Streptomyces avermitilis strong promoter and application thereof

Abstract

The invention belongs to the technical field of strain metabolism modification, and particularly relates to a streptomyces avermitilis strong promoter and application. The nucleotide sequence of the streptomyces avermitilis strong promoter provided by the invention is as shown in SEQ ID NO. 4. The strong promoter can express and regulate a key gene, and the mRNA relative expression level of the gene driven by the strong promoter can still be kept stable in the 48-96-hour growth stage of the streptomyces avermitilis, which indicates that the strong promoter can keep high activity in the 48-96-hour growth stage of the streptomyces avermitilis, so that the target gene can be stably and highly expressed. Therefore, the strong promoter can be used for constructing recombinant plasmids for expressing key genes for synthesizing target natural products and streptomyces avermitilis recombinant bacteria, and the constructed streptomyces avermitilis recombinant bacteria can efficiently produce the target natural products.

Description

Technical Field

[0001] The present invention belongs to the technical field of strain metabolic engineering, and particularly relates to a strong promoter of Streptomyces avermitilis and its application. Background Art

[0002] As of 2003, there were more than 22,500 active compounds of microbial origin, and those from actinomycetes accounted for nearly half (45%), among which more than 75% were from Streptomyces. Since the fermentation yields of secondary metabolites in wild production strains of Streptomyces are very low and their biosynthesis processes are also very complex, for a secondary metabolite with important clinical application value to achieve commercial application, the most important thing is to increase the fermentation yield of the secondary metabolite to significantly reduce its production cost. Primary metabolism provides precursors for secondary metabolism, so the precursor content is a key factor in the production of active secondary metabolites, and it is necessary to optimize the precursor content to increase the yield of secondary metabolites. Secondary metabolites are often limited by the expression levels of key enzyme genes in biosynthesis, so overexpression of key enzyme genes is an effective way to increase the yield of secondary metabolites.

[0003] The diverse strengths of constitutive promoters are considered to give stable gene expression levels, and flexible regulatory promoters such as inducible promoters can dynamically regulate gene expression based on the cellular environment. Currently, the regulatory expression toolkit of Streptomyces has developed very slowly, and only a few effective strong promoters, such as ermE*p , tsrp1 , SF14p and kasO*p have been discovered and applied to Streptomyces strains. The activation and high production of Streptomyces natural products are mainly achieved through two methods: in situ activation and heterologous expression, specifically including integrating path-specific key gene expression cassettes in the original host, replacing the natural promoter upstream of silent genes, and remodeling biosynthetic gene clusters (BGCs) using efficient functional elements in a suitable heterologous host, etc., and most of them require the participation of promoters. However, research shows that ermEp * and kasOp * The mRNA levels of the expressed genes of the promoter are significantly reduced in the late growth stage (60 to 96 hours) of Streptomyces coelicolor. Therefore, screening or constructing a strong promoter of Streptomyces avermitilis is an important direction for future strain improvement. Summary of the Invention

[0004] In view of the above problems, the present invention provides a strong promoter of Streptomyces avermitilis and its application. The strong promoter of Streptomyces avermitilis provided by the present invention can regulate the expression of key genes for synthesizing target natural products in Streptomyces avermitilis, and its activity can remain stable during the 48 to 96-hour growth stage of Streptomyces avermitilis, so as to increase the yield of the target product through stable high expression of the target gene.

[0005] To achieve the above-mentioned invention object, the present invention adopts the following technical solutions: In the first aspect of the present invention, a strong promoter of Streptomyces avermitilis is provided, and its nucleotide sequence is as shown in SEQ ID NO.4.

[0006] SEQ ID NO.4: GGCCCCTCACTTTCGGGTCGGGCGATTTGCGTACTTTCCTCATGATGTGTATGGGGGCCGCGAAGTGGTGGACCGACGCCCGCGGCGCGTCGATCTTCCGATCAACACCACTCGGATGGACGCAAGGGGCCTGGAAAGTCCCTGAAAGCAAGGAAGAGCACGGAAAGTCACAGTCTGTGACGTGTGATCACCCTGAGATCAGAATGACGCCCTCCGGCCGGACAGCTGTATTCCGGGCGGCAGTTGGGGGCCGATGCAGGTCACCGATCGATATCGGTCGGTGTGTATAGTCGGGCGCCAGAGGTCCCCTACGTCAAAGAAAGACGAGGTCGCGCG。

