SNP (Single Nucleotide Polymorphism) molecular marker related to pig intramuscular fat deposition and application of SNP molecular marker

Abstract

The invention discloses a pig intramuscular fat deposition related PINK1 gene SNP (Single Nucleotide Polymorphism) marker. The SNP marker is the 1240th nucleotide g.414Ggt of a PINK1 gene on a pig chromosome 6; a. The molecular marker can influence intramuscular fat deposition of the pig, and the intramuscular fat content of the group can be increased by selecting the SNP site of the pig, so that the pork quality is improved, and the productivity benefit is increased.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and molecular markers, and relates to an application of a PINK1 gene polymorphic site in the genetic improvement of pig intramuscular fat deposition traits. Background Art

[0002] The information disclosed in this background technology section is only intended to increase some understanding of the overall background of the invention, and should not be necessarily regarded as an admission or any form of suggestion that the information constitutes the prior art already known to ordinary technicians in this field.

[0003] As people's living standards improve, the quality requirements for animal products are getting higher and higher. As a major pork consumer, in my country's animal husbandry, pig intramuscular fat deposition is crucial for the production of high-quality meat products. At present, lean pigs are widely raised due to their advantages such as high yield, fast growth and high feed conversion rate. However, this high lean meat rate is also accompanied by a decrease in intramuscular fat content, which affects the taste and flavor of pork.

[0004] PINK1 (PTEN induced putative kinase 1) is a 581 amino acid polypeptide. It is a serine / threonine kinase located on depolarized mitochondria. It can be expressed in cells throughout the body, and is particularly expressed in high-energy organs such as the heart, muscle, and brain. In cells, it is mainly located in the inner membrane of mitochondria. Its N-terminus is similar to the mitochondrial targeting signal, followed by a hydrophobic transmembrane region, which serves as a mitochondrial inner membrane transfer termination signal. Residues between 156 and 509 constitute a serine / threonine domain, followed by a C-terminal domain, which serves as a mitochondrial outer membrane retention signal. In normal mitochondria, PINK1 is continuously transferred to the mitochondrial inner membrane, cleaved by the mitochondrial inner membrane protease PARL, and an N-terminal degradation motif is produced, which is then cleared. Therefore, under normal circumstances, the content of PINK1 is extremely low and difficult to detect. However, when the mitochondrial membrane potential is damaged, the path of PINK1 entering the mitochondrial inner membrane is blocked, PINK1 accumulates in the mitochondrial outer membrane, and recruits parkin to the damaged mitochondria to activate its E3 enzyme activity. Parkin then ubiquitinates the mitochondrial outer membrane protein, and the ubiquitin chain is phosphorylated by PINK1. The phosphorylated ubiquitin-modified outer membrane protein is recognized by autophagy adaptor proteins (p62, NDP52, OPTN, etc.), initiating mitochondrial autophagy. As an important mitochondrial quality control mechanism, mitochondrial autophagy mainly presents ubiquitination-dependent recognition and removal of dysfunctional mitochondria. Studies have revealed the mechanism by which mitochondrial autophagy regulates muscle-fat metabolic communication, suggesting that mitochondrial autophagy plays a vital role in lipid metabolic homeostasis. The PINK1 protein level in pigs with the PINK1 gene g.1240G>A mutation was not significantly reduced, but its kinase activity continued to be significantly reduced. Molecular modeling and kinetic simulation as well as multiple functional assays showed that the G1240A mutation interfered with the ubiquitin phosphorylation of wild-type PINK1 in the heterodimeric complex, which impaired the protective function of PINK1 / parkin-mediated mitochondrial quality control. Summary of the invention

[0005] The present invention screens out a PINK1 gene SNP marker that can regulate pig intramuscular fat deposition to solve the deficiencies and shortcomings in the prior art. The present invention also provides a primer pair and a kit for detecting the SNP molecular marker. The present invention also provides a method for screening pig breeds with high intramuscular fat traits. The present invention also provides a method for genetic improvement of pigs.

[0006] The technical solution adopted by the present invention is as follows:

[0007] In the first aspect of the present invention, a PINK1 gene SNP marker associated with intramuscular fat deposition in pigs is provided, wherein the SNP marker is the 1240th nucleotide g.1240G>A of the PINK1 gene on pig chromosome 6. The sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and the SNP molecular marker is located at the 157th position from the 5' end of the nucleic acid sequence of SEQ ID NO: 1, and its base is G or A.

