Blood methylation site combination and detection kit for early diagnosis of colorectal cancer

Abstract

The invention relates to the technical field of colorectal cancer auxiliary detection, and particularly discloses a blood methylation site combination and a detection kit for early diagnosis of colorectal cancer, and the method comprises the following steps: providing a blood sample of a person to be detected for obtaining cfDNA; the cfDNA is subjected to bisulfite treatment, and the transformed DNA is obtained; amplifying the transformed DNA by using a multiplex fluorescence PCR (Polymerase Chain Reaction) method to obtain fluorescence signal data of each gene; calculating a Ct value of each gene based on the fluorescence signal data, comparing the Ct value with a preset Cut-off value, and judging whether the colorectal cancer exists or not; according to the present invention, the invasive operation of the colonoscope can be replaced, the screening can be completed through the blood sample, the patient compliance can be significantly improved, the method is suitable for the large-scale early screening, the trace tumor signal in the blood can be efficiently captured based on the methylation marker highly related to the colorectal cancer, and the accurate early canceration identification can be achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of colorectal cancer auxiliary detection, and particularly relates to a blood methylation site combination for early diagnosis of colorectal cancer and a detection kit. Background Art

[0002] Currently, the gold standard for colorectal cancer screening is still colonoscopy, but it often affects the compliance of patients due to its cumbersome bowel preparation and discomfort caused by invasive examinations.

[0003] DNA methylation is a common epigenetic modification and the first epigenetic marker proven to be closely related to tumorigenesis. Aberrant DNA methylation is a common event in tumorigenesis, and the degree of methylation change of CpG sites in different regions is one of the prerequisites for gene dysfunction, which is mainly manifested as hypermethylation of CpG islands in the promoter region and global hypomethylation, and both can be used as the basic markers of tumor epigenetics, resulting in the silencing of tumor suppressor genes and the activation of oncogenes and mediating the progression of tumors.

[0004] The length of plasma free DNA (circulating cell free DNA, cfDNA) is mostly between 70 and 200 bases. Some studies have shown that the necrosis, apoptosis and secretion of tumor tissue cells are the main sources of plasma free DNA in tumor patients. The level of cfDNA in tumor patients is significantly higher than that in normal people, and its high level of cfDNA is composed of free DNA fragments released from abnormal or normal cells such as tumor cells and inflammatory cells into the blood vessels.

[0005] Principle: This product uses multiplex fluorescence PCR to detect the methylation of Septin9, NTMT1, and BCAT1 genes in blood samples. This product is based on the CpG island regions of the promoters of Septin9, NTMT1, and BCAT1 genes, which are highly correlated with the occurrence of colorectal cancer. Specific detection primers and fluorescence probes are designed for the sequences after methylation conversion. Plasma-free DNA is obtained from human blood samples, transformed using bisulfite, and the bisulfite-converted DNA (bisDNA) is measured by multiplex PCR amplification. The specific primers and probes in the PCR reaction can distinguish methylated and non-methylated sequences, thereby detecting the fluorescence signals emitted by the methylated Septin9 gene (VIC signal channel), NTMT1 gene (FAM signal channel), BCAT1 gene (ROX signal channel), and the internal control gene ACTB (CY5 signal channel). The ACTB (β-Actin) gene is a commonly used housekeeping gene, which is used to evaluate the nucleic acid content and quality in the test samples. The principle of bisulfite conversion is that the chemical reaction of bisulfite deaminates unmethylated cytosine to produce uracil sulfonate, but methylated cytosine will not be converted by bisulfite.

[0006] In view of this, the inventor proposes a blood methylation site combination and detection kit for the early diagnosis of colorectal cancer to solve the above problems. Summary of the Invention

[0007] The purpose of the present invention is to provide a blood methylation site combination and detection kit for the early diagnosis of colorectal cancer to solve the problems raised in the above background technology.