[0007] By mining the endogenous strong promoter in Streptomyces avermitilis, the present invention obtains the endogenous strong promoter of Streptomyces avermitilis. This strong promoter can regulate the expression of key genes. Moreover, the relative mRNA expression level of the gene driven by this strong promoter can still remain stable during the 48 - 96 hour growth stage of Streptomyces avermitilis, without an obvious decreasing trend, indicating that this strong promoter can maintain high activity during the 48 - 96 hour growth stage of Streptomyces avermitilis and can stably and highly express the target gene. Therefore, the recombinant Streptomyces avermitilis constructed by the recombinant plasmid containing this strong promoter and the key gene for synthesizing the target natural product can stably and continuously synthesize the target natural product, thereby increasing the yield of the target natural product.

[0008] In the second aspect of the present invention, the application of the above-mentioned strong promoter of Streptomyces avermitilis in constructing a recombinant plasmid or a recombinant bacterium for regulating the expression of a target gene is provided.

[0009] Preferably, the recombinant plasmid contains the strong promoter of Streptomyces avermitilis and the target gene; the recombinant bacterium carries the recombinant plasmid.

[0010] In the third aspect of the present invention, a recombinant plasmid is provided, and this recombinant plasmid contains the above-mentioned strong promoter of Streptomyces avermitilis.

[0011] Preferably, the starting plasmid of the recombinant plasmid is the Pset152 plasmid.

[0012] Preferably, the recombinant plasmid further contains a target gene.

[0013] Exemplarily, the target gene may include key genes related to the synthesis of the target product.

[0014] Exemplarily, the present invention provides a method for constructing the above recombinant plasmid, comprising the following steps: S1. Construct a reporter gene screening plasmid containing a reporter gene; S2. Double digest the reporter gene screening plasmid with Xbal enzyme and BamHl enzyme; use the Streptomyces avermitilis genome as a template, and perform PCR amplification with the upstream primer P0011-F with an XbaI restriction site and the downstream primer P0011-R with a BamHI restriction site; ligate the digested product and the PCR amplification product by homologous recombination, transform the ligation product into Escherichia coli TOP10, and screen positive strains by PCR to obtain a recombinant plasmid with the above Streptomyces avermitilis strong promoter and reporter gene.

[0015] Preferably, the reporter gene in S1 is the gentamicin gene Gen.

[0016] The nucleotide sequence of the gentamicin gene Gen is shown in SEQ ID No.1.

[0017] ATGTTACGCAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGTGGCTCAAGTATGGGCATCATTCGCACATGTAGGCTCGGCCCTGACCAAGTCAAATCCATGCGGGCTGCTCTTGATCTTTTCGGTCGTGAGTTCGGAGACGTAGCCACCTACTCCCAACATCAGCCGGACTCCGATTACCTCGGGAACTTGCTCCGTAGTAAGACATTCATCGCGCTTGCTGCCTTCGACCAAGAAGCGGTTGTTGGCGCTCTCGCGGCTTACGTTCTGCCCAAGTTTGAGCAGCCGCGTAGTGAGATCTATATCTATGATCTCGCAGTCTCCGGCGAGCACCGGAGGCAGGGCATTGCCACCGCGCTCATCAATCTCCTCAAGCATGAGGCCAACGCGCTTGGTGCTTATGTGATCTACGTGCAAGCAGATTACGGTGACGATCCCGCAGTGGCTCTCTATACAAAGTTGGGCATACGGGAAGAAGTGATGCACTTTGATATCGACCCAAGTACCGCCACCTAA。

[0018] Further preferably, in S1, the starting plasmid is double digested with BamHI and NotI enzymes, and the reporter gene screening plasmid is obtained by homologous recombination.

[0019] The fourth aspect of the present invention provides a Pset152-0011- ectA recombinant plasmid, which contains the above-mentioned strong promoter of Streptomyces avermitilis and the coding gene of L-diaminobutyric acid acetyltransferase ectA . This recombinant plasmid can improve the expression of L-diaminobutyric acid acetyltransferase in Streptomyces avermitilis, thereby improving the ability of Streptomyces avermitilis to produce ectoine.