[0008] SEQ ID NO: 1 is as follows:

[0009] 5'-GCTCACAGAGACCTGAAGTCTGACAACATCCTTGTGGAGCTGG ATGCAGACGGCTGCCCCTGGTTGGTGATCGCAGACTTCGGCTGCTGCCTGGCCGATGAGCGCGTGGGCCTGCAGCTGCCTTTCACCAGCTGGTACGTGGACCGCGGCGGAAACGGCTGCCTGATGGCTCCTGAGGTGTCCACGGCCTGCCCTGGCCCCAGGGCGGTGATTGACTACAGCAAGGCTGACGCCTGGGC GGTGGGAGCGCTCGCCTACGAAATCTTCGGGGCTCTCCAACCCCTTTTATGGCCAAGCAGGGGCCCACCTTGAAAGCCGCAGTTACCAAGAAGCTCAGCTTCCAGCGCTGCCCGAATCAGTGCCTCTAGACGTGAGACAGCTGGTGAGGTCGCTGCTCCAGCGAGATGCCAGCAAGAGGCCATCCGCCCGCGTG-3'

[0010] In a second aspect of the present invention, a primer pair is provided for detecting the SNP molecular marker of the PINK1 gene associated with pig intramuscular fat deposition, the primer pair consisting of an upstream primer and a downstream primer; the upstream primer is shown in SEQ ID NO: 2; the downstream primer is shown in SEQ ID NO: 3;

[0011] SEQ ID NO: 2: PINK1-F: 5'-GCTCACAGAGACCTGAAGTCT-3';

[0012] SEQ ID NO: 3: PINK1-R: 5'-CACGCGGCGGATGGCCTCTT-3'.

[0013] In the third aspect of the present invention, a kit for detecting the SNP molecular marker is provided, comprising the primer pair.

[0014] In a fourth aspect of the present invention, there is provided a use of the SNP molecular marker, the primer pair or the kit in any of the following:

[0015] a) preparing a product for identifying the regulatory traits of intramuscular fat deposition in pigs;

[0016] b) Molecular marker-assisted breeding of pigs;

[0017] c) preparing products that influence the regulation of intramuscular fat deposition in pigs.

[0018] In a fifth aspect of the present invention, a method for identifying the genotype of a SNP molecular marker associated with the regulation of pig intramuscular fat deposition is provided, comprising the following steps:

[0019] (1) Extracting genomic DNA from the pig to be tested;

[0020] (2) performing PCR amplification on the genomic DNA obtained in step (1) using the above primer pair to obtain a PCR amplification product;

[0021] (3) sequencing the PCR amplification product obtained in step (2) to obtain a sequencing result;

[0022] (4) based on the sequencing results, determining whether the genotype of the SNP molecular marker affecting the regulation of intramuscular fat deposition on chromosome 6 of the tested pig is GG, GA or AA;

[0023] By analyzing the results, it was found that the intramuscular fat deposition ability of pigs with GG, GA and AA genotypes was AA>GA>GG.

[0024] In one or some embodiments of the present invention, in step (2), 5 μL of 2×PCR Mix reagent, 1 μL of DNA template, 0.5 μL of each of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3, and 3 μL of ddH2O are taken to form a 10 μL amplification system.

[0025] In a sixth aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps:

[0026] The above-mentioned SNP molecular markers associated with intramuscular fat deposition in pigs are determined in the core group of breeding pigs, and corresponding selections are made based on the SNP molecular markers: breeding pig individuals with the AA genotype at site 1240 on chromosome 6 of the pig genome are selected from the core group of breeding pigs, and breeding pig individuals with the GG genotype at site 1240 are eliminated, so as to increase the frequency of the allele AA at this site from generation to generation, thereby increasing the intramuscular fat deposition of offspring pigs.

[0027] Compared with the related art known to the inventor, one of the technical solutions of the present invention has the following beneficial effects:

[0028] (1) The present invention increases the intramuscular fat content of the pig population by selecting this SNP site, thereby improving the quality of pork and increasing production efficiency; it can be used for molecular marker-assisted breeding, can be used for early selection of breeding pigs, and significantly promote the breeding process of breeding pigs.

[0029] (2) The method of detecting the 157th SNP site from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1 by using a pair of primers shown in SEQ ID NO: 2 and SEQ ID NO: 3 is accurate, reliable and easy to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their description are used to explain the present invention and do not constitute improper limitations on the present invention.

[0031] Figure 1 : Manhattan plot of genome-wide association analysis (GWAS) of traits, where the horizontal axis represents the chromosome position of pigs; the vertical axis represents the -logP value. DETAILED DESCRIPTION

[0032] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0033] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations and / or combinations thereof.

