Adeno-associated virus structure plasmid capable of improving adeno-associated virus titer

Abstract

The invention relates to the technical field of molecular biology, in particular to an adeno-associated virus structure plasmid capable of improving adeno-associated virus titer, which is sequentially provided with a Rep gene expression cassette and a Cap gene expression cassette along a gene expression direction, the Rep gene expression cassette comprises a rep gene regulated and transcribed by a first promoter, and a transcription termination signal fragment is arranged behind the rep gene; the Cap gene expression cassette comprises a cap gene regulated and transcribed by a second promoter; wherein the first promoter comprises any one of a P5 promoter, an RSV promoter, an MMTV promoter, a UBC promoter and a U6 promoter, and the second promoter comprises one or more of a CMV promoter, a CBh promoter, a CAG promoter, an EF1 alpha promoter and an SFFV promoter.

Description

Adeno-associated virus structural plasmid capable of increasing adeno-associated virus titer

[0001] Cross-reference information

[0002] This application claims priority to Chinese patent application No. 202211056510.1 filed on August 31, 2022, the entire contents of which are incorporated herein by reference.

[0003] The present invention relates to the technical field of molecular biology, and in particular to an adeno-associated virus structural plasmid capable of improving the titer of the adeno-associated virus.

[0004] Gene therapy and cell therapy have entered a rapid development stage and have become the most promising direction for the development of life medicine. The main goal of gene therapy is to introduce exogenous genes into target cells or tissues to replace, compensate, block, and correct specific genes in order to achieve the purpose of treating diseases. In gene therapy, 70%-80% of treatment plans are completed through viral vectors. Viral vectors are the key vectors for delivering therapeutic exogenous genes to target sites. They can be directly injected as drugs or used as important raw materials for drug production. At present, viral vectors used to introduce exogenous genes into target cells mainly come from viral vectors such as retroviruses, adenoviruses, and adeno-associated viruses.

[0005] Adeno-associated virus (AAV) is a member of the Parvoviridae family. It is a type of icosahedral microvirus that cannot replicate autonomously and has no envelope. Its diameter is about 20-26nm. It consists of a protein capsid and a single-stranded DNA genome of 4.7kb in length. The protein capsid is composed of three subunits, namely VP1, VP2 and VP3. The two ends of the AAV genome are two "T"-shaped inverted terminal repeat sequences (ITR). These two ITRs are the starting point of viral DNA replication and the signal that triggers viral packaging. The rep gene in the AAV genome encodes four proteins related to viral replication, namely Rep78, Rep68, Rep52 and Rep40. The recombinant adeno-associated virus (rAAV) used in the study is a gene vector modified from the non-pathogenic wild-type AAV. Due to its diverse types, extremely low immunogenicity, high safety, wide range of host cells (it has the ability to infect both dividing and non-dividing cells), strong diffusion ability, and long gene expression time in vivo, rAAV is regarded as one of the most promising gene research and gene therapy vectors.

[0006] There are three main auxiliary expression systems for adeno-associated virus vector production: adenovirus (AdV), herpes simplex virus (HSV) and baculovirus (BV) expression systems. The adenovirus auxiliary system uses three plasmids to transiently enter HEK293 cells that constitutively express adenovirus E1a and E1b genes. One plasmid expresses the rep and cap genes of the adeno-associated virus; another plasmid expresses the target gene that needs to be delivered in vivo; and another plasmid expresses adenovirus genes with auxiliary functions to produce AAV; the herpes simplex virus auxiliary system places the AAV gene in the HSV1 genome and uses HSV co-infection to produce AAV; the baculovirus auxiliary system combines the characteristics of Sf9 cells that can express recombinant proteins in large quantities, uses insect baculovirus containing rAAV genome and rAAV rep / cap genes to transduce Sf9 cells, and allows AAV to assemble in Sf9 cells, ultimately achieving the purpose of large-scale production of AAV. At present, most adeno-associated viruses are produced by transient transfection and packaging of three plasmids to obtain viruses. For cell and gene therapy R&D companies, the demand for viral vectors is limited during preclinical research, IND filing, and clinical trials. As demand grows, the production titer of viral vectors is in stark contrast to the strict requirements of gene therapy for viral vector quality (including viral titer, residual substances) and dosage. Therefore, viral vectors that meet the ever-expanding clinical needs remain a major obstacle and one of the biggest limiting factors for potential commercial supply. The current unit AAV production yield from different platforms ranges from 10 to 20 cells per day. 3 Up to 10 5 AAV vector genomes (vg) are available in 100 million cells per day, and researchers around the world are working hard to increase vector production to meet the demand for high production. In general, the best way is to modify AAV-related genes, which helps to produce safe and high-quality vectors.

[0007]

[0008] The first object of the present invention is to provide an adeno-associated virus structural plasmid, which is provided with a Rep gene expression cassette and a Cap gene expression cassette in sequence along the gene expression direction;

[0009] The Rep gene expression cassette comprises a rep gene transcribed by a first promoter, and a transcription termination signal segment is arranged after the rep gene; the Cap gene expression cassette comprises a cap gene transcribed by a second promoter;

[0010] The first promoter comprises any one of P5 promoter, RSV promoter, MMTV promoter, UBC promoter and U6 promoter, and the second promoter comprises one or more of CMV promoter, CBh promoter, CAG promoter, EF1α promoter and SFFV promoter.