[0020] The fifth aspect of the present invention provides a method for constructing the above-mentioned Pset152-0011- ectA recombinant plasmid, including the following steps: SI. Construct a recombinant plasmid containing the above-mentioned strong promoter of Streptomyces avermitilis; SII. Double digest the recombinant plasmid in SI with BamHI and NotI enzymes; using the genome of Streptomyces avermitilis as a template, and using primers with BamHI and NotI restriction sites for the coding geneectA Perform PCR amplification; ligate the restriction enzyme digestion product and the PCR amplification product by homologous recombination, transform the ligation product into Escherichia coli TOP10, and screen for positive strains by PCR to obtain the Pset152-0011- ectA recombinant plasmid.

[0021] The sixth aspect of the present invention provides a recombinant Streptomyces avermitilis strain Sze2, and the recombinant Streptomyces avermitilis strain Sze2 expresses the above-mentioned Pset152-0011- ectA recombinant plasmid. The recombinant Streptomyces avermitilis strain Sze2 has the characteristic of high-yielding ectoine, and its ability to produce ectoine is stable.

[0022] The seventh aspect of the present invention provides a method for constructing the above-mentioned recombinant Streptomyces avermitilis strain Sze2, which specifically includes the following operations: transferring the Pset152-0011- ectA recombinant plasmid into Escherichia coli ET12567, and transferring it into Streptomyces avermitilis by the method of mycelial conjugation transfer to obtain the recombinant Streptomyces avermitilis strain Sze2.

[0023] Preferably, the Streptomyces avermitilis is a wild-type Streptomyces avermitilis, such as Streptomyces avermitilis with a preservation number of ATCC No. 31271.

[0024] The eighth aspect of the present invention provides the application of the above-mentioned recombinant Streptomyces avermitilis strain Sze2 in the synthesis of ectoine.

[0025] Preferably, the method for synthesizing ectoine using the recombinant Streptomyces avermitilis strain Sze2 specifically includes the following operations: After culturing the recombinant Streptomyces avermitilis strain Sze2 in a spore medium, scrape the spores and inoculate them into an ISP-2 liquid medium for fermentation culture, and the fermentation broth contains the ectoine.

[0026] Preferably, the composition of the ISP-2 liquid medium is: malt extract 10 g / L, yeast extract 4 g / L, glucose 4 g / L, and the matrix is water.

[0027] The beneficial effects of the present invention are as follows: Compared with the prior art, the strong promoter of Streptomyces avermitilis provided by the present invention can regulate the key genes for synthesizing target natural products in Streptomyces avermitilis, thereby increasing the yield of the target natural product. Moreover, the relative mRNA expression level of the gene driven by this strong promoter can remain stable during the 48-96 hour growth stage of Streptomyces avermitilis, without an obvious decreasing trend, indicating that this strong promoter can maintain high activity during the 48-96 hour growth stage of Streptomyces avermitilis, enabling the target gene to be stably and highly expressed. Therefore, the recombinant Streptomyces avermitilis strain constructed with the recombinant plasmid containing this strong promoter and the key gene for synthesizing the target natural product can stably and continuously synthesize the target natural product, increasing the yield of the target natural product. Experiments have proved that for the L-diaminobutyric acid acetyltransferase that affects ectoine synthesis, this strong promoter of Streptomyces avermitilis can highly express its encoding gene, and the yield of ectoine produced by the recombinant Streptomyces avermitilis strain constructed with the recombinant plasmid containing this strong promoter and the encoding gene of L-diaminobutyric acid acetyltransferase can reach 95 mg / L, significantly higher than that of the wild-type Streptomyces avermitilis, showing good market prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the result of verifying the activity of the strong promoter P0011 by the reporter gene Gen in Streptomyces avermitilis in Example 1 of the present invention; Figure 2 This is the relative mRNA expression diagram of the gene gene0011 driven by the strong promoter P0011 in Example 2 of the present invention (ns indicates p ≥0.05); Figure 3 This is in Example 5 of the present invention where the strong promoter P0011 drives the gene of Streptomyces avermitilis ectA and then improves the effect diagram of ectoine yield (* indicates p <0.05). DETAILED DESCRIPTION OF THE EMBODIMENTS

[0029] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the following further details the present invention in combination with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the protection scope of the present invention.

[0030] Promoters are key factors regulating gene expression in cells. Currently, there are few types of promoters applied to Streptomyces, and the mRNA expression level of genes driven by them significantly decreases during the late growth stage of Streptomyces (60 to 96 hours), unable to regulate gene expression for a long time. Therefore, it is necessary to screen or construct strong promoters of Streptomyces avermitilis to obtain better recombinant strains of Streptomyces avermitilis.

