, and realize an analysis method that can accurately quantify three different gene targets in the same fluorescence channel, so as to improve the application field of digital PCR technology.

[0006] In conventional qPCR reactions, each fluorescence channel can only detect one gene locus. In the digital PCR reaction, the present invention can distinguish different amplification sites in the same fluorescence channel according to the difference in fluorescence intensity of amplification products at different sites, which can greatly improve the detection throughput.

[0007] The basic principle of the present invention is to design detection sites for three genes, A, B and C, in one fluorescent channel of the digital PCR reaction. In this three-order reaction, excluding the baseline negative point, there are a total of 7 combinations of positive reaction wells, namely, 3 positive wells with 3 products each being single positive; 3 positive wells with 3 products being double positive; and 1 positive well with 3 products being triple positive.

[0008] It should be noted that when setting the A, B and C gene fluorescent probes, the concentration of each probe should be adjusted through preliminary experiments so that the fluorescence value of the C single-positive well is higher than the fluorescence value of the A+B double-positive well to ensure that the bands can be clearly separated.

[0009] The product bands are arranged in order of fluorescence intensity from the baseline upward, as follows:

[0010] 1. In the single positive well of the target gene A product, the fluorescent probe concentration of A is the lowest, so its product fluorescence value is the lowest and is located in the first layer of each product band;

[0011] 2. In the single positive well of the target gene B product, the concentration of the B fluorescent probe is slightly higher than that of the A fluorescent probe, and the fluorescence value of its product is also higher than that of the gene A product, and is located in the second layer of the product band;

[0012] 3. Double positive wells for target gene A and B products. This layer of reaction wells contains both A and B products, which is the A+B layer. Therefore, its fluorescence value is higher than that of gene B product and is located in the third layer of the reaction strip.

[0013] 4. For the single positive well of the target gene C product, the concentration of C fluorescent probe should be higher than that of B fluorescent probe, and its product fluorescence value should be higher than that of the double positive wells of genes A and B, and it is located in the 4th layer of the product strip;

[0014] 5. The three layers of A single positive, B single positive and AB double positive located below the C product band overlap with the C product respectively. When they are located in the same hole, C+A layer, C+B layer and C+B+A layer will be generated above the C band respectively.

[0015] At this time, if there is no mutual interference between the target sites of A, B, and C genes, each of them diffuses independently between the reaction wells, and the distribution of each gene conforms to the Poisson distribution. Therefore, if the seven bands can be clearly separated in the third-order reaction, the copy number analysis of the three genes can be performed separately.

[0016] 1. When the threshold line is set between the C layer and the A+B layer, the positive wells above the threshold line include all C positive points. At this time, the template concentration of the C gene can be calculated based on the number of all C positive wells, and then the copy number of the C gene can be analyzed by comparing it with the internal reference gene.

[0017] 2. Similarly, when the threshold line is set between the B layer and the A layer, the positive wells above the threshold line include all the positive wells of C and B. At this time, the combined template concentration and copy number of genes C and B can be calculated, and the copy number of gene B can be obtained by subtracting the copy number of gene C from it.

[0018] 3. Similarly, when the threshold line is set between layer A and the baseline, the positive wells above the threshold line include all the positive wells of C, B and A. At this time, the overall template concentration of C, B and A genes can be calculated.

[0019] The copy number of gene A can be obtained by subtracting the copy number of gene C and gene B from it.

[0020] 4. Similarly, when the fourth target D is added to the reaction, its probe concentration should be adjusted and optimized so that the fluorescence value of its product is higher than the fluorescence value of the three positive wells C+B+A. The copy number of the D target can be analyzed according to the above method.

[0021] The method provided by the present invention is simple and accurate, and can analyze multiple targets in the same fluorescence channel, thereby realizing quantitative analysis of high-order multiple reactions in digital PCR.

[0022] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0023] In a first aspect, the present invention provides a method for high-order multiplex quantitative analysis of digital PCR, wherein the concentration of fluorescent probes for each target is optimized and combined so that positive wells of various combinations can be clearly distinguished.