[0008] To achieve the above purpose, the present invention provides the following technical solutions:

[0009] A detection method for a blood methylation site combination for the early diagnosis of colorectal cancer, including:

[0010] Providing a blood sample of the person to be tested for obtaining cfDNA;

[0011] Performing bisulfite treatment on the cfDNA to convert unmethylated cytosine C into uracil U to obtain the converted DNA;

[0012] Using multiplex fluorescence PCR to amplify the converted DNA, and detecting the methylated sequences of Septin9, NTMT1, and BCAT1 genes through specific primers and fluorescence probes to obtain the fluorescence signal data of each gene;

[0013] Calculating the Ct value of each gene based on the fluorescence signal data and comparing it with the preset Cut-off value to determine the presence or absence of colorectal cancer;

[0014] Among them, if the Ct value of any one of the Septin9, NTMT1 or BCAT1 genes is lower than or equal to 38, it is determined as positive for colorectal cancer. If the Ct values of all genes are higher than 38 or no signal is detected, it is determined as negative for colorectal cancer.

[0015] Preferably, the blood sample is a plasma or serum sample.

[0016] Preferably, the cfDNA is extracted by the Everything Newborn Extraction Kit.

[0017] Preferably, the bisulfite conversion treatment includes: treating the sample cfDNA with bisulfite solution at 98 °C for 5 min, at 80 °C for 20 min, and finally at 16 °C until the converted DNA is finally obtained.

[0018] Preferably, the primers and probes used in the multiplex fluorescence PCR method include:

[0019] The primer sequences of the Septin9 gene are GGAGTTGGGGGTGTAGAG, TTGGTTGTTTATTAGTTATTAT and CGACAACGCAAACCAAACC, AAATAATCCCATCCAACT; the probe sequences are CGGGCGCGGCGGGTTAC, TCGGATTTCGCGGTTA;

[0020] The primer sequences of the NTMT1 gene are GCGTTTAAGAAGTCGGGG, AGTTAAATTCGGAGTTCGC and GCCCAAACAACCAAAACCTA, AACCCATAACTAACTCCACCC, and the probe sequences are TGGTTACGCGTTTTCGGGGG, CGGGAGGGGCGAGTT;

[0021] The primer sequences of the BCAT1 gene are TAAGGGATGTTGGAGGG, TATGGGTAATTCGTTTCGGA and CAAACGATATAACCAAACCCC, AAATTCAACTCCCGCCT, and the probe sequences are CGACGCACGACCCATAAAACG, CGTGGCGAGGATCGTTACG;

[0022] The primer sequences of the internal reference gene ACTB are TGGTGATGGAGGAGGTTTAGTAAGT and AACCAATAAAACCTACTCCTCCCTTAA, and the probe sequence is ACCACCACCCAACACACAATAACAAACA; among them, the primer concentration is 200 nM and the probe concentration is 100 nM.

[0023] Preferably, the system of the PCR reaction comprises:

[0024] PCR reaction solution I concentrated to 6X concentration, containing buffer, dNTP and inhibitor-resistant DNA polymerase, with a dosage of 8.3 μL;

[0025] PCR reaction solution II, containing a mixture of primers and probes, with a dosage of 5 μL;

[0026] The loading amount of template DNA is 36.7 μL, and the total reaction volume is 50 μL.

[0027] The PCR amplification program comprises:

[0028] Pre-denaturation: hold at 95 °C for 5 minutes;

[0029] 45 cycles of amplification: each cycle includes denaturation at 95 °C for 15 seconds, annealing and extension at 60 °C for 30 seconds, and fluorescence signals are collected during the extension stage.

[0030] Preferably, the Cut-off value used in the step of determining the presence or absence of colorectal cancer is determined by the following method:

[0031] Using the Ct value data of 100 positive samples of colorectal cancer and 100 negative samples, the Ct value thresholds of each gene are determined through statistical analysis. Among them, the Cut-off value of the Septin9 gene is 38, the Cut-off value of the NTMT1 gene is 38, and the Cut-off value of the BCAT1 gene is 38.

[0032] Preferably, the detection method further includes a quality control step:

[0033] Among them, the positive control product is prepared by mixing methylated positive cell nucleic acid with 3% BSA solution, and the Ct value range of each target gene is Septin9, 26 ≤ Ct ≤ 38; NTMT1, 26 ≤ Ct ≤ 38; BCAT1, 26 ≤ Ct ≤ 38;

[0034] The negative control product is prepared by mixing non-methylated cell nucleic acid with 3% BSA solution, and the Ct value of each target gene > 38 or not detected;

[0035] Among them, the control products are run synchronously in each detection to ensure the effectiveness of the experiment.

