Screening method and application of real-time fluorescent quantitative PCR reference gene of asparagus cochinchinensis

Abstract

The invention discloses a screening method and application of a real-time fluorescent quantitative PCR reference gene of radix asparagi, and relates to the technical field of molecular biology. The method comprises the following steps: step 1, obtaining materials: selecting asparagus cochinchinensis plants for sampling, wherein sampling comprises different growth years and different tissue parts; step 2, extraction of RNA of a radix asparagi sample and preparation of a cDNA template: respectively grinding the collected and stored sample into fine powder in liquid nitrogen, extracting the total RNA of the sample, and verifying the integrity of the extraction result by adopting 1% agarose gel electrophoresis. On the basis of asparagus cochinchinensis full-length transcriptome data, through a strict reference gene screening program, the reference gene with the most stable expression of asparagus cochinchinensis samples at different growth years and different tissue parts is determined from 10 candidate reference genes for the first time, and the method is an innovation in asparagus cochinchinensis real-time fluorescent quantitative PCR reference gene screening and application.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to a screening method and application of an asparagus real-time fluorescence quantitative PCR internal reference gene. Background Art

[0002] (Asparagus cochinchinensis (Lour.) Merr., a plant of the Liliaceae family, is derived from its dried tuberous roots. It is mainly produced in southwestern provinces and autonomous regions of my country and is a local medicinal material in Neijiang, Sichuan. Asparagus was first recorded in the Shennong's Herbal Classic as "Asparagus cochinchinensis", and has been used by most herbal books of all dynasties. The 2020 edition of the Chinese Pharmacopoeia records that asparagus tastes sweet and bitter, is cold in nature, and has the effects of nourishing yin and moistening the lungs, clearing the lungs and promoting fluid production.

[0003] Modern studies on the chemical composition of Asparagus cochinchinensis have found that it contains a variety of chemical components such as steroidal saponins, polysaccharides, and amino acids, among which steroidal saponins are the main chemical components of Asparagus cochinchinensis. Modern pharmacological studies have shown that Asparagus cochinchinensis has anti-tumor, antioxidant, antibacterial, and anti-inflammatory pharmacological effects, especially for lung damage. With the development and progress of molecular pharmacognosy, the biosynthesis of the main active ingredients of Asparagus cochinchinensis and the functional research of key genes have received more and more attention.

[0004] Real-time fluorescence quantitative PCR (qRT-PCR) technology has developed into a widely used, rapid and accurate gene expression quantitative analysis tool in the field of molecular biology. The accuracy of qRT-PCR experimental results is affected by many factors, including RNA quality, cDNA synthesis efficiency, PCR amplification efficiency, and the stability of internal reference gene expression. In particular, the stability of the internal reference gene plays a decisive role in ensuring the accuracy of the target gene expression and the reliability of the experimental data.

[0005] At present, there is no report on the study of the internal reference gene of Asparagus cochinchinensis, and this research gap limits the in-depth exploration of the verification of the gene function of Asparagus cochinchinensis and its molecular mechanism. Therefore, systematic screening and identification of internal reference genes that are stably expressed in different growth years and different tissue parts of Asparagus cochinchinensis is of great significance for the study of Asparagus cochinchinensis gene expression. The present invention will provide the necessary prerequisites for the subsequent study of the gene function of Asparagus cochinchinensis, and help to improve the technical accuracy and scientific credibility of the results of related gene expression analysis. Summary of the invention

[0006] The purpose of the present invention is to solve the shortcomings of the prior art and to propose a screening method and application of an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis, comprising:

[0009] Step 1, acquisition of materials: select Asparagus cochinchinensis plants for sampling, including different growth years (one-year-old, two-year-old and three-year-old) and different tissue parts (root tubers, stem segments and leaf-like branches);

[0010] Step 2, extraction of RNA from asparagus samples and preparation of cDNA templates: Grind the collected and stored samples into fine powder in liquid nitrogen, extract the total RNA of the samples, and verify the integrity of the extraction results by 1% agarose gel electrophoresis; use an ultra-micro spectrophotometer to detect the quality and concentration of RNA, and dilute the RNA template to 100 ng / μL; operate according to the instructions of RT EasyTMII (with gDNase) of Fuji Biotechnology Co., Ltd. to synthesize the first chain of cDNA, and store the synthesized products at -20°C for future use;