[0011] The second object of the present invention is to provide a kit comprising the adeno-associated virus structural plasmid as described above.

[0012] The third object of the present invention is to provide a method for preparing adeno-associated virus particles, comprising transferring the adeno-associated virus structural plasmid as described above, together with a transfer plasmid and a helper plasmid, into a host cell for packaging.

[0013] The adeno-associated virus structural plasmid can significantly improve the titer and infection activity of the adeno-associated virus.

[0014] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0015] Figure 1 is a map of plasmid 1#;

[0016] Fig. 2 is the map of plasmid 4#;

[0017] Fig. 3 is the electrophoresis diagram of the synthesized plasmids 3#, 4#, and 5# after restriction digestion;

[0018] Fig. 4 is the electrophoresis diagram of amplified plasmids 3#, 4#, and 5# after restriction digestion;

[0019] FIG5 is a graph showing the viable cell density and cell viability after transfection of plasmid systems with different structural plasmids;

[0020] Figure 6 shows the AAV genome copy number after transfection of different structural plasmid systems;

[0021] FIG7 shows the AAV transduction titer after transfection of different structural plasmid systems;

[0022] FIG8 is a graph showing the viable cell density and cell viability after transfection of different strong promoter plasmid systems;

[0023] FIG9 shows the AAV genome copy number after transfection of different strong promoter plasmid systems;

[0024] FIG. 10 shows the AAV transduction titer after transfection of different strong promoter plasmid systems.

[0025] Reference to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0026] Unless otherwise indicated, the meaning of all terms (including technical and scientific terms) used to disclose the present invention is the same as that commonly understood by those of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0027] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of related listed items, wherein the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0028] As used herein, the terms "comprising", "including" and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0029] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0030] The present invention relates to concentration values, which include fluctuations within a certain range. For example, it can fluctuate within a corresponding precision range. For example, 2% can allow fluctuations within ±0.1%. For values ​​that are large or do not require too fine control, it is also allowed to include greater fluctuations. For example, 100mM can allow fluctuations within the range of ±1%, ±2%, ±5%, etc.

[0031] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0032] In the present invention, "first" and "second" are only used to distinguish promoters that regulate different genes, but they do not have any limiting effect on the type and number of promoters.

[0033] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0034] In the present invention, "preferably", "better", "more preferably", and "suitably" are only used to describe implementation methods or examples with better effects, and it should be understood that they do not constitute a limitation on the scope of protection of the present invention. In the present invention, "optionally", "optional", and "optional" refer to being optional, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent of each other.

[0035] The present invention relates to an adeno-associated virus structural plasmid, which is provided with a Rep gene expression cassette and a Cap gene expression cassette in sequence along the gene expression direction;

[0036] The Rep gene expression cassette comprises a first promoter and a rep gene that regulates transcription thereof, and a transcription termination signal segment is arranged after the rep gene; the Cap gene expression cassette comprises a second promoter and a cap gene that regulates transcription thereof;

[0037] The first promoter comprises any one of P5 promoter, RSV promoter, MMTV promoter, UBC promoter and U6 promoter, and the second promoter comprises one or more of CMV promoter, CBh promoter, CAG promoter, EF1α promoter and SFFV promoter.

[0038] The inventors of the present invention unexpectedly discovered that the higher yield of viral particles per cell due to ITR-based DNA self-replication may be related to (a) higher cap gene copies per cell, and (b) downregulated expression of Rep protein levels has a positive effect on vector yield and improves Rep-mediated cytotoxicity, which otherwise affects cell viability.

[0039] The present invention uses this method to transform the promoter, codon and other related elements of the adeno-associated virus structural plasmid, thereby achieving the effect of producing adeno-associated virus auxiliary vectors with high titer and high infection activity. The modified plasmid can be used for suspension transient production of adeno-associated virus vectors to meet the needs of later commercial use. By establishing a stable large-scale suspension cell production process platform, it is possible to produce high-titer, high-purity viral vectors that are sterile and heat-free throughout the preparation process, can be scalable, economical, and have controllable quality, thereby improving the quality of adeno-associated virus products in the entire industry.

[0040] Based on the above, the first promoter can be any weak promoter among P5 promoter, RSV promoter, MMTV promoter, UBC promoter or U6 promoter. In some embodiments, the first promoter is P5 promoter. P5 promoter can be contained in the adeno-associated virus structural plasmid itself, or it can be added later. The second promoter can be a single strong promoter, such as CMV promoter, CBh promoter, CAG promoter, EF1α promoter or SFFV promoter, etc.; it can also be a promoter containing two or more, such as CMV promoter and EF1α promoter, etc.; it can also be a promoter containing other genes that regulate transcription initiation, such as CMV promoter and CMV enhancer, etc.

[0041] In some embodiments, in the Rep gene expression cassette, the translation start codon of the rep gene is a start codon different from ATG. It is easy to understand that the optimal translation start codon ATG is replaced by some start codons that are not conducive to translation so as to weaken the expression of the gene. In some embodiments, the start codons of rep78 and rep68 are replaced with start codons different from ATG. In some embodiments, the start codons of rep78, rep68, rep52 and rep40 are all replaced with start codons different from ATG. In a more preferred embodiment, the start codon is selected from ACG, CAG, TTG, ATT, CTG or GTG codons. The codons here are codons corresponding to the DNA codon table.

[0042] In some embodiments, the Cap gene expression cassette further comprises a P40 promoter, which co-regulates the transcription of the cap gene with the second promoter.