[0034] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0035] SNP Screening:

[0036] (1) Data Collection

[0037] The data collection samples came from a pig farm, all of which were purebred Large White boars. The pigs were allowed to eat and drink freely, and the entire feeding method and feeding conditions were always consistent. Before slaughter, ear tissue samples were collected from all test pigs and stored in 75% ethanol for the extraction of pig genomic DNA. After slaughter, longissimus dorsi muscle samples were taken from the left half of the carcass for the determination of muscle fat content. The measurement method adopted the petroleum ether extraction method, and the average value was taken after three measurements.

[0038] (2) Extraction and detection of genomic DNA

[0039] The TSINGKE TSP202-200 was used to extract the animal genomic DNA. Hi-Pure Animal Genomic DNA Kit) was used to extract pig genomic DNA from pig ear tissue. The quality and concentration of the extracted DNA were tested using NanoDrop 2000 Nucleic Acid and Protein Analyzer (Thermo Fisher Scientific, USA). The curve was steep and smooth, the ratio of A260 / A280 was between 1.8 and 2.0, and the ratio of A260 / A230 was between 2.0 and 2.5. 50-100 ng of the extracted DNA was subjected to 1% agarose gel electrophoresis. The concentrated and bright bands indicated that the extracted DNA had a high purity.

[0040] (3) Genetic analysis and quality control

[0041] The whole genomic DNA of pigs was hybridized on the PorcineSNP60BeadChip developed by Illumina, which contains 61565 SNP sites. PLINK was used for quality control, and SNP markers with genotype missing rate (GENO)>0.1, minimum allele frequency (MAF)<0.01, Hardy-Weinberg equilibrium (HWE)<0.001, and sample detection rate (MIND)<0.90 were filtered out.

[0042] In order to systematically analyze the genetic basis of the target trait and mine related sites, in addition to using the SNP data on the PorcineSNP60BeadChip, we also independently conducted whole-genome association analysis and successfully discovered a new site that was not within the marker range of the existing chip. The discovery of this site was based on the results of whole-genome data analysis, further verifying its potential role in the target trait.

[0043] The analysis results are as follows Figure 1 As shown. Figure 1It can be seen that there is a site on chromosome 6 of the molecular marker that significantly affects intramuscular fat deposition, and the significantly associated SNP is the 157th nucleotide g.157G>A in SEQ NO.1.

[0044] Detection and verification of SNP molecular markers of samples:

[0045] (1) Use the high-efficiency animal genomic DNA extraction kit (TSINGKE TSP202-200 Hi-Pure Animal Genomic DNA Kit) was used to extract the genomic DNA of the pig to be tested. The detailed steps are as follows:

[0046] 1) Use surgical scissors wiped with alcohol cotton to cut the pig ear into pieces, add 20 μL Proteinase K and mix well, then place in a water bath at 56°C overnight until the tissue is enzymatically hydrolyzed to a particle-free state;

[0047] 2) Add 200 μL Buffer GB to the digestion solution, vortex to mix, and then incubate at 56°C in a water bath for 10 min; 6.

[0048] Add 200 μL of anhydrous ethanol to the digestion solution and vortex to mix;

[0049] 3) The adsorption column is placed in a collection tube, and the mixed solution obtained in the previous step is transferred to the adsorption column at 12000

[0050] rpm (~13400 × g) for 1 min;

[0051] 4) Discard the waste liquid, put the adsorption column back into the collection tube, and add 500 μL Buffer WB1 to the adsorption column.

[0052] Centrifuge at 12,000 rpm (~13,400 × g) for 30 s;

[0053] 5) Discard the waste liquid, put the adsorption column back into the collection tube, add 600 μL Buffer WB2 to the adsorption column, and centrifuge at 12,000 rpm (~13,400 × g) for 30 seconds;

[0054] 6) Repeat step 5);

[0055] 7) Discard the waste liquid, put the adsorption column back into the collection tube, and centrifuge the empty tube at 12,000 rpm (~13,400×g) for 2 minutes. Leave the adsorption column at room temperature for a few minutes to completely dry the remaining rinse solution;

[0056] 8) Place the adsorption column in a new 1.5 mL centrifuge tube, add 50-100 μL TEBuffer or ddH2O (better effect after 65°C heat bath) to the middle of the adsorption film, place at room temperature for 5 min, and centrifuge at 12000 rpm (~13400 rpm).

[0057] × g) for 2 min and collect the DNA solution.

[0058] (2) Using the above primer pair to perform PCR amplification on the genomic DNA obtained in step (1) to obtain a PCR amplification product. The amplification system is as follows:

[0059] 1) Take 5 μL of 2×PCR Mix reagent, 1 μL of DNA template, SEQ ID NO: 2 and SEQ ID NO:

[0060] 0.5 μL of each primer shown in 3 and 3 μL of ddH2O constitute a 10 μL amplification system;

[0061] 2) Set the PCR amplification conditions: 94°C, 3 min; 29 cycles (94°C, 25 s; 56°C, 25 s; 72°C, 10 s); 72°C, 5 min; 4°C, ∞.