[0011] Step 3, selection of candidate internal reference genes and design of synthetic qRT-PCR amplification primers: Based on the full-length transcriptome data of Asparagus cochinchinensis, the internal reference gene sequence of Arabidopsis thaliana was used as a reference, and the nucleotide sequence of the candidate internal reference gene in Asparagus cochinchinensis was determined through sequence alignment and NCBI database Blast alignment, and qRT-PCR specific primers were designed using Primer Premier 6.0 software;

[0012] Step 4, qRT-PCR amplification of candidate internal reference genes: Based on the MIQE guidelines for real-time fluorescence quantitative PCR, the cDNA templates of different samples of Asparagus cochinchinensis obtained in step 2 were amplified by real-time fluorescence quantitative PCR, and the amplification specificity of each primer was determined by whether the melting curve was a single peak;

[0013] Step 5, screening of stable internal reference genes: sort out the CT values ​​of candidate internal reference genes of Asparagus cochinchinensis, import them into ge Norm, NormFinder, BestKeeper and Ref Finder to analyze the qPCR results, evaluate the stability of candidate internal reference genes, and screen out the most stably expressed internal reference genes of Asparagus cochinchinensis in different growth years and different tissue parts.

[0014] Preferably: in step 1, obtaining the material includes the following steps:

[0015] S11: Sample collection: Select one-year-old, two-year-old and three-year-old Asparagus cochinchinensis plants, and randomly select multiple plants from each growth year;

[0016] S12: Tissue sampling: Each plant was sampled, including root tubers, stem segments and leaf branches, to ensure the representativeness of gene expression in different parts;

[0017] S13: Sample processing: After collection, all samples were surface sterilized with 75% ethanol, quickly frozen in liquid nitrogen, and then transferred to -80°C for storage;

[0018] S14: S12-S13 were repeated three times.

[0019] Preferably, in step 2, the extraction of RNA from the asparagus sample and the preparation of the cDNA template include the following steps:

[0020] S21: Total RNA extraction: The collected and stored Asparagus cochinchinensis samples were ground into fine powder in liquid nitrogen, and total RNA was extracted using the FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics–rich) of Nanjing Novozyme Biotechnology Co., Ltd.;

[0021] S22: Electrophoresis verification: The integrity of RNA was checked by 1% agarose gel electrophoresis; if complete 28S and 18S rRNA bands were observed, RNA extraction was successful;

[0022] S23: Concentration determination: Use an ultra-micro spectrophotometer to detect RNA quality and concentration to ensure that it meets the experimental requirements (usually 100 ng / μL);

[0023] S24: cDNA synthesis: According to the instruction manual of RT EasyTMII (with gDNase) of Fuji Biotechnology Co., Ltd., the first-chain cDNA was synthesized and the synthesized product was stored at -20°C for future use.

[0024] Preferably: in step 3, the selection of candidate internal reference genes and primer design include the following steps:

[0025] S31: Sequence alignment and database query: Based on the full-length transcriptome data of Asparagus cochinchinensis and the reference gene sequence of Arabidopsis thaliana, the candidate reference genes with relatively stable expression were determined through sequence alignment and NCBI database Blast alignment;

[0026] S32: Primer design: Use Primer Premier 6.0 software to design specific primers; when designing, the specificity and efficiency of the primers should be taken into consideration to ensure that the length and annealing temperature parameters of the primers are appropriate;

[0027] S33: PCR verification: The designed primers were verified by PCR to confirm that the selected primers could accurately amplify the target gene fragment; the reaction system (50 μL) was: 25 μL Taq PCR Master Mix (Shanghai Sangon Biotechnology), 1 μL cDNA template, 2 μL each of upstream and downstream primers (final concentration 0.4 μM) and 20 μL ddH2O, and the total reaction system was 50 μL; the reaction procedure included four steps: pre-denaturation, denaturation, annealing and extension.

[0028] Preferably: in step 4, the qRT-PCR amplification of the candidate internal reference gene comprises the following steps:

[0029] S41: Real-time fluorescence quantitative PCR preparation: Perform fluorescence quantitative PCR amplification of reverse transcribed cDNA template in the BIOER fluorescence quantitative PCR instrument (FQD-96A); the reaction system is: 2× SYBR qPCR SuperMix Plus 10 μL (nearshore protein), 0.4 μL of upstream and downstream primers each (final concentration 0.5 μM), cDNA 2 μL, 7.2 μL ddH2O, the total reaction system is 20 μL;

[0030] S42: Three-step PCR amplification: The PCR amplification procedure included 95°C pre-denaturation for 1 min; 95°C denaturation for 20 s, 60°C annealing for 20 s, and 72°C extension for 30 s, for a total of 40 cycles; and finally 72°C extension for 10 min.