[0031] In view of the above problems, an embodiment of the present invention provides a strong promoter of Streptomyces avermitilis, and its nucleotide sequence is shown in SEQ ID NO.4.

[0032] An embodiment of the present invention also provides the application of the above-mentioned strong promoter of Streptomyces avermitilis in constructing a recombinant plasmid or a recombinant bacterium for regulating the expression of a target gene.

[0033] An embodiment of the present invention also provides a recombinant plasmid containing the above-mentioned strong promoter of Streptomyces avermitilis and its construction method. As a specific embodiment, an embodiment of the present invention provides a Pset152-0011- containing the above-mentioned strong promoter of Streptomyces avermitilis and the gene encoding L-diaminobutyric acid acetyltransferase ectA ectA recombinant plasmid.

[0034] An embodiment of the present invention also provides a recombinant bacterium of Streptomyces avermitilis expressing the above recombinant plasmid and its construction method. As a specific embodiment, an embodiment of the present invention provides a recombinant strain Sze2 of Streptomyces avermitilis expressing the above Pset152-0011- ectA recombinant plasmid and its construction method, as well as the application of this recombinant strain in the synthesis of ectoine.

[0035] The following illustrates the solution of the present invention through specific examples.

[0036] The Ectoine determination method used in the following examples is high performance liquid chromatography. The chromatographic column is SinoChrom ODS-BP (4.6×250mm, 5μm) chromatographic column, the mobile phase is 0.1% phosphoric acid water and acetonitrile (5:95), and the flow rate is 1 mL·min -1 ; Detector: DAD 220nm.

[0037] The components of the culture media used in the following examples are as follows: Sporulation medium: soybean cake powder 20 g / L, mannitol 20 g / L, agar powder 20 g / L, matrix is water; ISP-2 liquid medium: malt extract 10 g / L, yeast extract 4 g / L, glucose 4 g / L, matrix is water; ​ISP-2 Solid Medium: malt extract 10 g / L, yeast extract 4 g / L, glucose 4 g / L, agar powder 20 g / L, with water as the matrix.

[0038] Materials such as Streptomyces avermitilis (ATCC No. 31271), Pset-152 plasmid, pJQ200SK plasmid (carrying the Gen gene), Escherichia coli TOP10, and Escherichia coli ET12567 used in the following examples are all commercial products and can be obtained through commercial channels.

[0039] Unless otherwise specified, the reagents or instruments used in the following examples are all conventional commercially available products obtained through commercial channels. Unless otherwise specified, the techniques used in the following examples are all conventional techniques in the art.

[0040] Example 1 In this example, the strong promoter P0011 of Streptomyces avermitilis was inserted into the Pset152-Gen recombinant plasmid, and the activity of this strong promoter P0011 was verified. The specific process is as follows: 1. Construction of the Pset152-Gen reporter gene screening plasmid The Pset152 plasmid was double-digested with BamHI and NotI enzymes from EMS. The enzyme digestion reaction system was: 10×buffer 1 μL, BamHI 1 μL, NotI 1 μL, plasmid 1000 μg, ddH 2 O was supplemented to 50 μL. The enzyme digestion system was reacted at 37°C for 1 hour.

[0041] Using the pJQ200SK plasmid as a template, Gen was PCR amplified using the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3. The nucleotide sequence of Gen is shown in SEQ ID NO.1.

[0042] SEQ ID NO.2 (the underlined part is the homologous arm, which contains the BamHI cleavage site): CGACTCTAGAGGATCC ATGTTACGCAGCAGCAACGATGTTA; SEQ ID NO.3 (the underlined part is the homologous arm, which contains the NotI cleavage site): TATCGCGCGCGGCCGC TTAGGTGGCGGTACTTGGGTCGAT.

[0043] The reaction conditions were as follows: 95°C for 2 min, 95°C for 20 s, 65°C for 20 s, 72°C for 10 s, for a total of 35 cycles; 72°C for 5 min. The amplified product was recovered by 1% agarose gel electrophoresis.

