Cell factor engineering bacterium system for targeting lung as well as construction method and application of cell factor engineering bacterium system

Abstract

The invention discloses a lung-targeting cell factor engineering bacterium system and a construction method and application thereof, and relates to the technical field of synthetic biology, the system comprises a pRSF-J23119-lung-pep-linker-IL-10-his engineering bacterium with a genome synchronous lysis module and a sodium alginate and chitosan two-component hydrogel. The sodium alginate and chitosan two-component hydrogel disclosed by the invention is not degraded in the stomach and directly reaches the intestinal tract, and is colonized in the intestinal tract and degraded in the intestinal tract after being orally taken; engineering bacteria in intestinal tracts are split to release IL-10 according to the growth density under the action of a genome synchronous splitting module, the IL-10 released by the engineering bacteria is delivered through an intestine-lung axis in blood transportation, and the IL-10 is colonized in a lung inflammation area through a targeting peptide lung-pep, so that tumor targeting of engineering bacteria drugs and precise controlled release of the drugs are realized, and the tumor targeting effect of the drugs is improved. The effects of relieving and treating lung inflammation of the IL-10 are exerted.

Description

Technical Field

[0001] The present invention relates to the field of synthetic biotechnology, and more specifically to an engineered bacteria system that releases cytokines targeted to the lungs through intestinal lysis after oral administration, as well as a construction method and application thereof. Background Art

[0002] With the rapid progress of modern medicine in the field of tumor treatment, clinicians can choose and develop a variety of treatment strategies to help patients delay the progression of the disease. However, existing treatment methods still have their own limitations and challenges. For example, traditional chemotherapy can cause side effects such as hair loss, nausea, vomiting, and immunosuppression, and tumors may also develop drug resistance during treatment, resulting in reduced efficacy; some immunotherapies may cause immune-related adverse reactions, such as rash, abnormal liver function, enteritis, etc. Therefore, it is imperative to find a new method to assist traditional tumor treatment and reduce treatment side effects.

[0003] According to existing research reports, interleukin-10 (IL-10) is a key anti-inflammatory cytokine that plays a vital role in regulating immune responses. Its potential in tumor treatment is also worthy of further study. IL-10 can inhibit the secretion of a variety of pro-inflammatory cytokines, such as IL-1β, IL-6, TNF-α, and IL-12, by acting on macrophages. These factors usually play a key role in inflammatory responses, enhancing inflammatory responses by inducing acute phase responses and activating other immune cells. IL-10 reduces the intensity of inflammatory responses by downregulating the expression of these cytokines. However, in the existing clinical treatment regimens using IL-10 recombinant protein, injection administration reduces the therapeutic benefits of such short-half-life drugs, and repeated injections can cause discomfort and decreased compliance in patients; traditional oral delivery causes IL-10 to be rapidly degraded by gastric acid and proteases; and some nanoencapsulation carriers cause toxic effects in vivo and are difficult to achieve accurate drug release.

[0004] Therefore, developing an interleukin-10 drug with fewer side effects and a targeted effect is an urgent problem that needs to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides an engineered bacteria system that releases cytokines targeted to the lungs through intestinal lysis after oral administration, as well as a construction method and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A lung-targeted cytokine engineered bacteria system, comprising a pRSF-J23119-lung-pep-linker-IL-10-his engineered bacteria with a genome synchronous lysis module and a sodium alginate@chitosan two-component hydrogel.

[0008] Preferably, the pRSF-J23119-lung-pep-linker-IL-10-his engineered bacteria with a genome synchronous cleavage module comprises a constitutive promoter J23119, an anti-inflammatory cytokine IL-10, a flexible linker, a lung epithelial cell targeting peptide lung-pep and a genome synchronous cleavage module.

[0009] More preferably, the nucleotide sequence of the lung epithelial cell targeting peptide lung-pep is as shown in SEQ ID NO.2.

[0010] More preferably, the genome synchronization lysis module can be used when the cell density reaches 4.8*10 8 CFU / ml (OD600=0.6) triggers bacterial lysis to release the target targeted therapeutic factors.

[0011] In the lung-targeted cytokine engineered bacteria system of the present invention, the sodium alginate@chitosan two-component hydrogel has the characteristics of uniform morphology, good dispersibility, high biocompatibility and high safety. It is not degraded in the stomach and directly reaches the intestine, achieving intestinal colonization after oral administration and being degraded in the intestine. Under the action of the genome synchronous lysis module, the engineered bacteria lyse and release IL-10 according to the growth density, and deliver the IL-10 released by the engineered bacteria through the intestine-lung axis during blood transportation, and colonize in the lung inflammation area through the targeting peptide lung-pep, achieving tumor targeting of the engineered bacteria drug and precise controlled drug release, and exerting the effect of IL-10 in alleviating and treating lung inflammation.