[0031] S43: Melting curve analysis: After the cycle is completed, a melting curve is drawn, and the fluorescence signal is collected every 0.5°C. The amplification specificity of the primer is determined by a single peak;

[0032] S44: CT value collation: The CT values ​​obtained by real-time fluorescence quantitative PCR are collated to facilitate subsequent analysis of the stability of the candidate internal reference genes.

[0033] Preferably: in step 5, the screening of stable internal reference genes comprises the following steps:

[0034] S51: Best Keeper analysis: The stability of candidate reference genes was evaluated by Best Keeper analysis. The smaller the standard deviation and relative standard deviation, the more stable the gene;

[0035] S52: Norm Finder analysis: Norm Finder analysis was used to rank candidate reference genes. Reference genes with lower stability values ​​had more stable expression.

[0036] S53: ge Norm analysis: The average stability value of candidate reference genes is calculated by ge Norm to determine the best reference gene;

[0037] S54: ΔCT value analysis: The candidate genes were ranked by average standard deviation, and the gene with the lowest ΔCT value was selected as the most stable reference gene;

[0038] S55: Ref Finder comprehensive analysis: Finally, the Ref Finder software was used to integrate the analysis results of ge Norm, Norm Finder, Best Keeper and ΔCT value to determine the most stable internal reference gene in all samples.

[0039] Preferably: In the asparagus qRT-PCR internal reference gene, the ACT7 amplification primer sequence is:

[0040] F:5'-AGGATACGCCCTTCCTCATG-3'

[0041] R:5'-GGCAGTCTCAAGTTCTTGCTCAT-3'.

[0042] Preferably, in step 1, Asparagus cochinchinensis plants from Shuangqiao Town, Dongxing District, Neijiang City, Sichuan Province are selected for sampling.

[0043] An application of an asparagus real-time fluorescence quantitative PCR internal reference gene: the asparagus real-time fluorescence quantitative PCR internal reference gene is applied to asparagus real-time fluorescence quantitative PCR detection.

[0044] An application of an asparagus real-time fluorescence quantitative PCR internal reference gene: the amplification primers of the asparagus real-time fluorescence quantitative PCR internal reference gene are applied to asparagus real-time fluorescence quantitative PCR detection.

[0045] The beneficial effects of the present invention are:

[0046] 1. Based on the full-length transcriptome data of Asparagus cochinchinensis, the present invention, through a strict internal reference gene screening procedure, for the first time determined the internal reference gene with the most stable expression in Asparagus cochinchinensis samples of different growth years and different tissue parts from 10 candidate internal reference genes, which is an innovation in the screening and application of internal reference genes for real-time fluorescence quantitative PCR of Asparagus cochinchinensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 is a specific agarose gel electrophoresis diagram of the candidate internal reference gene primers of the present invention;

[0048] Figure 2 It is a melting curve diagram of the candidate internal reference gene real-time fluorescence quantitative PCR of the present invention;

[0049] Figure 3 C is the candidate internal reference gene of the present invention for real-time fluorescence quantitative PCR T value;

[0050] Figure 4 The invention is based on BestKeeper, ge Norm, Norm Finder and ΔC T Stability analysis diagram of candidate internal reference genes using the value method;

[0051] Figure 5 This is a stability analysis diagram of candidate internal reference genes based on the Ref Finder method of the present invention;

[0052] Figure 6 This is the result graph of the expression level of the target gene in different tissues of three-year-old Asparagus cochinchinensis. DETAILED DESCRIPTION

[0053] The technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.

[0054] Embodiment 1:

[0055] A method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis and its application. When the present invention is implemented, the method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis in different growth years and different tissue parts comprises the following steps:

[0056] (1) Material acquisition: Asparagus cochinchinensis samples were selected from Shuangqiao Town, Dongxing District, Neijiang City, Sichuan Province, including three tissue parts (root tubers, stem segments and leaf-like branches) of three different growth years (one-year-old, two-year-old and three-year-old). All samples were surface sterilized with 75% ethanol after collection, and then placed in liquid nitrogen and stored in a -80℃ refrigerator for later use. All treatments were repeated 3 times, with a total of 27 samples.