[0036] Preferably, the detection method further includes a sample determination criterion, wherein:

[0037] If Ct VIC ≤ 38, then Septin9 methylation is positive; if Ct VIC > 38 or Unde, then Septin9 methylation is negative;

[0038] If Ct FAM ≤ 38, then NTMT1 methylation is positive; if Ct FAM > 38 or Unde, then NTMT1 methylation is negative;

[0039] If Ct ROX ≤ 38, then BCAT1 methylation is positive; if Ct ROX > 38 or Unde, then BCAT1 methylation is negative;

[0040] If any one of Septin9, NTMT1, and BCAT1 is positive, the sample is judged to be positive.

[0041] A detection kit, characterized by comprising:

[0042] cfDNA extraction reagent for extracting DNA from plasma or serum samples;

[0043] Bisulfite treatment reagent for bisulfite conversion of cfDNA to convert unmethylated cytosine C to uracil U;

[0044] Multiplex fluorescence PCR amplification reagent, including the following specific primers and fluorescence probes;

[0045] PCR reaction solution, including: PCR reaction solution I at 6X concentration, containing buffer, dNTP, and inhibitor-resistant DNA polymerase;

[0046] PCR reaction solution II, containing a mixture of primers and probes;

[0047] Positive control product prepared by mixing methylated positive cell nucleic acid with 3% BSA solution;

[0048] Negative control product prepared by mixing non-methylated cell nucleic acid with 3% BSA solution, with Ct values of each target gene > 38 or not detected;

[0049] Data analysis software or standard curve for comparing and analyzing fluorescence signal data to provide a diagnostic result.

[0050] Compared with the prior art, the beneficial effects of the present invention are:

[0051] (1) The present invention can replace the invasive operation of colonoscopy, complete screening through blood samples, significantly improve patient compliance, is suitable for large-scale early screening, and can efficiently capture trace tumor signals in blood based on methylation markers (Septin9, NTMT1, BCAT1) highly related to colorectal cancer, realizing accurate identification of early canceration.

[0052] (2) By optimizing the bisulfite conversion and multiplex fluorescence PCR techniques, the present invention breaks through the detection bottleneck of low-concentration free DNA, ensures the stable detection of trace methylation signals in early-stage tumors, simplifies the process by synchronously analyzing the premixed reagent and multiple targets, and combines a strict quality control system to improve the detection efficiency and the reliability of result interpretation. Description of the Drawings

[0053] Figure 1 It is a flow chart of a detection method for a blood methylation site combination for early diagnosis of colorectal cancer according to the present invention;

[0054] Figure 2 It is a curve graph of the qPCR detection result of a blood sample of a colorectal cancer patient according to the present invention;

[0055] Figure 3 It is a curve graph of the qPCR detection result (only internal standard gene) of a blood sample of a normal person according to the present invention. Detailed Embodiments

[0056] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0057] Embodiment 1:

[0058] Please refer to Figure 1 , the application process of the blood methylation detection kit for early diagnosis of colorectal cancer:

[0059] 1. Sample collection and processing

[0060] Step 1: Blood sample collection

[0061] Collect 10 mL of peripheral venous blood from the subject using an EDTA anticoagulant tube. After gently inverting and mixing, store it at 4°C and process it within 24 hours.

[0062] Step 2: EDTA anticoagulated plasma sample

[0063] Centrifuge the whole blood sample at 1600 rcf at 4°C for 10 min, transfer the upper plasma to a new centrifuge tube, and be careful not to aspirate the cell buffy coat layer.

[0064] Centrifuge at 16000 rcf at 4°C for 10 min, transfer the upper plasma to a new centrifuge tube, and be careful not to aspirate the precipitate. The obtained plasma sample can be stored at -20°C / -80°C.

[0065] 2. Bisulfite conversion treatment

[0066] Step 3: cfDNA conversion

[0067] Treat the sample cfDNA with bisulfite solution at 98 °C for 5 min, at 80 °C for 20 min, and finally at 16 °C until the converted DNA is obtained.