[0024] To achieve this goal, the product fluorescence value of each target should be higher than the fluorescence value of the positive wells that contain all the targets below this fluorescence value. When performing copy number analysis, the threshold line is set slightly below the fluorescence area of ​​each single positive well of each target. At this time, the positive points above the threshold line are all positive wells that include one or more positive sites, and the copy number of the corresponding target or the total copy number of multiple targets can be analyzed. The copy number of each target can be obtained by subtracting the targets in order from high to low.

[0025] In a second aspect, the present invention provides a primer probe combination, reaction reagent and quality control reagent for detecting the copy number of exon 4 (A), exon 45 (B) and exon 65 (C) of the dystrophin gene (DMD gene). The DMD gene is the main pathogenic gene of Duchenne muscular dystrophy, Becker muscular dystrophy and X-linked dilated cardiomyopathy. Exon deletion variation of the DMD gene is the most common variation type in the pathogenic variation of the DMD gene, accounting for about 70%.

[0026] The primer pair for specifically amplifying exon 4 of the DMD gene includes a forward primer and a reverse primer;

[0027] The forward primer includes the nucleotide sequence shown in SEQ ID No.1;

[0028] The reverse primer includes the nucleotide sequence shown in SEQ ID No.2.

[0029] SEQ ID NO.1: GTGAATATTGGAAGTACTGACATCGT;

[0030] SEQ ID NO.2: GGATTCTTACCTGCCAGTGGA

[0031] The primer pair for specifically amplifying the DMD gene No. 45 includes a forward primer and a reverse primer;

[0032] The forward primer includes the nucleotide sequence shown in SEQ ID No.3;

[0033] The reverse primer includes the nucleotide sequence shown in SEQ ID No.4.

[0034] SEQ ID No.3: TTGGGAAGCCTGAATCTGCG

[0035] SEQ ID No.4: AGATCTGTCGCCCTAACCTCT

[0036] The primer pair for specifically amplifying the DMD gene No. 65 includes a forward primer and a reverse primer;

[0037] The forward primer includes the nucleotide sequence shown in SEQ ID No.5;

[0038] The reverse primer includes the nucleotide sequence shown in SEQ ID No.6.

[0039] SEQ ID No.5:CAAGAAAATGACCAGCCCA

[0040] SEQ ID No.6: ACATATCCACGCAGAGAGGG65

[0041] Preferably, the probes for detecting exons 4, 45 and 65 of the DMD gene include nucleotide sequences shown in SEQ ID No. 7 to SEQ ID No. 9.

[0042] SEQ ID No.7: TGGAAATCATAAACTGACTCTT

[0043] SEQ ID No.8:CAGGAGGTCTGCAAAC

[0044] SEQ ID No.9:TGACCGCCTGGAGCA

[0045] Preferably, the 5' end of the probe is modified with a fluorescent dye, and the 3' end of the probe is modified with a quencher.

[0046] Preferably, the 3' end of the probe is also connected to an MGB group.

[0047] Preferably, the fluorescent dye comprises HEX.

[0048] Preferably, the quencher comprises TAMRA.

[0049] Preferably, the primer-probe combination for detecting the copy number of the DMD gene further comprises a primer pair and a probe for specifically amplifying and detecting the internal reference gene GAPDH.

[0050] Preferably, the primer pair for specifically amplifying the internal reference gene GAPDH comprises a forward primer and a reverse primer.

[0051] Preferably, the forward primer comprises the nucleotide sequence shown in SEQ ID No.10.

[0052] Preferably, the reverse primer comprises the nucleotide sequence shown in SEQ ID No.11.

[0053] Preferably, the probe for detecting the internal reference gene GAPDH comprises the nucleotide sequence shown in SEQ ID No.12.

[0054] SEQ ID No.7: AAGCCTGCCGGTGACTAAC;

[0055] SEQ ID No.8: CTCGCTCCACCTGACTTCC;

[0056] SEQ ID No.9: CGCTCCTGCCTCGA.