[0043] In some embodiments, in the Cap gene expression cassette, a transcription termination signal segment is arranged after the cap gene.

[0044] The transcription termination signal can serve the purpose of terminating the transcription of the related gene. The transcription termination signal can be a single copy or multiple copies, such as 3×SV40 polyA, or a combination of multiple different polyAs. In some embodiments, the transcription termination signal fragments in the Rep gene expression cassette and the Cap gene expression cassette are independently selected from one or more of SV40 polyA, BGH polyA, TK polyA, hGH polyA or rbGlob polyA. The sequences of the above-mentioned transcription termination signal fragments and promoters are well known to those skilled in the art, and also cover their mutants within a moderate range, such as truncation, insertion, substitution and / or deletion of one or more nucleotides. For example, the concept of BGH polyA covers short BGH polyA.

[0045] In the present invention, the "rep gene" in the Rep gene expression cassette includes at least rep78 and rep68 genes, and preferably includes rep52 and rep40 genes. The rep52 and rep40 genes in the rep gene can be expressed by different plasmids.

[0046] In some preferred embodiments, the Rep gene expression cassette further comprises a rep gene (preferably rep52 and rep40 genes) transcribed by promoter P19 promoter. Preferably, the expression region of rep52 and rep40 genes is located downstream of rep78 and rep68 genes, and rep78 and rep68 genes are regulated by the first promoter.

[0047] In some specific embodiments, the nucleotide sequence of the P5 promoter is as shown in SEQ ID NO: 1; or a nucleotide sequence that has at least 80% identity thereto and can exert a transcription function no higher than that of the P5 promoter, for example, a nucleotide sequence with at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0048] In some specific embodiments, the nucleotide sequence of the P40 promoter is as shown in SEQ ID NO: 2; or a nucleotide sequence that has at least 80% identity thereto and can exert transcriptional function, for example, a nucleotide sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0049] In some specific embodiments, the nucleotide sequence of the CMV promoter is as shown in SEQ ID NO: 3; or a nucleotide sequence that has at least 80% identity thereto and can perform transcriptional function, for example, a nucleotide sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0050] In some specific embodiments, the nucleotide sequence of SV40 polyA is as shown in SEQ ID NO: 4; or a nucleotide sequence that has at least 80% identity thereto and can perform a termination function, such as a nucleotide sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0051] In some specific embodiments, the nucleotide sequence of BGH polyA is as shown in SEQ ID NO: 5; or a nucleotide sequence that has at least 80% identity thereto and can perform a termination function, such as a nucleotide sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0052] In some specific embodiments, the nucleotide sequence of the P19 promoter is as shown in SEQ ID NO: 6; or a nucleotide sequence that has at least 80% identity thereto and can exert transcriptional function, for example, a nucleotide sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0053] In some specific embodiments, the nucleotide sequence of the CBh promoter is as shown in SEQ ID NO: 8; or a nucleotide sequence that has at least 80% identity thereto and can exert transcriptional function, for example, a nucleotide sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0054] In some specific embodiments, the nucleotide sequence of the CAG promoter is as shown in SEQ ID NO: 9; or a nucleotide sequence that has at least 80% identity thereto and can exert transcriptional function, for example, a nucleotide sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0055] In some specific embodiments, the nucleotide sequence of the EF1α promoter is as shown in SEQ ID NO: 10; or a nucleotide sequence that has at least 80% identity thereto and can exert transcriptional function, for example, a nucleotide sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0056] In some embodiments, the adeno-associated virus structural plasmid is derived from a pAAV2 / 2 plasmid, and its original P40 promoter is inactivated or deleted. It refers to the plasmid corresponding to Addgene's catalog number 104963. The term "derived from" used herein refers to the source of the transformation, that is, the cloning vector is obtained by transforming the initial vector (e.g., pAAV2 / 2 plasmid) from which it is derived, and the transformation may include: (i) inserting one or more exogenous promoters on the initial vector such as pAAV2 / 2 plasmid, (ii) inserting one or more transcription termination signal fragments on the initial vector such as pAAV2 / 2 plasmid, (iii) mutating the initial vector such as pAAV2 / 2 plasmid to reduce the expression of rep, typically mutating the translation start codon ATC of rep to a start codon that is unfavorable to translation, (iv) mutating the initial vector such as pAAV2 / 2 plasmid to inactivate unnecessary additional promoters; or a combination of (i) to (iv).

[0057] In some embodiments, the P40 promoter contained in the rep gene of the adeno-associated virus structural plasmid is inactivated or deleted.

[0058] In some specific embodiments, the P40 promoter contained in the rep gene of the adeno-associated virus structural plasmid is mutated into a DelP40 promoter; in some embodiments, the nucleotide sequence of the DelP40 promoter is as shown in SEQ ID NO: 7 or a nucleotide sequence that has at least 80% identity thereto and can exert transcriptional function, for example, a nucleotide sequence with at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0059] According to yet another aspect of the present invention, it also relates to a kit, which comprises the adeno-associated virus structural plasmid as described above.

[0060] In some embodiments, the kit further comprises a transfer plasmid and / or a helper plasmid.