[0057] (2) RNA extraction and cDNA synthesis: The total RNA of the sample was extracted using the FastPurePlant Total RNA Isolation Kit (Polysaccharides & Polyphenolics–rich) of Nanjing Novogene Biotech Co., Ltd. The integrity of the extraction results was verified by 1% agarose gel electrophoresis. The quality and concentration of RNA were detected using an ultra-micro spectrophotometer, and the RNA template was diluted to 100 ng / μL. The RT Easy TM II (with gDNase) instruction manual to synthesize the first-strand cDNA, and the synthesized product was stored in a -20°C refrigerator for future use.

[0058] (3) Screening of candidate internal reference genes and synthesis and verification of primers: Based on the full-length transcriptome data of Asparagus cochinchinensis, with the internal reference gene sequence of Arabidopsis thaliana as a reference, 10 common candidate internal reference genes were selected, including actin genes (ACT7 & ACT8), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), histone (H3.1), heat shock protein (HSP), transcription factor (NAC), protein phosphatase 2 (PP2A), S-adenosylmethionine (SAM) and ubiquitin (UBC1 & UBC8). Specific primers were designed using PrimerPremier 6.0 software. The specific information is shown in Table 1. The specific primers of the 10 candidate internal reference genes were verified by PCR. The reaction system (50 μL) was: 25 μL TaqPCR Master Mix (Shanghai Sangon Biotechnology), 1 μL cDNA template, 2 μL of upstream and downstream primers (final concentration 0.4 μM) and 20 μL ddH2O. The total reaction system was 50 μL. The reaction procedure was as follows: 94°C pre-denaturation for 4 min; 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 20 s, 35 cycles; 72°C extension for 10 min. After obtaining the amplified product, its specificity was verified by 1% agarose gel electrophoresis ( Figure 1 ).

[0059] Table 1 Primer information of candidate internal reference genes

[0060]

[0061]

[0062] (4) Real-time fluorescence quantitative PCR amplification of candidate internal reference genes: The 10 candidate genes of the reverse transcribed cDNA template were subjected to fluorescence quantification in the BIOER fluorescence quantitative PCR instrument (FQD-96A). The reaction system was: 2× SYBR qPCR SuperMix Plus 10μL (nearshore protein), upstream and downstream primers 0.4μL each (final concentration 0.5μM), cDNA 2μL, 7.2μL ddH2O, total reaction system 20μL. Three-step reaction program: 95℃1min; 95℃20s, 60℃20s, 72℃30s, 40 cycles. After the cycle is completed, a melting curve is drawn: 55~95℃, and the fluorescence signal is collected every 0.5℃. The single peak is used as the standard for primer specificity ( Figure 2 ). The C of the candidate reference gene obtained by real-time fluorescence quantitative PCR T Value Figure 3 .

[0063] (5) Best Keeper analysis: Best Keeper analysis is to judge the stability of candidate genes based on correlation coefficient, standard deviation and RSD. The smaller the standard deviation and RSD, the more stable the gene. However, if the standard deviation is greater than 1, the gene is considered unstable. As shown in Table 2, NAC is the most stable internal reference gene, followed by ACT7 and PP2A ( Figure 4 A).

[0064] Table 2 BestKeeper analysis of 10 candidate reference genes

[0065]

[0066]

[0067] (6) Norm Finder analysis: Norm Finder analysis uses the relative stability value of genes to rank candidate reference genes. The lower the stability value, the more stable the expression of the reference gene. Figure 4 As shown in B, ACT7 has the lowest stability value and the most stable expression, followed by NAC, while HSP has the highest stability value.

[0068] (7) GE Norm analysis: GE Norm is used to calculate the average stability value of candidate internal reference genes. The smaller the value, the more stable the gene expression. Figure 4 As shown in the results of C, ACT7 and NAC had the lowest stability values, while HSP had the highest stability value.

[0069] (8)ΔC T Value analysis: ΔC T The analysis is to sort the candidate genes by the average standard deviation. The lower the average standard deviation, the more stable the internal reference gene. Figure 4 D shows the ΔC of ACT7 T The value was the lowest, followed by PP2A and NAC, which was consistent with the above analysis results.