[0057] Preferably, the 5' end of the probe is modified with a fluorescent dye, and the 3' end of the probe is modified with a quencher.

[0058] Preferably, the 3' end of the probe is also connected to an MGB group.

[0059] Preferably, the fluorescent dye comprises ROX.

[0060] Preferably, the quencher comprises BHQ.

[0061] In the present invention, the GAPDH gene is used as an internal reference gene, with good amplification effect and high detection efficiency.

[0062] The application scope of the present invention includes not only the DMD gene copy number detection listed above, but also genes outside the above application scope that are not listed. Due to space limitations and for the sake of simplicity, the present invention no longer exhaustively lists the specific genes included in the scope.

[0063] In a third aspect, the present invention provides a kit for detecting the copy number of a DMD gene, wherein the kit comprises a primer-probe combination for detecting the copy number of a DMD gene, a reaction reagent and a quality control reagent.

[0064] Preferably, the reaction reagents include sample DNA extraction reagents and detection system PCR reaction solution.

[0065] Preferably, the PCR reaction solution of the detection system includes DNA polymerase, enzyme buffer, MgCl2 and dNTPs.

[0066] Preferably, the quality control reagents include DMD gene zero copy quality control products and DMD gene single copy quality control products.

[0067] Preferably, the DMD gene zero copy quality control product is a plasmid containing two copies of the internal reference gene GAPDH.

[0068] Preferably, the DMD gene single copy quality control product is a plasmid containing a single copy of the DMD gene and two copies of the internal reference gene GAPDH.

[0069] Preferably, the two-copy DMD gene quality control product is a plasmid containing two copies of the DMD gene and two copies of the internal reference gene GAPDH.

[0070] In the present invention, the kit for detecting the copy number of the DMD gene is designed with a forward primer, a reverse primer and an MGB probe primer for detecting the DMD gene, and the primers have high amplification efficiency, and can accurately detect and determine the DMD genotype of the patient by performing copy number detection on plasmid standards and samples submitted for inspection. By adjusting the reaction conditions such as the concentration and annealing temperature of the forward primer, the reverse primer and the MGB probe, the amplification efficiency can be optimized.

[0071] In a fourth aspect, the present invention provides a method for using the kit for detecting the copy number of the DMD gene according to the second aspect for the purpose of non-disease diagnosis and / or treatment, the method comprising the following steps:

[0072] (1) collecting and processing a DNA sample to be tested, adding the DNA sample to be tested and a primer probe combination for detecting the copy number of the human DMD gene to a PCR reaction solution of the detection system, mixing, and obtaining a PCR system;

[0073] (2) Amplify the PCR system on a digital PCR platform to obtain the positive points of DMD and GAPDH;

[0074] (3) The DMD gene copy number analysis was performed using the ratio of the positive points between DMD and GAPDH.

[0075] Preferably, the concentration of the DNA sample to be tested is 5-100 ng / μL, for example, it can be 5 ng / μL, 10 ng / μL, 20 ng / μL, 30 ng / μL, 40 ng / μL, 50 ng / μL, 60 ng / μL, 70 ng / μL, 80 ng / μL, 90 ng / μL or 100 ng / μL, etc.

[0076] Preferably, the final concentrations of the forward primer and the reverse primer for specifically amplifying the DMD gene in the PCR system are independently 0.1 to 1 μM, for example, 0.1 μM, 0.3 μM, 0.5 μM, 0.7 μM, 0.9 μM or 1 μM.

[0077] Preferably, the final concentrations of the forward primer and the reverse primer for specifically amplifying the internal reference gene GAPDH in the PCR system are independently 0.1 to 1 μM, for example, 0.1 μM, 0.3 μM, 0.5 μM, 0.7 μM, 0.9 μM or 1 μM.

[0078] Preferably, the final concentrations of the probe for detecting the DMD gene and the probe for detecting the internal reference gene GAPDH in the PCR system are independently 0.1 to 1 μM, for example, 0.1 μM, 0.3 μM, 0.5 μM, 0.7 μM, 0.9 μM or 1 μM.