[0044] The two fragments had the same homologous arms and were constructed into a recombinant plasmid by seamless cloning. The reaction system was as follows: 4 μL of 5 × CE II buffer from Vazyme, 2 μL of Exnase II, 130 μg of vector fragment (digested product), 20 μg of insert fragment (fragment recovered after PCR amplification), and ddH 2 O was supplemented to 20 μL. The reaction system was reacted at 30°C for 30 min. The ligation product was transformed into Escherichia coli TOP10, and positive strains were screened by PCR for DNA sequencing verification to verify the correct construction of the Pset152-Gen reporter gene screening plasmid.

[0045] 2. Construction of Pset152-0011-Gen plasmid The Pset152-Gen reporter gene screening plasmid was double digested with Xbal enzyme and BamHl enzyme from EMS. The digestion reaction system was as follows: 1 μL of 10× buffer, 1 μL of BamHI, 1 μL of NotI, 1000 μg of plasmid, and ddH 2 O was supplemented to 50 μL. The digestion system was reacted at 37°C for 1 hour.

[0046] Using the Streptomyces avermitilis genome as a template, the strong promoter P0011 (as shown in SEQ ID NO.4) was obtained by PCR amplification using the upstream primer P0011-F with an XbaI restriction site (as shown in SEQ ID NO.5) and the downstream primer with a BamHI restriction site (as shown in SEQ ID NO.6).

[0047] SEQ ID NO.5 (the underlined part is the homologous arm, which contains the XbaI restriction site): GCAGGTCGACTCTAGA GGCCCCTCACTTTCGGGTCGGGCGA; SEQ ID NO.6 (the underlined part is the homologous arm, which contains the BamHI restriction site): TGCGTAACATGGATCC CGCGCGACCTCGTCTTTCTTTGACG.

[0048] The reaction conditions were as follows: 95°C for 2 min, 95°C for 20 s, 65°C for 20 s, 72°C for 10 s, for a total of 35 cycles; 72°C for 5 min. The amplified product was subjected to 1% agarose gel electrophoresis and the corresponding fragment was recovered.

[0049] The two fragments had the same homologous arms and were constructed into a recombinant plasmid through seamless cloning. The reaction system was as follows: 4 μL of 5 × CE II buffer from Vazyme, 2 μL of Exnase II, 130 μg of vector fragment (digested product), 20 μg of inserted fragment (fragment recovered after PCR amplification), and ddH 2 O was supplemented to 20 μL. The reaction system was reacted at 30°C for 30 min. The ligation product was transformed into Escherichia coli TOP10, and positive strains were screened by PCR for DNA sequencing verification. After verifying that the construction of the Pset152-0011-Gen promoter screening plasmid was correct, the Pset152-0011-Gen plasmid was transferred into Escherichia coli ET12567 and transferred into Streptomyces avermitilis by the mycelial conjugation transfer method to obtain a recombinant Streptomyces avermitilis strain.

[0050] 3. Using the commonly used strong promoter ermE p* as a control, the activity of the strong promoter P0011 was verified in Streptomyces avermitilis. Construct the Pset152- ermE p*-Gen plasmid containing the strong promoter ermE p* according to the methods in steps 1 and 2. Transform this plasmid into Escherichia coli TOP10 and screen positive strains by PCR. Inoculate the positive strain and the positive strain containing the Pset152-0011-Gen plasmid into ISP-2 solid medium containing different concentrations of gentamicin (the final concentrations of gentamicin in the medium were 0 g / L, 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, 35 g / L) respectively, and culture in an incubator at 28°C for 6 d. The results were as Figure 1 shown. The strong promoter P0011 responded well to gentamicin, proving that the activity of the strong promoter P0011 was high.

[0051] Example 2 In this example, q-PCR was used to verify the mRNA level of the gene driven by the strong promoter P0011 of Streptomyces avermitilis in the recombinant Streptomyces avermitilis.