[0070] (9) RefFinder software analysis: RefFinder software is based on ge Norm, Norm Finder, BestKeeper and ΔC T The geometric mean of the ranking values ​​of the software was used to perform an overall ranking to determine the stability of the candidate reference genes. Figure 5 As shown, ACT7 was the most stable reference gene in all samples, followed by NAC and PP2A.

[0071] In summary, ACT7 is the most stably expressed reference gene in Asparagus cochinchinensis of different growth years and different tissue locations.

[0072] Embodiment 2:

[0073] Further verification was performed based on the internal reference gene ACT7 with the best stability screened out in Example 1 to ensure that truly reliable quantitative data was obtained. Using ACT7 as the internal reference gene, three genes, HMGR-1, ispE and IDI-2, which are key enzyme genes in the biosynthesis pathway of steroidal saponins in Asparagus neijiangensis, were selected as target genes, and their expression levels in different tissues of three-year-old Asparagus neijiangensis were analyzed and compared with the transcriptome data.

[0074] cDNAs from the tuberous roots (R), stem segments (S) and leaf branches (L) of three-year-old Neijiang asparagus were extracted as templates for quantitative PCR. ACT7 was used as the internal reference gene, and primers were designed according to the CDS sequences of HMGR-1, ispE and IDI-2. The sequences are shown in Table 3.

[0075] Table 3 Primer sequences of target genes

[0076]

[0077] The fluorescence quantitative reaction was carried out on the BIOER fluorescence quantitative PCR instrument (FQD-96A), and the reaction system was: 2× SYBR qPCR SuperMix Plus 10μL (nearshore protein), upstream and downstream primers 0.4μL each (final concentration 0.5μM), cDNA 2μL, 7.2μL ddH2O, total reaction system 20μL. Three-step reaction program: 95℃1min; 95℃20s, 60℃20s, 72℃30s, 40 cycles.

[0078] After the reaction, use 2 -ΔΔCT All data were standardized by the qRT-PCR method. SPSS22.0 was used to analyze the significant differences of qRT-PCR data, and Prism8 software was used to draw graphs.

[0079] The results are as follows Figure 6 As shown, the qRT-PCR results obtained using ACT7 as the internal reference gene were consistent with the FPKM value change trend in the transcriptome data.

[0080] In summary, gene ACT7 can be stably expressed in different growth years and different tissue parts of Neijiang Asparagus cochinchinensis, and can be used as an internal reference gene for real-time fluorescence quantitative PCR in different growth years and different tissue parts of Neijiang Asparagus cochinchinensis, which can lay a foundation for future research on important functional trait genes of Neijiang Asparagus cochinchinensis.

[0081] The nucleotide sequence of ACT7 is as follows:

[0082] ATGGCAGACACTGAGGATATCCAGCCCCTTGTCTGTGACAA

[0083] TGGTACCGGAATGGTTAAGGCTGGATTTGCTGGCGATGATGCAC

[0084] CTAGAGCAGTATTCCCTAGCATTGTAGGCAGACCTCGCCATACC

[0085] GGAGTCATGGTTGGGATGGGGCAGAAGGATGCTTATGTGGGCG

[0086] ATGAAGCCCAGTCCAAGAGAGGTATCCTCACCTTAAAGTATCCA

[0087] ATTGAGCATGGTATTGTCAGCAACTGGGATGATATGGAAAAGAT

[0088] CTGGCATCACACCTTCTACAATGAGCTCCGTGTTGCCCCCGAGG

[0089] AGCACCCTGTTCTTCTCACTGAGGCTCCACTCAACCCCAAGGC

[0090] CAACAGAGAGAAAATGACTCAGATCATGTTCGAAACCTTCAAT

[0091] GTTCCCGCCATGTATGTTGCCATCCAGGCCGTCCTCTCTCTCTAC

[0092] GCTAGTGGTCGTACCACAGGTATTGTGCTGGACTCTGGTGATGG

[0093] TGTCAGCCACACTGTCCCAATCTACGAAGGATACGCCCTTCCTC

[0094] ATGCCATCCTTCGTCTGGATCTCGCTGGTCGTGATCTCACTGATT

[0095] CCTTGATGAAGATCCTCACTGAGAGAGGTTACATGTTCACTACC

[0096] ACAGCAGAGCGGGAAATTGTAAGAGACATAAAGGAGAAGCTC

[0097] GCTTATGTTGCTTTAGATTATGAGCAAGAACTTGAGACTGCCAA

[0098] GAGCAGTTCCTCTGTGGAGAAGAACTACGAGCTTCCTGATGGT

[0099] CAGGTGATCACTATTGGAGCTGAGAGGTTCAGGTGCCCTGAGG

[0100] TCCTTCTTCCAGCCGTCATTCATTGGTATGGAAGCTGCCGGTATTC

[0101] ACGAGACAACCTATAACTCCATCATGAAGTGTGATGTGGATATC

[0102] AGGAAGGACTTGTATGGTAACATTGTGCTCAGTGGAGGGTCGA

[0103] CCATGTTCCCCGGTATTGCTGACCGTATGAGCAAGGAAATCACT

[0104] GCGCTTGCACCTAGCAGCATGAAGATCAAGGTTGTTGCACCTCC

[0105] TGAGAGGAAGTACAGTGTCTGGATTGGAGGCTCCATCCTTGCTT

[0106] CCCTCAGCACCTTCCAGCAGATGTGGATATCCAAGGCAGAGTAC

[0107] GATGAATCTGGTCCTTCAATCGTTCACCGCAAGTGCTTCTAA

[0108] The specific parameters of the above-described embodiments are only for the purpose of clearly describing the invention verification process, and are not intended to limit the scope of patent protection of the present invention. For those skilled in the art, several modifications and improvements may be made without departing from the concept of the present invention, and these all belong to the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be subject to the attached claims.

[0109] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and inventive concepts of the present invention within the technical scope disclosed by the present invention, and they should be covered by the protection scope of the present invention.

Claims

1. A method for screening internal reference genes for real-time fluorescence quantitative PCR of Asparagus cochinchinensis, characterized in that: include: Step 1, acquisition of materials: selecting Asparagus cochinchinensis plants for sampling, including sampling at different growth years and different tissue parts; Step 2, extraction of RNA from asparagus samples and preparation of cDNA templates: the collected and stored samples were ground into fine powder in liquid nitrogen, and the total RNA of the samples was extracted. The integrity of the extraction results was verified by 1% agarose gel electrophoresis; The quality and concentration of RNA were detected using an ultra-micro spectrophotometer, and the RNA template was diluted to 100 ng / μL. The first-chain cDNA was synthesized according to the RTEasyTMII instruction manual of Fuji Biotechnology Co., Ltd., and the synthesized product was stored at -20°C for future use. Step 3, selection of candidate internal reference genes and design of synthetic qRT-PCR amplification primers: Based on the full-length transcriptome data of Asparagus cochinchinensis, the internal reference gene sequence of Arabidopsis thaliana was used as a reference, and the nucleotide sequence of the candidate internal reference gene in Asparagus cochinchinensis was determined through sequence alignment and NCBI database Blast alignment, and qRT-PCR specific primers were designed using Primer Premier 6.0 software; Step 4, qRT-PCR amplification of candidate internal reference genes: Based on MIQE of real-time fluorescence quantitative PCR, the cDNA templates of different samples of Asparagus cochinchinensis obtained in step 2 were amplified by real-time fluorescence quantitative PCR, and the amplification specificity of each primer was determined by whether the melting curve was a single peak; Step 5, screening of stable internal reference genes: sort out the CT values ​​of candidate internal reference genes of Asparagus cochinchinensis, import them into ge Norm, NormFinder, BestKeeper and Ref Finder to analyze the qPCR results, evaluate the stability of candidate internal reference genes, and screen out the most stably expressed internal reference genes of Asparagus cochinchinensis in different growth years and different tissue parts.

2. The method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis according to claim 1, characterized in that: In step 1, obtaining materials includes the following steps: S11: Sample collection: Select one-year-old, two-year-old and three-year-old Asparagus cochinchinensis plants, and randomly select multiple plants from each growth year; S12: Tissue sampling: Each plant was sampled, including root tubers, stem segments and leaf branches, to ensure the representativeness of gene expression in different parts; S13: Sample processing: After collection, all samples were surface sterilized with 75% ethanol, quickly frozen in liquid nitrogen, and then transferred to -80°C for storage; S14: S12-S13 were repeated three times.