[0079] Preferably, the final concentration of the DNA polymerase in the PCR system is 0.02-0.1 U / μL, for example, 0.02 U / μL, 0.03 U / μL, 0.05 U / μL, 0.07 U / μL, 0.09 U / μL or 0.1 U / μL.

[0080] Preferably, the method of use further comprises the step of performing synchronous detection using a quality control reagent.

[0081] Preferably, in step (3), the criteria for determining the DMD gene copy number include:

[0082] If the ratio of the positive points of exon 4, exon 45 or exon 65 of the DMD gene to the internal reference gene GAPDH is 0.80 to 1.20, it is judged that the DMD gene has 2 copies;

[0083] If the ratio of the positive points of exon 4, exon 45 or exon 65 of the DMD gene to the internal reference gene GAPDH is 0.3 to 0.7, the copy number of the DMD gene is judged to be 1 copy;

[0084] When the ratio of the positive points of exon 4, exon 45 or exon 65 of the DMD gene to the internal reference gene GAPDH is 0 to 0.1, the copy number of the DMD gene is judged to be zero copy.

[0085] In the method of the present invention, exon 4, exon 45 or exon 65 of the DMD gene of the individual to be tested and the internal reference gene GAPDH are simultaneously amplified in the same reaction, and a copy number calculation method is designed. The DMD gene copy number in the sample to be tested is determined by calculating the ratio of positive points of each target gene. Compared with the judgment method in the prior art, the judgment method of the present invention does not require the preparation of a qPCR quantitative standard curve, is simple to operate, easy to use, and is conducive to wide promotion and application.

[0086] Preferably, the method of use further comprises the step of determining the deletion status of the DMD gene.

[0087] Preferably, the criteria for determining the absence of the DMD gene include:

[0088] The DMD gene and the internal reference gene GAPDH both have 2 copies, and the DMD gene is wild type;

[0089] The copy number of the DMD gene is 1 copy, the internal reference gene GAPDH is 2 copies, and the DMD gene is a heterozygous deletion type;

[0090] The copy number of the DMD gene is zero copy, there is no amplification product of DMD, and the DMD gene is a homozygous deletion type.

[0091] The present invention designs a copy number calculation method based on digital PCR, provides an accurate, simple, fast and low-cost method for detecting the copy number of the DMD gene, and performs DMD gene deletion analysis. It is effectively used to evaluate the performance of gene detection kits, study the related mechanisms of the DMD gene, and assist in the analysis of intermediate result information of detecting DMD gene deletion, etc., which is of great significance to the field of spinal muscular atrophy detection.

[0092] In the present invention, the procedure of PCR amplification includes:

[0093] Pre-denaturation: incubate at 93-96°C for 3-7 min. The incubation temperature may be, for example, 93°C, 94°C, 95°C or 96°C, and the incubation time may be, for example, 3 min, 4 min, 5 min, 6 min or 7 min;

[0094] Denaturation: incubate at 93-96°C for 25-35 seconds, the incubation temperature may be, for example, 93°C, 94°C, 95°C or 96°C, and the incubation time may be, for example, 25 seconds, 27 seconds, 29 seconds, 30 seconds, 31 seconds, 33 seconds or 35 seconds;

[0095] Annealing and extension:

[0096] Incubate at 55-65° C. for 30-60 s, where the incubation temperature may be, for example, 55° C., 56° C., 57° C., 58° C., 59° C., or 60° C., and the incubation time may be, for example, 30 s, 31 s, 32 s, 33 s, 34 s, 35 s, or 36 s;

[0097] The process is repeated 40 to 50 times. The number of cycles may be, for example, 40, 41 or 42 times.