[0068] 3. Multiplex fluorescence PCR amplification

[0069] Step 4: Preparation of PCR reaction system

[0070] Mix the reagents in the following proportions:

[0071] Converted DNA: 36.7 μL;

[0072] PCR reaction solution I (6X concentrate): 8.3 μL (containing buffer, dNTP, inhibitor-tolerant DNA polymerase);

[0073] Including Septin9F-1, Septin9R-1, Septin9P-1, Septin9F-2, Septin9R-2, Septin9P-2, NTMT1F-1, NTMT1R-1, NTMT1P-1, NTMT1F-2, NTMT1R-2, NTMT1P-2, BCAT1F-1, BCAT1R-1, BCAT1P-1, BCAT1F-2, BCAT1R-2, BCAT1P-2, ACTBF, ACTBR, ACTBP, primer concentration is 200 nM, probe concentration is 100 nM;

[0074] PCR reaction solution II (primer-probe mixture): 5 μL (containing primers and probes for Septin9, NTMT1, BCAT1, and ACTB genes), Inhibitor-Tolerant qPCR Mix (Beijing Maidian Biotechnology Co., Ltd.);

[0075] Total reaction volume: 50 μL.

[0076] Step 5: PCR amplification program

[0077] As shown in Table 1 and Table 2, run the following program on a fluorescence quantitative PCR instrument:

[0078] Pre-denaturation: 95 °C, 5 minutes;

[0079] Amplification cycle (45 times):

[0080] Denaturation: 95 °C, 15 seconds;

[0081] Annealing and extension: 60 °C, 30 seconds (fluorescence signal is collected at this stage);

[0082] Fluorescent channel settings: VIC (Septin9), FAM (NTMT1), ROX (BCAT1), CY5 (ACTB).

[0083] 4. Data analysis and result determination

[0084] Step 6: Ct value calculation and comparison with the Cut-off value

[0085] Analyze the Ct values of each fluorescent channel through the instrument software;

[0086] Judgment criteria:

[0087] Positive: The Ct value of any one of the genes Septin9, NTMT1, or BCAT1 ≤ 38;

[0088] Negative: The Ct value of all genes > 38 or not detected (Unde).

[0089] Step 7: Quality control verification

[0090] As shown in Table 3 and Table 4, positive control products: Septin9 (26 ≤ Ct ≤ 38), NTMT1 (26 ≤ Ct ≤ 38), BCAT1 (26 ≤ Ct ≤ 38);

[0091] Negative control products: The Ct value of all target genes > 38 or not detected;

[0092] Step 8: Sample judgment criteria, where if Ct VIC ≤ 38, then Septin9 methylation is positive; if Ct VIC > 38 or Unde, then Septin9 methylation is negative;

[0093] If Ct FAM ≤ 38, then NTMT1 methylation is positive; if Ct FAM > 38 or Unde, then NTMT1 methylation is negative;

[0094] If Ct ROX ≤ 38, then BCAT1 methylation is positive; if Ct ROX > 38 or Unde, then BCAT1 methylation is negative;

[0095] If any one of the genes Septin9, NTMT1, and BCAT1 is positive, the sample is judged as positive.

[0096] Table 1 Composition of experimental materials

[0097]

[0098] Table 2 Gene-signaling pathway-quenched gene association table

[0099] gene signal channel quenching group Septin9 VIC NONE NTMT1 FAM NONE BCAT1 ROX NONE ACTB CY5 NONE

[0100] Among them, Septin9-F-1 GGAGTTGGGGGTGTAGAG

[0101] Septin9-R-1 CGACAACGCAAACCAAACC

[0102] Septin9-P-1 CGGGCGCGGCGGGTTAC

[0103] Septin9-F-2 TTGGTTGTTTATTAGTTATTAT

[0104] Septin9-R-2 AAATAATCCCATCCAACT

[0105] Septin9-P-2 TCGGATTTCGCGGTTA

[0106] NTMT1-F-1 GCGTTTAAGAAGTCGGGG

[0107] NTMT1-R-1 GCCCAAACAACCAAAACCTA

[0108] NTMT1-P-1 TGGTTACGCGTTTTCGGGGG

[0109] NTMT1-F-2 AGTTAAATTCGGAGTTCGC

[0110] NTMT1-R-2 AACCCATAACTAACTCCACCC

[0111] NTMT1-P-2 CGGGGGAGGGGCGAGTT

[0112] BCAT1-F-1 TAAGGGATGTTGGAGGG

[0113] BCAT1-R-1 CAAACGATATAACCAAACCCC

[0114] BCAT1-P-1 CGACGCACGACCCATAAAACG

[0115] BCAT1-F-2 TATGGGTAATTCGTTTCGGA

[0116] BCAT1-R-2 AAATTCAACTCCCGCCT

[0117] BCAT1-P-2 CGTGGCGAGGATCGTTACG

[0118] ACTB-F TGGTGATGGAGGAGGTTTAGTAAGT

[0119] ACTB-R AACCAATAAAACCTACTCCTCCCTTAA

[0120] ACTB-P ACCACCACCCAACACACAATAACAAACA

[0121] 5. Detection Results

[0122] Sample Detection Results:

[0123] As Figure 2 shown, colorectal cancer patient samples:

[0124] Septin9 Ct = 30 (VIC channel, positive);

[0125] NTMT1 Ct = 29 (FAM channel, positive);

[0126] BCAT1 Ct = 35 (ROX channel, positive);

[0127] ACTB Ct = 28 (CY5 channel, sufficient DNA amount);

[0128] Judgment: Positive for colorectal cancer.

[0129] As Figure 3 shown, healthy person samples:

[0130] Septin9 Ct = Undetected;

[0131] NTMT1 Ct = 42;

[0132] BCAT1 Ct = Undetected;

[0133] ACTB Ct = 30 (sufficient DNA amount);

[0134] Judgment: Negative for colorectal cancer.

[0135] Table 3 Amplification Data of Quality Control Products

[0136]

[0137] Table 4 Judgment Criteria for Gene Detection Results

[0138]

[0139] From the experiment, it can be seen that among 663 colorectal cancer samples detected, 537 were detected positive (81.00%);

[0140] 956 non-colorectal cancer samples were detected, and 918 negative cases (96.03%) were detected;

[0141] 0.5 copies / μL (all target genes could be stably detected);

[0142] Three precision reference products were repeatedly detected 10 times, and the coefficient of variation (CV) of Ct values ≤ 3.5%.

[0143] In the description of this specification, the description with reference to terms such as "one embodiment", "some embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic expressions of the above terms do not have to be directed to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0144] In the accompanying drawings of the disclosed embodiments of the present invention, only the structures related to the disclosed embodiments are involved. Other structures can refer to the general design. Without conflict, the same embodiment and different embodiments of the present invention can be combined with each other.

[0145] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A detection method for a blood methylation site combination for early diagnosis of colorectal cancer, characterized in that Comprising: Providing a blood sample of a person to be tested for obtaining cfDNA; Performing bisulfite treatment on the cfDNA to convert unmethylated cytosine C into uracil U, obtaining the converted DNA; Amplifying the converted DNA using multiplex fluorescence PCR, detecting the methylation sequences of Septin9, NTMT1 and BCAT1 genes through specific primers and fluorescence probes, and obtaining the fluorescence signal data of each gene; Calculating the Ct value of each gene based on the fluorescence signal data, and comparing it with a preset Cut-off value to determine the presence or absence of colorectal cancer; Wherein, if the Ct value of any one of the genes Septin9, NTMT1 or BCAT1 is less than or equal to 38, it is determined as positive for colorectal cancer; if the Ct values of all genes are higher than 38 or no signal is detected, it is determined as negative for colorectal cancer.

2. The detection method of a blood methylation site combination for early diagnosis of colorectal cancer according to claim 1, wherein The blood sample is a plasma or serum sample.

3. The detection method of a blood methylation site combination for early diagnosis of colorectal cancer according to claim 1, wherein The cfDNA is extracted by a Wanwuxinsheng extraction kit.

4. The detection method of a blood methylation site combination for early diagnosis of colorectal cancer according to claim 1, characterized in that, The bisulfite conversion treatment includes: treating the sample cfDNA with a bisulfite solution at 98°C for 5 min, at 80°C for 20 min, and finally at 16°C until the converted DNA is finally obtained.