[0052] Through genomic analysis, the gene driven by the strong promoter P0011 of Streptomyces avermitilis was the Streptomyces avermitilis gene gene0011, and the nucleotide sequence of the Streptomyces avermitilis gene gene0011 was as shown in SEQ ID No.7: GTGAAGAAGCTTCTCCTGGTCGCACTGGCCGCCATCGGCGGGCTCCTCGTGTACCGCCAGATCCAGGCGGATCGCGCCGAGCAGGATCTGTGGACGGAGGCGACTGACTCCGTGCCCACGGGTTCGTGA。

[0053] The recombinant Streptomyces avermitilis obtained in Example 1 was cultured on a spore medium for 6 d, and then 0.5 cm 2 of spores were inoculated into 30 mL of ISP-2 liquid medium and cultured at 28°C with 180 rpm for 12 h. Then, 0.5 mL of the spore suspension was inoculated into 100 mL of ISP-2 liquid medium and cultured at 28°C with 180 rpm. The cells grown to 48 h and 96 h were taken to extract RNA. The extracted mRNA was reverse transcribed into cDNA using the PrimeScriptm RT reagent Kit with qDNA Eraser kit from TaKaRa. Using the 2×ChamQ Universal SYBR Master Mix kit from Vazyme, q-PCR reactions were performed with the q-PCR forward primer shown in SEQ ID NO.8 and the q-PCR reverse primer shown in SEQ ID NO.9.

[0054] SEQ ID NO.8: AAGAAGCTTCTCCTGGTCGC; SEQ ID NO.9: GTGGGCACGGAGTCAGTC.

[0055] The q-PCR reaction system was as follows: 10 μL of 2×ChamQ Universal SYBR Master Mix, 0.4 μL of the forward primer with a concentration of 10 μM, 0.4 μL of the reverse primer with a concentration of 10 μM, 1 μL of the template, and ddH 2 O was supplemented to 20 μL. The q-PCR reaction program was: 95°C for 30 s, 1 cycle; 95°C for 10 s, 60°C for 30 s, 40 cycles.

[0056] The results were as Figure 2 shown, and there were no significant differences in the relative mRNA expression levels of the target gene gene0011 at 48 h and 96 h.

[0057] Example 3 In this example, a recombinant plasmid Pset152-0011- was constructed based on the Pset152-0011-Gen plasmidectA and the recombinant strain Sze2 of Streptomyces avermitilis.

[0058] Using the genome of Streptomyces avermitilis as a template, amplified by conventional PCR ectA the nucleotide sequence. ectA The nucleotide sequence of is shown in SEQ ID NO.10: ATGACCGCCGCACACGCAGACCTGCAAGCGGAATTCCTGGAAATGCCCGAGGGACTGCGGATCGACCGCCCGGACGTGGCGGACGGGTCCGCACTCTGGCGCATCGCCAAGGACTCCAAGACCCTCGACCTGAACTCCTCGTACAGCTATCTGCTGTGGTGCCGTGACTTCGCCGGCACCACGGCGGTGGCACGAGCCGCCGACGGGACGCCCGTCGGCTTCATCACCGCGTACGTGCGGCCCGAGCGCCCGCACACCCTCCTCGTCTGGCAGGTGGCCGTCGACGCGGCGTACCGCGGGCGCGGGCTGGCCGCGCGCATGCTCGACGGACTGACCGCACGCGTCACGGACGAGTACGGGGTGACCGGCATCGAGACGACGATCTCCCCCGGCAACACCGCCTCCGAACGCCTGTTCACCTCGTATGCGCAGCGCCACGGCGCGGACCTCGAGCGTGAGGTCCTGTTCGAGGCAGGGCTGTTCCCCGACGCCCCGCACGACCCCGAGGTCCTGTACCGCATCGGCCCCCTCTCCCACTGA.

[0059] The upstream primer used carried a homologous arm, and the sequence was shown in SEQ ID NO.11 (the underlined part is the homologous arm, which contains the BamHI cleavage site): AGGTCGCGCGGGATCC ATGACCGCCGCACACGCAGACCTGCAAGCG; The downstream primer carried a homologous arm, and the sequence was shown in SEQ ID NO.12 (the underlined part is the homologous arm, which contains the NotI cleavage site): TATCGCGCGCGGCCGC TCAGTGGGAGAGGGGGCCGATGCGGTACAG.

[0060] The reaction conditions were: 95°C for 2 min, 95°C for 15 s, 65°C for 20 s, 72°C for 30 s, for a total of 35 cycles; 72°C for 5 min. The obtained sequence was subjected to 1% agarose gel electrophoresis and the corresponding fragment was recovered.

[0061] The Gen gene in the PSET152-0011-Gen plasmid was deleted by double digestion with BamHI and NotI from EMS. The enzyme digestion reaction system was: 10×buffer 1 μL, BamHI 1 μL, NotI 1 μL, plasmid 1000 μg, ddH 2 O was supplemented to 50 μL. The enzyme digestion system was reacted at 37°C for 1 hour.