[0061] In the present invention, "transfer plasmid" refers to a plasmid used to load a target gene, which usually contains an ITR sequence. "Target gene" refers to an entity derived from and compared with the remaining entities with different genotypes. For example, a polynucleotide introduced into a plasmid or vector derived from a different species by genetic engineering technology is a heterologous polynucleotide. The target gene may include, for example, a gene (nucleotide sequence) encoding a protein that is defective or missing in a receptor individual or target cell; a gene encoding a protein with a desired biological or therapeutic effect (e.g., antibacterial, antiviral or antitumor / anticancer function); a nucleotide sequence encoding RNA that inhibits or reduces the production of harmful or otherwise undesirable proteins (e.g., a nucleotide sequence encoding an RNA interfering agent as defined above); and / or a nucleotide sequence encoding an antigenic protein. In some embodiments, the expression product of the target gene is an interfering RNA or an aptamer. Interfering RNA can be selected from, for example, siRNA, shRNA or miRNA. In some embodiments, the expression product of the target gene is mRNA, and such mRNA is preferably capable of expressing a protein, for example, a protein that imparts certain desired characteristics to the target cell, such as a fluorescent protein that allows cell tracing, provides an active enzyme that is lost or altered in the target cell, an antigenic substance used as a vaccine, etc. In some embodiments, the expression product of the target gene is a chimeric antigen receptor.

[0062] Suitable target genes include, but are not limited to, genes encoding at least one of the following proteins: interferon (e.g., IFN-γ, IFN-α, IFN-β, IFN-ω, IFN-τ); insulin (e.g., Novolin, Humulin, Humalog, Lantus, etc.); erythropoietin ("EPO"; e.g., epoetin-α, darbepoetin-α, epoetin-β; etc.); antibodies (e.g., monoclonal antibodies, such as rituximab, infliximab, etc.); (e.g., tadalafil, trastuzumab, HumiraTM (adalimumab), omalizumab, tositumomab, RaptivaTM (efalizumab), ErbituxTM (cetuximab), bevacizumab; etc.); antigen-binding fragments of monoclonal antibodies (e.g., ranibizumab); blood factors (e.g., alteplase, tissue plasminogen activator protein, recombinant human factor VIIa, factor VIIa, factor VIII, factor IX, beta-globulin, hemoglobin; etc.); colony-stimulating factor stimulating factors (e.g., filgrastim (G-CSF), Neulasta (pegylated filgrastim), granulocyte colony stimulating factor (G-CSF), granulocyte monocyte colony stimulating factor, macrophage colony stimulating factor, megakaryocyte colony stimulating factor; etc.); growth hormones (e.g., somatotropin, somatotropin; etc.); interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, I L-8, IL-9; etc.); growth factors (e.g., beclapermin (PDGF), trofermin (bFGF), anciplostatin (stem cell factor), keratinocyte growth factor, acidic fibroblast growth factor, stem cell factor, basic fibroblast growth factor, hepatocyte growth factor; etc.); soluble receptors (e.g., TNF-α binding soluble receptors, such as (etanercept), soluble VEGF receptor, soluble interleukin receptor, soluble gamma / delta T cell receptor; etc.); Enzymes (e.g., α-glucosidase, β-glucocerebrosidase, alglucosidase), enzyme activators (e.g., tissue plasminogen activator); chemokines (e.g., IP-10, Mig, Groα / IL-8, RANTES, MIP-1α, MIP-1β, MCP-1, PF-4; etc.); angiogenic agents (e.g., vascular endothelial growth factor (VEGF); anti-angiogenic agents (e.g., soluble VEGF receptor); protein vaccines;Neuroactive peptides, such as bradykinin, cholecystokinin, gastrin, secretin, oxytocin, gonadotropin-releasing hormone, β-endorphin, enkephalin, substance P, somatostatin, prolactin, galanin, growth hormone-releasing hormone, cerulein, dynorphin, neurotensin, motilin, thyroid-stimulating hormone, neuropeptide Y, luteinizing hormone, calcitonin, insulin, glucagon, vasopressin, angiotensin II, thyrotropin-releasing hormone, vasoactive intestinal peptide, sleep peptide, etc.; other proteins, such as thrombolytic agents, atrial natriuretic peptide, bone morphogenetic protein, thrombopoietin, relaxin, glial fibrillary acidic protein, follicle-stimulating hormone, human α -1 antitrypsin, leukemia inhibitory factor, transforming growth factor, insulin-like growth factor, luteinizing hormone, macrophage activating factor, tumor necrosis factor, neutrophil chemotactic factor, nerve growth factor, tissue inhibitor of metalloproteinases; vasoactive intestinal peptide, angiogenin, angiotropin, fibrinogen; hirudin; leukemia inhibitory factor; IL-1 receptor antagonist (e.g., (anakinra)); ion channels, for example, cystic fibrosis transmembrane conductance regulator (CFTR); dystrophin; utrophin (a tumor suppressor); lysosomal enzyme acid alpha-glucosidase (GAA); etc. Suitable target genes also include those encoding functional fragments of any of the above proteins; and nucleic acids encoding functional variants of any of the above proteins. ;

[0063] In the present invention, "helper plasmid" refers to Helper plasmid, which refers to a plasmid containing genes (such as E2A, E4, VARNA, etc.) encoding adeno-associated virus replication. A variety of such helper viruses of AAV are known in the art, including (for example) adenovirus, herpes virus and pox virus (such as vaccinia). Many adenoviruses of human, non-human mammalian and avian origin are known and can be obtained from collection centers such as CCTCC and CGMCC. Viruses of the herpes family include (for example) herpes simplex virus (HSV) and Epstein-Barr viruses (EBV) as well as cytomegalovirus (CMV) and pseudorabies virus (PRV).