[0098] As a preferred technical solution of the present invention, the method for using the kit for detecting the copy number of the DMD gene for the purpose of non-disease diagnosis and / or treatment comprises the following steps:

[0099] (1) Collecting and processing a DNA sample to be tested, adding the DNA sample to be tested and a primer-probe combination for detecting the copy number of the DMD gene to a PCR reaction solution of the detection system, mixing, and obtaining a PCR system; the concentration of the DNA sample to be tested in the PCR system is 5 to 100 ng / μL, the final concentrations of the forward primer and the reverse primer for specifically amplifying the DMD gene are each independently 0.1 to 1 μM, the final concentrations of the forward primer and the reverse primer for specifically amplifying the internal reference gene GAPDH are each independently 0.1 to 1 μM, the final concentrations of the probe for detecting the DMD gene and the probe for detecting the internal reference gene GAPDH are each independently 0.1 to 1 μM, and the final concentration of the DNA polymerase in the PCR system is 0.02 to 0.1 U / μL.

[0100] During the test, quality control reagents are used for simultaneous testing.

[0101] (2) Amplify the PCR system on a digital PCR platform to obtain the amplification results of DMD and GAPDH.

[0102] The procedure of the PCR amplification includes:

[0103] Pre-denaturation: incubate at 93-96°C for 3-7 minutes;

[0104] Denaturation: incubate at 93-96℃ for 25-35s;

[0105] Annealing and extension: incubate at 55-60°C for 30-45 seconds, cycle 40-50 times;

[0106] Detection: Detect the number of positive points in exon 4, exon 45, exon 65 of the DMD gene and the GAPDH gene.

[0107] (3) Using the number of positive spots in the amplification results of DMD and GAPDH, DMD gene copy number analysis is performed to determine the absence of the DMD gene. The criteria for determining the absence of the DMD gene include:

[0108] Both the DMD gene and the internal reference gene GAPDH have 2 copies, the ratio of the positive points of DMD and the internal reference gene GAPDH is at a normal level (range 0.8 to 1.2), and the SMN1 gene is wild type;

[0109] The copy number of the DMD gene is 1 copy, the internal reference gene GAPDH is 2 copies, the ratio of the positive points of DMD and the internal reference gene GAPDH is significantly reduced (range 0.3 to 0.7), and the DMD gene is a heterozygous deletion type;

[0110] The copy number of the DMD gene is zero copy, the positive point ratio of DMD and the internal reference gene GAPDH is in the range of 0 to 0.1, and the DMD gene is a homozygous deletion type.

[0111] In a fifth aspect, the present invention provides a system for detecting the copy number of a DMD gene, wherein the system for detecting a DMD gene deletion comprises:

[0112] (1) Sample preparation module: collecting and processing the DNA sample to be tested, adding the DNA sample to be tested and the primer probe combination for DMD gene copy number detection into the detection system PCR reaction solution, mixing, and preparing the PCR system;

[0113] (2) Detection module: amplify and detect the PCR system on the digital PCR platform to obtain the positive points of DMD and GAPDH;

[0114] (3) Analysis module: Calculate the positive point ratio of DMD and GAPDH and perform DMD gene copy number analysis.

[0115] Compared with the prior art, the present invention has the following beneficial effects:

[0116] (1) The method of the present invention can easily and accurately detect the copy number of high-order multiplex reactions;

[0117] (2) The detection method designed in the present invention can effectively detect the copy number of the DMD gene and is simple to operate and easy to use. BRIEF DESCRIPTION OF THE DRAWINGS

[0118] Attached Figure 1 There is no mutual interference between the target sites of A, B, and C genes, and each diffuses independently between the reaction wells. The distribution of each gene conforms to the Poisson distribution. Therefore, if the seven bands can be clearly separated in the third-order reaction, the copy number analysis of the three genes can be performed separately. DETAILED DESCRIPTION

[0119] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0120] Example 1

[0121] This embodiment provides a kit for detecting the copy number of the DMD gene, and the kit includes the primer-probe combination, reaction reagents and quality control reagents for detecting the copy number of the DMD gene described in Example 1. This test uses the above-mentioned kit for detecting the copy number of the DMD gene to detect 4 clinically confirmed normal female samples.

[0122] (1) Collect and process the DNA sample to be tested.