[0012] Another object of the present invention is to provide a method for constructing the above-mentioned lung-targeted cytokine engineering bacteria system, comprising the following steps:

[0013] S1: The IL-10 fragment was connected to the plasmid pRSF-1b chassis by red homologous recombination technology to construct pRSF-J23119-IL-10. Next, lung-pep and flexible linker were extended in sequence at the N-terminus of pRSF-J23119-IL-10 by vector self-circularization, and his purification tag was loaded at the C-terminus to obtain pRSF-J23119-lung-pep-linker-IL-10-his plasmid.

[0014] The constructed pRSF-J23119-lung-pep-linker-IL-10-his plasmid was chemically transferred into the competent DH5α strain with a genome synchronous lysis module to obtain the pRSF-J23119-lung-pep-linker-IL-10-his engineered bacteria capable of lysis;

[0015] S2: Use a dual-syringe pump microfluidic device to prepare sodium alginate@chitosan two-component hydrogel to encapsulate the engineered bacteria obtained in the previous step:

[0016] The pRSF-J23119-lung-pep-linker-IL-10-his engineering bacteria were cultured to the logarithmic growth phase, and the bacteria were mixed with 1% sodium alginate solution in equal proportions to obtain an internal prepolymer solution;

[0017] Prepare 5% calcium chloride solution to obtain external prepolymer solution;

[0018] The inner prepolymer solution was loaded into the inner injection pump, and the flow rate was set to 50 μL / min. The outer prepolymer solution was added into the outer injection pump, and the flow rate was set to 1500 μL / min, to prepare a single-layer engineering bacteria capsule coated with sodium alginate;

[0019] Then, the sodium alginate-coated single-layer engineered bacteria capsule is placed in a 1% chitosan solution, and the positive and negative charge adsorption principle is utilized to slowly stir the solution to form double-layer coated two-component micro-nano gel particles, namely, sodium alginate@chitosan two-component hydrogel-coated engineered bacteria capsules.

[0020] Another object of the present invention is to provide the use of the above-mentioned lung-targeted cytokine engineered bacteria system or the sodium alginate@chitosan two-component hydrogel-encapsulated engineered bacteria capsule obtained by the above-mentioned construction method in the preparation of oral dosage forms of drugs targeting lung tissue.

[0021] Beneficial effects:

[0022] 1. The biocompatible gel capsule enables the engineered bacteria drugs to reach the small intestine smoothly and be released after oral administration, avoiding the side effects of biological leakage of the drugs; the surface of the engineered bacteria is modified with alginate and chitosan coating to achieve intestinal adhesion and retention.

[0023] 2. After the engineered bacteria are colonized in the intestine, they lyse and release IL-10 according to their growth density. The IL-10 released by the engineered bacteria is delivered through the intestinal-lung axis and colonized in the inflammatory area of ​​the lung through targeting peptides, thus achieving tumor targeting of engineered bacteria drugs and precise controlled drug release.

[0024] 3. Utilize the increased intestinal permeability caused by the systemic inflammatory environment of patients with chronic inflammatory diseases of tumors to improve the patient's own drug absorption, and combine it with the long-term intestinal colonization of engineered bacteria to achieve the long-term effect of the drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0026] Figure 1 This is the verification result of IL-10 activity in the engineered bacteria constructed by the present invention.

[0027] Figure 2 The results are for measuring the expression of IL-10 in the engineered bacteria constructed by the present invention.

[0028] Figure 3 The present invention is a flow chart of the process for preparing the sodium alginate@chitosan two-component hydrogel-encapsulated engineering bacteria capsule.

[0029] Figure 4 This is the growth curve of the sodium alginate@chitosan two-component hydrogel-encapsulated engineering bacteria capsule in the intestinal simulated fluid of the present invention.

[0030] Figure 5 The figure shows the activation status of the sodium alginate@chitosan two-component hydrogel-encapsulated engineering bacteria capsule in different simulated liquids.

[0031] Figure 6 This is a diagram verifying the intestinal retention efficiency of the sodium alginate@chitosan two-component hydrogel-coated engineered bacteria capsule of the present invention.

[0032] Figure 7 This is a diagram verifying the targeting function of the sodium alginate@chitosan two-component hydrogel-encapsulated engineered bacteria capsule of the present invention. DETAILED DESCRIPTION

[0033] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Example 1

[0035] 1. Construction of engineered bacterial strains that release IL-10 by lysis

[0036] (1) Construction was based on the DH5α strain. First, the IL-10 fragment was connected to the plasmid pRSF-1b chassis by red homologous recombination technology to construct pRSF-J23119-IL-10. Next, the lung-pep and polyglycine flexible linker were sequentially extended from the N-terminus of the IL-10 sequence in the pRSF-J23119-IL-10 plasmid by vector self-cyclization, and the his purification tag (the his purification tag consists of six consecutive histidine residues) was loaded at the C-terminus to obtain the pRSF-J23119-lung-pep-linker-IL-10-his plasmid. The plasmid contains promoter J23119, IL-10, lung-pep, flexible linker, C-terminal his purification tag and kanamycin resistance gene. The primers and gene sequences required for the construction process were synthesized by GENEWIZ, Inc. (Suzhou, China).