[0064] The above-mentioned adeno-associated virus structural plasmid, transfer plasmid or auxiliary plasmid may also contain a selection marker (such as a screening gene; or a tag that facilitates enrichment, such as a his tag; or a tag that facilitates detection, such as GFP), and a sequence for autonomous replication of the DNA construct in a prokaryotic or eukaryotic host cell, such as an origin of replication (ori), or contain regulatory elements necessary for affecting expression in specified target cells.

[0065] In some embodiments, the plasmid comprises two or more, for example, 3, 4, 5, 6, 7, 8, 9, 10 or more endonuclease recognition sequences.

[0066] In some embodiments, the plasmid comprises a selection gene, and typical selection genes are antibiotic resistance genes, such as kanamycin resistance gene (nptII), tetracycline resistance gene (tetR), neomycin phosphotransferase gene (npt), etc. The selection gene can also be certain compound detoxification enzyme genes, carbohydrate metabolism enzyme selection marker genes, etc.

[0067] The adeno-associated virus particles protected by the present invention may have a genome from any AAV virus. Adeno-associated virus particles may also be used interchangeably with "AAV virus" or "AAV virus particles" or "rAAV vector particles". "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or its derivatives. Unless otherwise required, the term includes subtypes and naturally occurring and recombinant forms. The abbreviation "rAAV" refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or "rAAV" vector). The term "AAV" may be used to refer to different serotypes of adeno-associated viruses, and multiple serotypes of AAV have been identified, including 13 human serotypes and more than 100 non-human primate serotypes. For example, AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), AAV type 10 (AAV10), AAV type 11 (AAV11), AAV type 12 (AAV12), AAV type 13 (AAV13), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. "Primate AAV" refers to AAV that infects primates, "non-primate AAV" refers to AAV that infects non-primate mammals, and "bovine AAV" refers to AAV that infects bovine mammals, etc. Among them, AAV2, AAV3, and AAV9 are derived from humans themselves, and are therefore preferred; more preferred is AAV2. The genomic sequences of different subtypes of AAV, as well as the sequences of natural terminal repeats (ITRs), Rep proteins and capsid subunits are known in the art. Such sequences can be found in the literature or in public databases such as GenBank.

[0068] The rep gene and cap gene in the corresponding serotype used in the present invention can be wild type or a moderate range of mutants, and other techniques such as rational mutagenesis, targeted peptide engineering, chimeric particle generation, library and directed evolution methods and immune escape modification are used to optimize the rep gene and cap gene sequences of AAV vectors, for example, to achieve immune escape and enhance therapeutic output. See, for example, Mitchell AM et al. AAV's anatomy: Roadmap for optimizing vectors for translational success. Curr Gene Ther. 10(5): 319-340.

[0069] The kit provided by the present invention may also include some conventional components, such as a restriction endonuclease that matches the restriction site contained in the above-mentioned plasmid, and instructions for use that record the method of using the kit.

[0070] The present invention also relates to a method for preparing adeno-associated virus particles, comprising transferring the adeno-associated virus structural plasmid as described above, together with a transfer plasmid and a helper plasmid, into a host cell for packaging and culturing, and collecting the adeno-associated virus particles after lysing the host cell.

[0071] The above-mentioned plasmids can be transformed into host cells using any method known in the art, including but not limited to chemical transformation or electroporation.

[0072] In some embodiments, the host cell can provide adenovirus E1 region (eg, E1a and E1b). The host cell can be a common mammalian (eg, mouse, rabbit, dog, monkey, cow, sheep, horse, donkey, human) cell or cell line in the art.

[0073] In some embodiments, the host cell is a HEK-293 cell or a derivative thereof. In some specific embodiments, the host cell is a suspended HEK293 cell. In one embodiment, the host cell is a PowerS TM -293 cells.

[0074] In some embodiments, the derivative strain is selected from at least one of HEK-293A, HEK-293S, HEK-293SG, HEK-293SGGD, HEK-293T, HEK-293T / 17SF, HEK-293H, HEK-293E, HEK-293-6E, HEK-293F, HEK-293FT, HEK-293FTM, AAV-293 and GP2-293.

[0075] In some embodiments, the plasmid is transferred into the host cell by transient transformation. In other embodiments, the host cell is cultured in suspension.

[0076] Optionally, the method further comprises the step of isolating and purifying adeno-associated virus particles therefrom.

[0077] Embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably referred to the guidance provided in the present invention, and can also be based on the experimental manual or normal conditions in this area, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0078] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0079] Example 1 Design, synthesis and verification of pAAV-Rep2 / Cap2 plasmid

[0080] Based on the independently synthesized pAAV-Rep2 / Cap2 (hereinafter referred to as pRC2) plasmid (refer to Addgene's pAAV2 / 2 plasmid, catalog number: 104963), which contains rep gene, cap gene, P19, P40 promoter and other elements, the following two directions were selected for transformation:

[0081] 1. Reduce the expression of rep: by adding the P5 promoter and changing the ATG codon to the weaker ACG codon;

[0082] 2. Enhance the expression of cap: Under the premise of not affecting the encoded amino acid, the P40 promoter in the rep gene is mutated to make it lose its function (i.e. P40 mutation DelP40), and a polyA tail is added after the rep gene. By adding a CMV promoter in front of the cap gene, the expression of Cap can be regulated and enhanced separately, and the expression of Cap gene can be further enhanced by the CMV+P40 dual promoter;

[0083] Based on the above transformation ideas, the following five pRC2 modified plasmid sequences (plasmids 2#-6#) were designed, among which plasmid 1# is the original unmodified plasmid (see Figure 1), and the representative modified plasmid 4# map is shown in Figure 2, in the hope of achieving the goal of increasing the virus titer.