[0123] Extraction of genomic DNA from whole blood samples:

[0124] Use a pipette to draw 20 μL of proteinase K solution and place it at the bottom of a 1.5 mL centrifuge tube; add 200 μL of whole blood sample to the 1.5 mL centrifuge tube; add 200 μL of Buffer AL, shake and mix for 15 seconds, and incubate at 56°C for 10 minutes; centrifuge briefly to allow the solution to settle to the bottom of the 1.5 mL centrifuge tube; add 200 μL of anhydrous ethanol, shake and mix for 15 seconds, and centrifuge; transfer all the supernatant after centrifugation to a 2 mL filter column with a filter membrane, cover the tube, and centrifuge at 6000 g for 1 minute; add 500 μL of Buffer AW1 to the filter column, and centrifuge at 6000 g for 1 minute; add 500 μL of Buffer AW2 to the filter column, and centrifuge at 20000 g for 3 minutes; place the filter column in the centrifuge again and centrifuge for 1 minute to dry the residual liquid; place the filter column in a new 1.5 mL centrifuge tube, add 200 μL of Buffer AE, and centrifuge at 6000 g for 1 minute.

[0125] The PCR system is as follows:

[0126]

[0127] The sample DNA template is genomic DNA extracted from a whole blood sample, and the final concentration of the genomic DNA in the PCR system is 50 ng / μL. The PCR reaction solution is prepared according to the number of test copies.

[0128] In the experimental group, 1 μL of extracted blood genomic DNA solution was added to each PCR reaction solution, 1 μL of positive control (DMD two-copy quality control, DMD single-copy quality control and DMD zero-copy quality control were used as positive controls) was directly added to the positive control group, and 1 μL of ddH2O was directly added to the negative control group.

[0129] (2) Amplify the PCR system on a digital PCR instrument to obtain the positive points of DMD and GAPDH.

[0130] Digital PCR amplification was performed on the Roche Diagnostics Digital LightCycler System digital PCR instrument. The PCR amplification procedure is as follows:

[0131] Pre-denaturation: incubate at 94°C for 5 min;

[0132] Denaturation: incubate at 94°C for 30 seconds;

[0133] Annealing and extension: incubate at 55°C for 30 s, cycle 50 times.

[0134] (3) Calculate the positive point ratio of DMD and GAPDH and perform DMD gene copy number analysis.

[0135] Test results such as Figure 1As shown, A is DMD gene exon 4, B is DMD gene exon 45, and C is DMD gene exon 65. The products corresponding to each fluorescent area are as follows:

[0136] 1. In the single positive well of the target gene A product, the fluorescent probe concentration of A is the lowest, which is 70nM, so its product fluorescence value is the lowest, about 11000-12000, located at the bottom of each product band;

[0137] 2. Single positive well for target gene B product, B fluorescent probe concentration is 200nM, and its product fluorescence value is about

[0138] 16000-19000 range, higher than the product of gene A, located in the second layer of the product band;

[0139] 3. Double positive wells for target gene A and B products. This layer of reaction wells contains both A and B products, which is the A+B layer. Therefore, its fluorescence value is in the range of 22,000 to 23,000, which is higher than that of gene B product and is located in the third layer of the reaction strip.

[0140] 4. The single positive well of the target gene C product, the concentration of C fluorescent probe is 300nM, and its product fluorescence value is about 28000-29000, which is higher than the double positive wells of genes A and B, and is located in the fourth layer of the product strip; 5. The three layers of A single positive, B single positive and AB double positive located below the C product strip are respectively related to the C product.

[0141] Now superimposed, when located in the same hole, C+A layer, C+B layer and C+B+A layer will be generated above the C strip respectively.

[0142] At this time, since there is no mutual interference between the target sites of A, B, and C genes, each diffuses independently between the reaction wells, and the distribution of each gene conforms to the Poisson distribution. Therefore, if the seven bands can be clearly separated in the third-order reaction, the copy number analysis of the three genes can be performed separately.