[0062] The two fragments had the same homologous arms and were constructed into a recombinant plasmid by seamless cloning. The reaction system was: using 5×CE II buffer 4 μL from Vazyme, Exnase II 2 μL, vector fragment (enzyme digestion product) 130 μg, insert fragment (fragment recovered after PCR amplification) 20 μg, ddH 2 O was supplemented to 20 μL. The reaction system was reacted at 30°C for 30 min. The ligation product was transformed into Escherichia coli TOP10, and positive strains were screened by PCR for DNA sequencing verification to verify Pset152-0011- ectA After correct construction of PSET152-0011- ectA The plasmid was transferred into Escherichia coli ET12567 and transferred into wild-type Streptomyces avermitilis (WT) by mycelial conjugation transfer method to obtain the recombinant strain Streptomyces avermitilis Sze2.

[0063] Example 4 This example provides a method for directly constructing the recombinant plasmid Pset152-0011- ectA .

[0064] 1. Construction of the recombinant plasmid Pset152-0011 The Pset152 plasmid was double-digested with XbaI and BamHI from EMS. The enzyme digestion reaction system was: 10×buffer 1 μL, BamHI 1 μL, XbaI 1 μL, plasmid 1000 μg, ddH 2 O was supplemented to 50 μL. The enzyme digestion system was reacted at 37°C for 1 hour.

[0065] Using the Streptomyces avermitilis genome as a template, the P0011 strong promoter was obtained by PCR amplification using the upstream primer P0011-F with an XbaI restriction site (as shown in SEQ ID NO.5) and the downstream primer with a BamHI restriction site (as shown in SEQ ID NO.13).

[0066] SEQ ID NO.5 (The underlined part is the homologous arm, which contains the XbaI cleavage site): GCAGGTCGACTCTAGA GGCCCCTCACTTTCGGGTCGGGCGA; SEQ ID NO.13 (The underlined part is the homologous arm, which contains the BamHI cleavage site): GCGCGGCCGCGGATCC CGCGCGACCTCGTCTTTCTTTGACG.

[0067] The reaction conditions were as follows: 95°C for 2 min, 95°C for 20 s, 65°C for 20 s, 72°C for 10 s, for a total of 35 cycles; 72°C for 5 min. The amplified product was recovered by 1% agarose gel electrophoresis.

[0068] The two fragments have the same homologous arms and are constructed into a recombinant plasmid by seamless cloning. The reaction system was as follows: 4 μL of 5 × CE II buffer from Vazyme, 2 μL of Exnase II, 130 μg of vector fragment (digested product), 20 μg of insert fragment (fragment recovered after PCR amplification), and ddH 2 O was supplemented to 20 μL. The reaction system was reacted at 30°C for 30 min. The ligation product was transformed into Escherichia coli TOP10, and positive strains were screened by PCR for DNA sequencing verification to verify the correct construction of the Pset152-0011 plasmid.

[0069] 2. Construction of recombinant plasmid Pset152-0011- ectA of The Pset152-0011 plasmid was double digested with BamHI and NotI enzymes from EMS. The digestion reaction system was as follows: 1 μL of 10× buffer, 1 μL of BamHI, 1 μL of NotI, 1000 μg of plasmid, and ddH 2 O was supplemented to 50 μL. The digestion system was reacted at 37°C for 1 hour.

[0070] Using the genome of Streptomyces avermitilis as a template, the nucleotide sequence was amplified by conventional PCR ectA of ectA The nucleotide sequence of was as shown in SEQ NO.10: The upstream primer used carried a homologous arm, and the sequence was as shown in SEQ ID NO.11. The downstream primer carried a homologous arm, and the sequence was as shown in SEQ ID NO.12.

[0071] The reaction conditions were as follows: 95°C for 2 min, 95°C for 15 s, 65°C for 20 s, 72°C for 30 s, for a total of 35 cycles; 72°C for 5 min. The corresponding fragments were recovered after subjecting the obtained sequences to 1% agarose gel electrophoresis.