[0084] 1#:pRC2-ATG-Rep(P40)-Cap

[0085] 2#: pRC2-MMTV-ACG-Rep(DelP40)-SV40polyA-CMV-Cap-BGHpolyA;

[0086] 3#: pRC2-P5-ACG-Rep(DelP40)-SV40polyA-CMV-Cap-BGHpolyA;

[0087] 4#: pRC2-P5-ACG-Rep(DelP40)-SV40polyA-CMV-P40-Cap-BGHpolyA;

[0088] 5#: pRC2-P5-ATG-Rep(DelP40)-SV40polyA-CMV-P40-Cap-BGHpolyA;

[0089] 6#: pRC2-P5-ACG-Rep(DelP40)-SV40polyA-P40-Cap-BGHpolyA.

[0090] The sequences of the above components are shown as follows:

[0091] P5 promoter: GGTGGAGTCGTGACGTGAATTACGTCATAGGGTTAGGGAGGTCCTGTATTAGAGGTCACGTGAGTGTTTTGCGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTAAGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGG (SEQ ID NO: 1)

[0092] P19 promoter:

[0093] GCCGGAGGCGGGAACAAGGTGGTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCGTGGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTGGCG (SEQ ID NO: 6)

[0094] DelP40 promoter:

[0095] GGTCACCAAGCAAGAGGTTAAGGACTTTTTCCGGTGGGCAAAGGATCACGTGGTTGAGGTGGAGCATGAATTCTACGTCAAAAAGGGTGGAGCCAAGAAAAGACCAGCACCAAGTGACGCAGACATCAGCGAGCCCAAACGGGTGCGCGAGTCAGTTGCGCAGCCATCGACGTCAGACGC (SEQ ID NO: 7)

[0096] P40 promoter: GGTCACCAAGCAGGAAGTCAAAGACTTTTTCCGGTGGGCAAAGGATCACGTGGTTGAGGTGGAGCATGAATTCTACGTCAAAAAGGGTGGAGCCAAGAAAAGACCCGCCCCCAGTGACGCAGATATAAGTGAGCCCAAACGGGTGCGCGAGTCAGTTGCGCAGCCATCGACGTCAGACGC (SEQ ID NO: 2)

[0097] CMV promoter:

[0098] SV40 poly(A):

[0099] BGH poly(A):

[0100] These five plasmids were synthesized by Nanjing GenScript Biotechnology Co., Ltd. Through enzyme digestion identification and Sanger sequencing, the enzyme digestion electrophoresis conditions were: according to different plasmids, 500ng of plasmid was taken, and different enzymes such as SacI, NotI, PmeI, SmaI, etc. were added for double digestion, incubated at 37°C for 60min, and then electrophoresed on 1% agarose gel with a voltage of 100V and a time of 30min. The results were analyzed as shown in Figure 3, verifying that the fragment sizes of the transformed plasmids 3#, 4# and 5# after enzyme digestion were consistent with the theoretical fragment sizes, and Sanger sequencing verified that the sequences were correct.

[0101] Example 2 Preparation and verification of pAAV-Rep2 / Cap2 plasmid

[0102] The plasmid was prepared by NEB Stable strain (purchased from NEW ENGLAND BioLabs, catalog number: C3040H), including plasmid transformation and verification, as follows:

[0103] 1. Place the Stable competent cells in an ice bath.

[0104] 2. Add the above 6 plasmid sequences to the Stable competent cell suspension respectively, flick to mix, and let stand in an ice bath for 30 minutes.

[0105] 3. Place the centrifuge tube in a 42°C water bath for 60-90 seconds, then quickly transfer the tube to an ice bath to cool the Stable competent cells for 2-3 minutes. Do not shake the centrifuge tube during this process.

[0106] 4. Add 900 μl of sterile LB medium (without antibiotics) to the centrifuge tube, mix well, and place in a 37°C shaker for 45-60 minutes to allow the bacteria to recover.

[0107] 5. Mix the centrifuge tube, draw 100 μl of transformed Stable competent cells and add them to the LB solid agar medium plate containing the corresponding antibiotics, and spread them evenly with a sterile spreader. Place the plate at room temperature until the liquid is completely absorbed, invert the plate, and culture it at 37°C for 12-16 hours.

[0108] 6. On the plate with grown colonies, pick a spot and place it in LB culture medium, place it in a shaker at 37°C for shaking culture, and preserve the glycerol bacteria.

[0109] 7. The plasmid was extracted using a kit (purchased from QIAGEN, catalog number: 12391), and the plasmid was identified by restriction digestion agarose gel electrophoresis. The identification gel images of plasmids 3#, 4# and 5# are shown in Figure 4. The fragment sizes of plasmids 3#, 4# and 5# after restriction digestion were consistent with the theoretical fragment sizes, and the plasmids were sequenced by Sanger sequencing to verify that the sequence results were correct.