5. The detection method of a blood methylation site combination for early diagnosis of colorectal cancer according to claim 1, characterized in that The primers and probes used in the multiplex fluorescence PCR method include: The primer sequences of the Septin9 gene are GGAGTTGGGGGTGTAGAG, TTGGTTGTTTATTAGTTATTAT and CGACAACGCAAACCAAACC, AAATAATCCCATCCAACT; the probe sequences are CGGGCGCGGCGGGTTAC, TCGGATTTCGCGGTTA; The primer sequences of the NTMT1 gene are GCGTTTAAGAAGTCGGGG, AGTTAAATTCGGAGTTCGC and GCCCAAACAACCAAAACCTA, AACCCATAACTAACTCCACCC; the probe sequences are TGGTTACGCGTTTTCGGGGG, CGGGAGGGGCGAGTT; The primer sequences of the BCAT1 gene are TAAGGGATGTTGGAGGG, TATGGGTAATTCGTTTCGGA and CAAACGATATAACCAAACCCC, AAATTCAACTCCCGCCT; the probe sequences are CGACGCACGACCCATAAAACG, CGTGGCGAGGATCGTTACG; The primer sequences of the internal reference gene ACTB are TGGTGATGGAGGAGGTTTAGTAAGT and AACCAATAAAACCTACTCCTCCCTTAA; the probe sequence is ACCACCACCCAACACACAATAACAAACA; wherein, the primer concentration is 200 nM and the probe concentration is 100 nM.

6. The detection method of a blood methylation site combination for early diagnosis of colorectal cancer according to claim 5, characterized in that The system of the PCR reaction includes: PCR Reaction Solution I concentrated to 6X concentration, containing buffer, dNTP and inhibitor-resistant DNA polymerase, with a dosage of 8.3 μL; PCR Reaction Solution II, containing a mixture of primers and probes, with a dosage of 5 μL; The template DNA loading amount is 36.7 μL, and the total reaction volume is 50 μL; The PCR amplification program includes: Pre-denaturation: Hold at 95 °C for 5 minutes; 45 cycles of amplification: Each cycle includes denaturation at 95 °C for 15 seconds, annealing and extension at 60 °C for 30 seconds, and fluorescence signals are collected during the extension stage.

7. The detection method of a blood methylation site combination for early diagnosis of colorectal cancer according to claim 1, wherein The Cut-off value used in the step of determining the presence or absence of colorectal cancer is determined by the following method: Using the Ct value data of 100 colorectal cancer positive samples and 100 negative samples, the Ct value thresholds of each gene are determined through statistical analysis. Among them, the Cut-off value of the Septin9 gene is 38, the Cut-off value of the NTMT1 gene is 38, and the Cut-off value of the BCAT1 gene is 38.

8. The detection method of a blood methylation site combination for early diagnosis of colorectal cancer according to claim 1, wherein, The detection method also includes a quality control step: Among them, the positive control product is prepared by mixing methylated positive cell nucleic acid with 3% BSA solution, and the Ct value range of each target gene is Septin9, 26 ≤ Ct ≤ 38; NTMT1, 26 ≤ Ct ≤ 38; BCAT1, 26 ≤ Ct ≤ 38; The negative control product is prepared by mixing non-methylated cell nucleic acid with 3% BSA solution, and the Ct value of each target gene > 38 or not detected; Among them, the control products are run synchronously in each detection.

9. The detection method of a blood methylation site combination for early diagnosis of colorectal cancer according to claim 1, characterized in that, The detection method also includes a sample determination criterion, where: If Ct VIC ≤ 38, then Septin9 methylation is positive; if Ct VIC > 38 or Unde, then Septin9 methylation is negative; If Ct FAM ≤ 38, then NTMT1 methylation is positive; if Ct FAM > 38 or Unde, then NTMT1 methylation is negative; If Ct ROX ≤ 38, then BCAT1 methylation is positive; if Ct ROX > 38 or Unde, then BCAT1 methylation is negative; If any one of Septin9, NTMT1 and BCAT1 is positive, the sample is judged as positive.

10. A detection kit, characterized in that, Including: cfDNA extraction reagent, used to extract DNA from plasma or serum samples; Bisulfite treatment reagent, used to perform bisulfite conversion on cfDNA to convert unmethylated cytosine C into uracil U; Multiplex fluorescence PCR amplification reagent, including the following specific primers and fluorescence probes; PCR reaction solution, including: 6X concentration PCR reaction solution I, containing buffer, dNTP and inhibitor-resistant DNA polymerase; PCR reaction solution II, containing a mixture of primers and probes; Positive control product, prepared by mixing methylated positive cell nucleic acid with 3% BSA solution; Data analysis software or standard curve, used to compare and analyze fluorescence signal data and provide a diagnostic result.

Images