[0072] The plasmid Pset152-0011 and the fragment recovered after PCR amplification were used to construct a recombinant plasmid through seamless cloning. The reaction system was as follows: 4 μL of 5×CE II buffer from Vazyme, 2 μL of Exnase II, 130 μg of vector fragment (digested product), 20 μg of insert fragment (fragment recovered after PCR amplification), and ddH 2 O was supplemented to 20 μL. The reaction system was reacted at 30°C for 30 min. The ligation product was transformed into Escherichia coli TOP10, and positive strains were screened by PCR for DNA sequencing verification to verify that the construction of Pset152-0011- ectA was correct.

[0073] The correctly constructed recombinant plasmid PSET152-0011- ectA was transferred into Escherichia coli ET12567 and transferred into wild-type Streptomyces avermitilis (WT) by the method of mycelial conjugation transfer to obtain the recombinant strain Streptomyces avermitilis Sze2.

[0074] Example 5 This example verified the effect of Streptomyces avermitilis Sze2 constructed in Example 3 in fermenting to produce ectoine.

[0075] After culturing Streptomyces avermitilis Sze2 on a spore medium for 6 d, 0.5 cm 2 of spores were scraped and inoculated into 30 mL of ISP-2 liquid medium at 28°C and cultured at 180 rpm for 12 h. Then, 0.5 mL of the spore solution was taken and inoculated into 100 mL of ISP-2 liquid medium and cultured at 28°C and 180 rpm. The fermentation broth sample was taken on the 4th day of fermentation to detect the ectoine yield. The results were as Figure 3 shown. The ability of Streptomyces avermitilis Sze2 to produce ectoine was significantly higher than that of the wild-type Streptomyces avermitilis WT, indicating that the strong promoter P0011 significantly increased the ectoine yield by continuously enhancing the expression of the encoding gene of L-diaminobutyric acid acetyltransferase ectA (* indicates p < 0.05).

[0076] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, or improvements made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A strong promoter of Streptomyces avermitilis, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

4.

2. Use of the strong Streptomyces avermitilis promoter according to claim 1 in constructing a recombinant plasmid or recombinant bacteria for regulating the expression of a target gene.

3. The use according to claim 2, characterized in that: The recombinant plasmid contains a strong promoter of Streptomyces avermitilis and a target gene; and the recombinant bacteria carries the recombinant plasmid.

4. A recombinant plasmid, characterized in that: The recombinant plasmid contains the strong promoter of Streptomyces avermitilis according to claim 1.

5. The recombinant plasmid according to claim 4, characterized in that The starting plasmid of the recombinant plasmid is Pset152 plasmid; and / or the recombinant plasmid further comprises a target gene.

6. A Pset152-0011- ectA The recombinant plasmid is characterized in that Pset152-0011- ectA The recombinant plasmid contains the strong promoter of Streptomyces avermitilis according to claim 1 and the coding gene of L-diaminobutyric acid acetyltransferase ectA .

7. Pset152-0011- according to claim 6 ectA The method for constructing a recombinant plasmid is characterized in that: The following steps are involved: SI, constructing a recombinant plasmid containing the strong promoter of Streptomyces avermitilis according to claim 1; SII, using BamHI and NotI enzymes to double-digest the recombinant plasmid in SI; using the genome of Streptomyces avermitilis as a template, using primers with BamHI and NotI restriction sites to cleave the coding gene ectA PCR amplification was performed; the enzyme digestion product and the PCR amplification product were connected by homologous recombination, the connection product was transformed into Escherichia coli TOP10, and positive strains were screened by PCR to obtain the Pset152-0011- ectA Recombinant plasmid.

8. A recombinant strain of Streptomyces avermitilis Sze2, characterized in that: The recombinant strain Sze2 of Streptomyces avermitilis expresses Pset152-0011- ectA Recombinant plasmid.

9. The method for constructing the recombinant strain Sze2 of Streptomyces avermitilis according to claim 8, characterized in that: The specific operations include: ectA The recombinant plasmid was transferred into Escherichia coli ET12567, and then transferred into Streptomyces avermitilis by mycelium conjugation transfer method, thus obtaining the Streptomyces avermitilis recombinant strain Sze2.

10. Use of the recombinant strain Sze2 of Streptomyces avermitilis according to claim 8 in the synthesis of ectoine, characterized in that: Specifically, the method comprises the following operations: after culturing the recombinant strain Sze2 of Streptomyces avermitilis in a spore culture medium, scraping spores, and inoculating the spores into an ISP-2 liquid culture medium for fermentation culture, wherein the fermentation liquid contains the ectoine.

Images