[0110] Enzyme digestion and electrophoresis conditions: According to different plasmids, 500 ng of plasmid was taken and different enzymes, such as SacI, NotI, PmeI, SmaI, etc., were added for double digestion. The mixture was incubated at 37°C for 60 min, and then electrophoresis was performed on a 1% agarose gel at a voltage of 100 V for 30 min.

[0111] Plasmid fermentation:

[0112] The glycerol bacteria obtained in the previous step were inoculated into LB culture medium at a ratio of 1-2%, and cultured in a 37°C shaker for 16-18 hours. The plasmid was prepared with a final concentration of 1 mg / mL and endotoxin-free plasmid using a plasmid extraction kit for later use.

[0113] Example 3 Verification of the Effect of Plasmid on Adeno-associated Virus Titer

[0114] 1. PowerS TM-293 cells (GenScript) were revived in advance, passaged at 0.5E+6 cells / mL, and cultured in a constant temperature incubator at 37°C, 125 rpm, 8% CO2 for 3 days;

[0115] 2. In PowerS TM -293 cell density ≥4E+6 cells / mL, viability ≥90%, use pHelper plasmid (refer to Addgene's pAdDeltaF6, Catalog No.: 112867), the above-mentioned pAAV-Rep2 / Cap2 modified plasmid and pAAV-GFP plasmid (refer to Addgene's AAV GFP plasmid, Catalog No.: 49055), the plasmid addition amount is 0.375μg / 10 6 cells, and mixed them in a ratio of 1:3:1, and the AAV2 viral vector was packaged by the three-plasmid transient transfection method.

[0116] 3. Within three days after the cells were transfected, the density and viability of live cells were detected every day by the Vi-CELL XR fully automatic cell counting and viability analysis system (purchased from Beckman Coulter, catalog number: VICELL-XR). As shown in Figure 5, compared with the control group plasmid 1#, the viability of the transfected cells was equivalent, and the cell density after the modified plasmid transfection was even higher.

[0117] 4. Harvest the virus 72 hours after transfection, add lysis solution to the cells cultured in a ratio of lysis solution (Tween20, purchased from Sigma-Aldrich, catalog number: 9005-64-5): cell suspension = 1:9 (volume ratio), incubate at 37°C for 1 hour, centrifuge at 3000g for 20 minutes at 4°C, and take the supernatant for packaging.

[0118] Genome copy number reference Titer Kit ( The AAV functional titer (transduction titer) is determined by the following steps in the instruction manual of the AAV kit (for real-time PCR, TAKARA, catalog number: 6233); the AAV virus is diluted in gradients and then infected into HEK293T adherent cells. The expression of GFP gene is detected by flow cytometry to determine whether it is positive. The transduction titer is calculated based on the number of positive cells or positive wells combined with the virus dilution. The unit of measurement is the transduction unit (TU).

[0119] Table 1 Statistics of genome copy number data

[0120] Table 2 Transduction titer data statistics

[0121] As shown in FIG5 , the viable cell density and cell viability after transfection of the designed plasmids with different structures were different.

[0122] As shown in Figures 6, 7 and Tables 1 and 2, in terms of genome copy number, compared with the control, plasmids #3, #4 and #5 increased by 2.4, 4.2 and 4.1 times, respectively, among which plasmids #4 and #5 both reached 1E+11vg / mL; in terms of transduction titer, compared with the control, plasmids #3, #4 and #5 increased by 4.0, 4.1 and 2.0 times, respectively, among which plasmids #3 and #4 reached 1E+07TU / mL.

[0123] Example 4 pAAV-Rep2 / Cap2 strong promoter replacement and effect verification

[0124] In order to verify the universal effect of strong promoters on improving the physical biological titer of adeno-associated virus, the following three pRC2 modified plasmid sequences (plasmids 7#-9#) were designed using plasmid 4# as a template.

[0125] 4#:pRC2-P5-ACG-Rep(DelP40)-SV40polyA-CMV-P40-Cap-BGHpolyA;

[0126] 7#:pRC2-P5-ACG-Rep(DelP40)-SV40polyA-CBh-P40-Cap-BGHpolyA;

[0127] 8#:pRC2-P5-ACG-Rep(DelP40)-SV40polyA-CAG-P40-Cap-BGHpolyA;

[0128] 9#: pRC2-P5-ACG-Rep(DelP40)-SV40polyA-EF1α-P40-Cap-BGHpolyA.

[0129] The corresponding strong promoter element sequence is as follows:

[0130] CBh promoter: CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCTGAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAG(SEQ ID NO: 8)

[0131]

[0132] EF1α promoter: GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG (SEQ ID NO: 10)

[0133] These three plasmids were synthesized by Nanjing GenScript Biotechnology Co., Ltd. Through restriction digestion identification and Sanger sequencing, the specific method is detailed in Example 1, and it is verified that the fragment sizes of the transformed plasmids 7#, 8# and 9# after restriction digestion are consistent with the theoretical fragment sizes, and Sanger sequencing verifies that the sequences are correct.

[0134] The specific methods for plasmid preparation and verification are detailed in Example 2.

[0135] The specific method for verifying the effect of a strong promoter on the titer of adeno-associated virus is detailed in Example 3.

[0136] As shown in Figure 8, when only the strong promoter was replaced, the cell density and viability trends after transfection remained consistent. On the third day after transfection, the viable cell density was around 1E+07 cells / mL and the viable cell ratio was around 80%.