[0062] (3) sequencing the PCR amplification product obtained in step (2) to obtain a sequencing result;

[0063] (4) based on the sequencing results, determining whether the genotype of the SNP molecular marker affecting the regulation of intramuscular fat deposition on chromosome 6 of the tested pig is GG, GA or AA;

[0064] By analyzing the results in Tables 1 and 2, the intramuscular fat deposition capacity of pigs with GG, GA and AA genotypes is AA>GA>GG.

[0065]

[0066]

[0067] Among them, there were 29 pigs with GG genotype: 001, 004, 008, 009, 010, 013, 017, 020, 021, 024, 030, 035, 036, 039, 041, 043, 047, 048, 049, 060, 061, 068, 077, 080, 081, 082, 090, 095, 098;

[0068] There were 48 pigs with GA genotype: 002, 005, 006, 007, 012, 014, 016, 019, 025, 028, 029, 031, 032, 033, 034, 037, 040, 042, 044, 045, 050, 053, 054, 055, 056, 058, 059, 062, 063, 066, 067, 069, 070, 071, 072, 073, 074, 076, 078, 083, 086, 087, 089, 091, 093, 094, 096, 100;

[0069] There are 23 pigs with AA genotype: 003, 011, 015, 018, 022, 023, 026, 027, 038, 046, 051, 052, 057, 064, 065, 075, 079, 084, 085, 088, 092, 097, and 099.

[0070] According to Tables 1 and 2, the effect of the G→A mutation at the 1240th nucleotide of the PINK1 gene on chromosome 6 of the molecular marker SNP site on the intramuscular fat content indicates that this molecular marker can affect the intramuscular fat deposition of pigs. By selecting this SNP site in pigs, the intramuscular fat content of the group can be increased, thereby improving pork quality and increasing production efficiency.

[0071] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A PINK1 gene SNP marker associated with pig intramuscular fat deposition, characterized in that: The SNP marker is the 1240th nucleotide g.1240G>A of the PINK1 gene on pig chromosome 6; the sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and the SNP molecular marker is located at the 157th position from the 5' end of the SEQ ID NO: 1 nucleic acid sequence, and its base is G or A.

2. A primer pair for detecting the SNP molecular marker of the PINK1 gene associated with pig intramuscular fat deposition as claimed in claim 1, characterized in that: The primer pair consists of an upstream primer and a downstream primer; the upstream primer is shown as SEQ ID NO: 2; the downstream primer is shown as SEQ ID NO:

3.

3. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The primer pair comprises SEQ ID NO: 2-3.

4. Use of the SNP molecular marker according to claim 1, the primer pair according to claim 2 or the kit according to claim 3 in any of the following: a) preparing a product for identifying the regulatory traits of intramuscular fat deposition in pigs; b) Molecular marker-assisted breeding of pigs; c) preparing products that influence the regulation of intramuscular fat deposition in pigs.

5. A method for identifying the genotype of a SNP molecular marker associated with the regulation of intramuscular fat deposition in pigs, characterized in that: The following steps are included: (1) Extracting genomic DNA from the pig to be tested; (2) performing PCR amplification on the genomic DNA obtained in step (1) using the primer pair described in claim 2 to obtain a PCR amplification product; (3) sequencing the PCR amplification product obtained in step (2) to obtain a sequencing result; (4) based on the sequencing results, determining whether the genotype of the SNP molecular marker affecting the regulation of intramuscular fat deposition on chromosome 6 of the tested pig is GG, GA or AA; By analyzing the results, it was found that the intramuscular fat deposition ability of pigs with GG, GA and AA genotypes was AA>GA>GG.

6. The method for identifying the genotype of a SNP molecular marker associated with the regulation of pig intramuscular fat deposition as claimed in claim 5, characterized in that: In step (2), 5 μL of 2×PCR Mix reagent, 1 μL of DNA template, 0.5 μL of each primer shown in SEQ ID NO: 2 and SEQ ID NO: 3, and 3 μL of ddH2O were taken to form a 10 μL amplification system.

7. A method for genetic improvement of pigs, characterized in that: The following steps are included: Determine the PINK1 gene SNP marker associated with intramuscular fat deposition in pigs as described in claim 1 in the breeding pig core group, and make corresponding selections based on the SNP molecular markers: select breeding pig individuals with AA genotype at site 1240 on chromosome 6 of the pig genome from the breeding pig core group, and eliminate breeding pig individuals with GG genotype at site 1240 to increase the frequency of the allele AA at this site, thereby increasing the intramuscular fat deposition of offspring pigs.

Images