3. The method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis according to claim 1, characterized in that: In step 2, the extraction of RNA from the asparagus sample and the preparation of the cDNA template include the following steps: S21: Total RNA extraction: The collected and stored Asparagus samples were ground into fine powder in liquid nitrogen, and total RNA was extracted using the FastPure Plant Total RNA Isolation Kit of Nanjing Novogene Biotech Co., Ltd.; S22: Electrophoresis verification: The integrity of RNA was checked by 1% agarose gel electrophoresis; if complete 28S and 18S rRNA bands were observed, RNA extraction was successful; S23: Concentration determination: Use an ultra-micro spectrophotometer to detect RNA quality and concentration to ensure that it meets the experimental requirements; S24: cDNA synthesis: According to the RT EasyTMII instruction manual of Fuji Biotechnology Co., Ltd., the first-chain cDNA was synthesized and the synthesized product was stored at -20°C for future use.

4. The method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis according to claim 1, characterized in that: In step 3, the selection of candidate internal reference genes and primer design include the following steps: S31: Sequence alignment and database query: Based on the full-length transcriptome data of Asparagus cochinchinensis and the reference gene sequence of Arabidopsis thaliana, the candidate reference genes with relatively stable expression were determined through sequence alignment and NCBI database Blast alignment; S32: Primer design: Specific primers were designed using Primer Premier 6.0 software; S33: PCR verification: The designed primers were verified by PCR to confirm that the selected primers could accurately amplify the target gene fragment; the reaction system was: 25 μL Taq PCR Master Mix, 1 μL cDNA template, 2 μL each of upstream and downstream primers and 20 μL ddH2O, and the total reaction system was 50 μL; the reaction procedure included four steps: pre-denaturation, denaturation, annealing and extension.

5. The method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis according to claim 1, characterized in that: In step 4, the qRT-PCR amplification of the candidate internal reference gene includes the following steps: S41: Real-time fluorescence quantitative PCR preparation: Perform fluorescence quantitative PCR amplification of reverse transcribed cDNA template in a fluorescence quantitative PCR instrument; the reaction system is: 2× SYBR qPCR SuperMix Plus 10μL, upstream and downstream primers 0.4μL each, cDNA 2μL, 7.2μL ddH2O, the total reaction system is 20μL; S42: Three-step PCR amplification: The PCR amplification procedure included 95°C pre-denaturation for 1 min; 95°C denaturation for 20 s, 60°C annealing for 20 s, and 72°C extension for 30 s, for a total of 40 cycles; and finally 72°C extension for 10 min. S43: Melting curve analysis: After the cycle is completed, a melting curve is drawn, and the fluorescence signal is collected every 0.5°C. The amplification specificity of the primer is determined by a single peak; S44: CT value collation: The CT values ​​obtained by real-time fluorescence quantitative PCR are collated to facilitate subsequent analysis of the stability of the candidate internal reference genes.

6. The method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis according to claim 1, characterized in that: In step 5, the screening of stable internal reference genes includes the following steps: S51: Best Keeper analysis: The stability of candidate reference genes was evaluated by Best Keeper analysis; S52: Norm Finder analysis: Norm Finder analysis was used to rank candidate reference genes; S53: ge Norm analysis: The average stability value of candidate reference genes is calculated by ge Norm to determine the best reference gene; S54: ΔCT value analysis: The candidate genes were ranked by average standard deviation, and the gene with the lowest ΔCT value was selected as the most stable reference gene; S55: Ref Finder comprehensive analysis: Finally, the most stable reference gene in all samples was determined by integrating the analysis results of ge Norm, Norm Finder, BestKeeper and ΔCT value through Ref Finder software.

7. The method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis according to claim 1, characterized in that: In the Asparagus cochinchinensis qRT-PCR internal reference gene, the ACT7 amplification primer sequence is: F:5'-AGGATACGCCCTTCCTCATG-3' R:5'-GGCAGTCTCAAGTTCTTGCTCAT-3'.

8. The method for screening an internal reference gene for real-time fluorescence quantitative PCR of Asparagus cochinchinensis according to claim 1, characterized in that: In the step 1, Asparagus cochinchinensis plants from Shuangqiao Town, Dongxing District, Neijiang City, Sichuan Province were selected for sampling.

9. An application of an asparagus real-time fluorescence quantitative PCR internal reference gene, characterized in that: described.

10. An application of an asparagus real-time fluorescence quantitative PCR internal reference gene, characterized in that: described.

Images