[0143] The test results of 4 clinical samples are shown below.

[0144] 1. DMD gene exon 65 (target C) test results

[0145] When the threshold line is set between band C and band A+B, all positive wells of target C are included above the threshold line. According to the Poisson distribution formula, the copy number of target C can be calculated to be 2.

[0146] Table 1. Target C copy number detection results

[0147]

[0148]

[0149] 2. DMD gene exon 45 (target B) test results

[0150] When the threshold line is set between band B and band A, all positive wells of target C and target B are included above the threshold line. According to the Poisson distribution formula, the combined copy number of target C and target B can be calculated to be 4. Combined with the result in Table 1 that the copy number of target C is 2, the copy number of target B can be calculated to be 2.

[0151] Table 2. Target B copy number detection results

[0152]

[0153] 3. DMD gene exon 4 (target A) test results

[0154] When the threshold line is set between band A and the baseline, all positive wells of target C, target B, and target A are included above the threshold line. According to the Poisson distribution formula, the combined copy number of target C, target B, and target A can be calculated to be 6. Combined with the result in Table 2 that the combined copy number of target C and target B is 4, the copy number of target A can be calculated to be 2.

[0155] Table 3. Target B copy number detection results

[0156]

Claims

1. A method for quantitatively analyzing gene copy number using advanced multiplex digital PCR technology, characterized in that: In a fluorescent channel of the digital PCR reaction, the detection sites of three genes A, B and C are designed; and the concentration of fluorescent probes is optimized through preliminary experiments so that the fluorescent signal intensity of each target gene forms a predictable and orderly hierarchical structure, so that different gene combinations can be distinguished in the same fluorescent channel; The detection sites of the three genes A, B and C are exon 4, exon 45 and exon 65 of the DMD gene, respectively.

2. A primer-probe combination for detecting the copy number of a DMD gene, characterized in that: The primer-probe combination for detecting the copy number of the DMD gene includes a primer pair and a probe for specifically amplifying and detecting the DMD gene; The primer pair for specifically amplifying the DMD gene includes a forward primer and a reverse primer; The forward primer includes the nucleotide sequence shown in SEQ ID No.1; The reverse primer comprises the nucleotide sequence shown in SEQ ID No.2; or The forward primer includes the nucleotide sequence shown in SEQ ID No.3; The reverse primer comprises the nucleotide sequence shown in SEQ ID No.4; or The forward primer includes the nucleotide sequence shown in SEQ ID No.5; The reverse primer includes the nucleotide sequence shown in SEQ ID No.

6.

3. The primer-probe combination for detecting the copy number of the DMD gene according to claim 2, characterized in that: The probe for detecting the DMD gene includes the nucleotide sequences shown in SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9; the 5' end of the probe is modified with a fluorescent dye, and the 3' end of the probe is modified with a quencher.

4. The primer-probe combination for detecting the copy number of the DMD gene according to claim 3, characterized in that: The 3' end of the probe is also connected to an MGB group; The fluorescent dye includes HEX; The quencher includes TAMRA.

5. The primer-probe combination for detecting the copy number of the DMD gene according to claim 2, characterized in that: The primer-probe combination for detecting the copy number of the DMD gene also includes a primer pair and a probe for specifically amplifying and detecting the internal reference gene GAPDH; The primer pair for specifically amplifying the internal reference gene GAPDH includes a forward primer and a reverse primer; The forward primer includes the nucleotide sequence shown in SEQ ID No.10; The reverse primer includes the nucleotide sequence shown in SEQ ID No.11; The probe for detecting the internal reference gene GAPDH includes the nucleotide sequence shown in SEQ ID No.12; The 5' end of the probe is modified with a fluorescent dye, and the 3' end of the probe is modified with a quencher.

6. The primer-probe combination for detecting the copy number of the DMD gene according to claim 5, characterized in that: The 3' end of the probe is also connected to an MGB group; The fluorescent dye includes ROX; The quencher includes BHQ.