[0137] As shown in Figures 9 and 10, from the perspective of genome copy number, plasmid #8 has also been greatly improved compared to the control in the previous Example 3, while plasmid #4, plasmid #7 and #9 have all reached 1E+11vg / mL, and compared to the best quality plasmid #4 in the previous Example 3, plasmid #7 and #9 have increased by 1.5 and 1.2 times, respectively, further improving the genome copy number; from the perspective of transduction titer, plasmid #4, plasmid #7, plasmid #8 and #9 have all reached 1E+07TU / mL, among which plasmid #7 has the largest increase, and compared to the best quality plasmid #4 in the previous Example 3, plasmid #7, #8 and #9 have increased by 2.0, 1.2 and 1.6 times, respectively, which has improved the transduction titer well. Overall, the transformation of plasmids #4, #7, #8 and #9 was successful, and verified the feasibility and universality of different strong promoters for titer improvement.

[0138] At present, the AAV2 genome copy number packaged by major companies on the market is around 2 to 6E+10vg / mL, and the transduction titer is around 2 to 6E+06TU / mL, which is lower than other serotypes. The low titer of AAV2 viral vector often leads to the failure of downstream processes to proceed normally, and the recovery rate is low, and the low infection activity will have a great side effect on the efficiency of viral vector delivery. Based on these factors, it will greatly hinder the later commercial production. Most companies mainly improve the AAV packaging titer through a series of process optimization methods such as DoE screening and OFAT. However, process optimization methods may have the disadvantages of increasing plasmid residues, introducing other impurities, increasing downstream purification pressure, and increasing the variability of later process amplification. Although there will be an effect of increasing the titer, the increase is limited.

[0139] The present invention successfully screened out 4 pAAV-Rep / Cap plasmids of AAV2 by replacing promoters, start codons and other regulatory elements through molecular biological means. AAV2 was packaged under the three-plasmid expression system platform process, which increased its genome copy number by 2-5 times and transduction titer by 3-5 times, and also solved the problem of downstream purification difficulties.

[0140] The implementation of the present invention is not limited to the above-mentioned embodiments. Without departing from the spirit and scope of the present invention, ordinary technicians in this field can make various changes and improvements to the present invention in form and detail, and these are considered to fall within the protection scope of the present invention.

[0141] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims, and the description and drawings can be used to interpret the content of the claims.

Claims

An adeno-associated virus structural plasmid, which is provided with a Rep gene expression cassette and a Cap gene expression cassette in sequence along the gene expression direction; the Rep gene expression cassette comprises a first promoter and a rep gene whose transcription is regulated therefrom, and a transcription termination signal segment is arranged after the rep gene; the Cap gene expression cassette comprises a second promoter and a cap gene whose transcription is regulated therefrom; wherein the first promoter comprises any one of a P5 promoter, an RSV promoter, an MMTV promoter, an UBC promoter, and an U6 promoter, and the second promoter comprises one or more of a CMV promoter, a CBh promoter, a CAG promoter, an EF1α promoter, and an SFFV promoter. According to the adeno-associated virus structural plasmid according to claim 1, in the Rep gene expression cassette, the translation start codon of the rep gene is a start codon different from ATG; preferably selected from ACG, CAG, TTG, ATT, CTG or GTG codons. According to the adeno-associated virus structural plasmid according to claim 1, the Cap gene expression cassette further comprises a P40 promoter. According to the adeno-associated virus structural plasmid according to claim 1, in the Cap gene expression cassette, a transcription termination signal segment is provided after the cap gene. According to the adeno-associated virus structural plasmid according to claim 4, the transcription termination signal fragments in the Rep gene expression cassette and the Cap gene expression cassette are independently selected from one or more of SV40 polyA, BGH polyA, TK polyA, hGH polyA or rbGlob polyA. According to the adeno-associated virus structural plasmid according to claim 1, the Rep gene expression cassette further comprises a P19 promoter. The adeno-associated virus structural plasmid according to any one of claims 1 to 6, which is derived from the pAAV2 / 2 plasmid, and its original P40 promoter is inactivated or deleted. A kit comprising the adeno-associated virus structural plasmid according to any one of claims 1 to 7. The kit according to claim 8, further comprising a transfer plasmid and / or a helper plasmid. The kit according to claim 8 or 9 is used to produce adeno-associated viruses of any one or more of AAV1, AAV2, AAV3 to AAV13. The method for preparing adeno-associated virus particles comprises transferring the adeno-associated virus structural plasmid described in any one of claims 1 to 7, together with a transfer plasmid and / or a helper plasmid, into a host cell for packaging and culturing, and collecting the adeno-associated virus particles after lysing the host cell. According to the method for preparing adeno-associated virus particles according to claim 11, the host cell is capable of providing adenovirus E1 region, and is a HEK-293 cell or a derivative thereof. According to the method for preparing adeno-associated virus particles according to claim 12, the derivative strain is selected from at least one of HEK-293A, HEK-293S, HEK-293SG, HEK-293SGGD, HEK-293T, HEK-293T / 17SF, HEK-293H, HEK-293E, HEK-293-6E, HEK-293F, HEK-293FT, HEK-293FTM, AAV-293 and GP2-293. The method for preparing adeno-associated virus particles according to any one of claims 11 to 13, wherein the plasmid is transferred into the host cell by transient transformation. The method for preparing adeno-associated virus particles according to any one of claims 11 to 14, wherein the host cells are cultured in suspension.

Images