7. A kit for detecting the copy number of DMD gene, characterized in that: The kit for detecting the copy number of the DMD gene comprises the primer-probe combination for detecting the copy number of the DMD gene according to any one of claims 1 to 5, a reaction reagent and a quality control reagent; The reaction reagents include sample DNA extraction reagents and detection system PCR reaction solution; The detection system PCR reaction solution includes DNA polymerase, enzyme buffer, MgCl2 and dNTPs.

8. The kit for detecting the copy number of the DMD gene according to claim 7, characterized in that: The quality control reagent includes any one or a combination of at least two of DMD gene zero copy quality control, DMD gene single copy quality control or DMD gene two copy quality control; The DMD gene zero copy quality control product is a plasmid containing two copies of the internal reference gene GAPDH; The DMD gene single copy quality control product is a plasmid containing a single copy of the DMD gene and two copies of the internal reference gene GAPDH; The DMD gene two-copy quality control product is a plasmid containing two copies of the DMD gene and two copies of the internal reference gene GAPDH.

9. A method for using the kit for detecting the copy number of the DMD gene according to claim 7 or 8 for the purpose of non-disease diagnosis and / or treatment, characterized in that: The method of use comprises the following steps: (1) collecting and processing a DNA sample to be tested, adding the DNA sample to be tested and a primer probe combination for detecting the copy number of the DMD gene to a PCR reaction solution of the detection system, mixing, and obtaining a PCR system; (2) Amplify the PCR system on a digital PCR platform to obtain the positive points of DMD and GAPDH; (3) Calculate the ratio of the positive points of DMD and GAPDH and perform DMD copy number analysis.

10. The method of use according to claim 9, characterized in that: The concentration of the DNA sample to be tested is 5-100 ng / μL; The final concentrations of the forward primer and the reverse primer for specifically amplifying the DMD gene in the PCR system are independently 0.1 to 1 μM; The final concentrations of the forward primer and the reverse primer for specifically amplifying the internal reference gene GAPDH in the PCR system are independently 0.1 to 1 μM; The final concentrations of the probe for detecting the DMD gene and the probe for detecting the internal reference gene GAPDH in the PCR system are independently 0.1 to 1 μM; The final concentration of DNA polymerase in the PCR system is 0.02-0.1 U / μL; The method of use also includes the step of using a quality control reagent to perform synchronous detection.

11. The method of use according to claim 9 or 10, characterized in that: In step (3), the criteria for determining the copy number of the DMD gene include: If the ratio of the positive points of exon 4, exon 45 or exon 65 of the DMD gene to the internal reference gene GAPDH is 0.80 to 1.20, it is judged that the DMD gene exon is 2 copies; If the ratio of the positive points of exon 4, exon 45, or exon 65 of the DMD gene to the internal reference gene GAPDH is 0.3 to 0.7, the copy number of the DMD gene is judged to be 1 copy; When the ratio of the positive points of exon 4, exon 45 or exon 65 of the DMD gene to the internal reference gene GAPDH is 0 to 0.1, the copy number of the DMD gene is judged to be zero copy.

12. A system for detecting the copy number of a DMD gene, characterized in that: The system for detecting the copy number of the DMD gene comprises: (1) Sample preparation module: collecting and processing the DNA sample to be tested, adding the DNA sample to be tested and the primer probe combination for DMD gene copy number detection into the detection system PCR reaction solution, mixing, and preparing the PCR system; (2) Detection module: amplification detection of the PCR system on a digital PCR platform, and the number of positive points of DMD gene exon 4, exon 45 or exon 65 and GAPDH; (3) Analysis module: Calculate the ratio of the amplification positive points of DMD gene exon 4, exon 45 or exon 65 to GAPDH to perform DMD gene copy number analysis.

13. Use of any one or a combination of at least two of the primer-probe combination for detecting the DMD gene copy number according to any one of claims 2 to 6, the kit for detecting the DMD gene copy number according to claim 7 or 8, or the system for detecting the DMD gene copy number according to claim 12 in the preparation of a product for detecting the DMD gene copy number.

Images