[0037] Finally, the constructed pRSF-J23119-lung-pep-linker-IL-10-his plasmid was chemically transferred into a competent strain with a genome synchronous lysis module to obtain pRSF-J23119-lung-pep-linker-IL-10-his engineered bacteria that could lyse according to colony density.

[0038] The IL-10 sequence was obtained from the public database RSCB PDB: 5'-atgcctggctcagcactgctatgctgcctgctcttactgactggcatgaggatcagcaggggccagt acagccgggaagacaataactgcacccacttcccagtcggccagagccacatgctcctagagctgcggactgccttcagccaggtgaagactttctttcaaacaaaggaccagctggac aacatactgctaaccgactccttaatgcaggactttaagggttacttgggttgccaagccttatcggaaatgatccagttttacctggtagaagtgatgccccaggcagagaagcatgg cccagaaatcaaggagcatttgaattccctgggtgagaagctgaagaccctcaggatgcggctgaggcgctgtcatcgatttctcccctgtgaaaataagagcaaggcagtggagcagg tgaagagtgattttaataagctccaagaccaaggtgtctacaaggccatgaatgaatttgacatcttcatcaactgcatagaagcatacatgatgatcaaaatgaaaagctaa-3', seq ID NO.1.

[0039] The lung epithelial cell targeting peptide lung-pep was screened out, and its sequence is:

[0040] 5'-GCAACGAACCCAACCCGGGCTACCGCA-3', SEQ ID NO. 2.

[0041] The above components are connected by a flexible linker, which has high flexibility and low immunogenicity. This embodiment uses a polyglycine flexible linker, which can also be replaced by a polyserine linker, a polyglutamic acid linker or other flexible linkers according to different design requirements.

[0042] 5'-GTCGACACCGCCAGAACCCGCAGCACTGCCCGCGCTACCGGTACC-3', SEQ ID NO. 3.

[0043] (2) In the above step, the genome synchronous lysis module is the result of previous research in this laboratory, which is composed of LuxR-pluxI-sfGFP-luxR-pluxI-LuxI and p15A-pluxI-174-Cm double plasmids. The genome synchronous lysis module is chemically transferred into the DH5α competent strain (purchased from Nanjing Qingke Biotechnology Co., Ltd.).

[0044] Use 2.5% LB medium to culture the DH5α competent strain. When the cell density reaches 4.8*10 8 CFU / ml (OD600=0.6), overexpression and toxic effects of the LuxI / LuxR regulatory system lead to excessive accumulation of AHL (acyl-homoserinelactone), which can trigger bacterial lysis.

[0045] Key element LuxI sequence:

[0046] 5'--3', SEQ ID NO.4.

[0047] Key component LuxR sequence:

[0048] 5’-Ttaatttttaaagtatgggcaatcaattgctcctgttaaaattgctttagaaatactttggcagcggtttgttgtattgagtttcatttgcgcattggttaaatggaaagtgacagtacgctcactgcagcctaatatttttgaaatatcccaagagctttttccttcgcatgcccacgctaaacattctttttctcttttggttaaatcgttgtttgatttattatttgctatatttatttttcgataattatcaactagagaaggaacaattaatggtatgttcatacacgcatgtaaaaataaactatctatatagttgtctttttctgaatgtgcaaaactaagcattccgaagccattgttagccgtatgaatagggaaactaaacccagtgataagacctgatgttttcgcttctttaattacatttggagattttttatttacagcattgttttcaaatatattccaattaattggtgaatgattggagttagaataatctactataggatcatattttattaaattagcgtcatcataatattgcctccattttttagggtaattatctagaattgaaatatcagatttaaccatagaatgaggataaatgatcgcgagtaaataatattcacaatgtaccattttagtcatatcagataagcattgattaatatcattattgcttctacaagctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcat-3’, SEQ ID NO.5.

[0049] Sequence of key component pluxI:

[0050] 5'-Acctattgtttgtcgcaagttttgcgtgttatatatcattaaaacggtaatggattgacatttgatt ctaataaattggatttttgtcacactattgtatcgctgggaatacaattacttaacataagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatgaattcattaaagaggagaaaggtacc-3', SEQ ID NO.6.

[0051] Sequence of key element 174:

[0052] 5'-atggtacgctggactttgtgggataccctcgctttcctgctcctgttgagtttattgctgccgtcattgcttattatgttcatcccgtcaacattcaaacggcctgtctcatcatggaaggcgctgaatttacggaaaa cattattaatggcgtcgagcgtccggttaaagccgctgaattgttcgcgtttaccttgcgtgtacgcgcagg aaacactgacgttcttactgacgcagaagaaaacgtgcgtcaaaaattacgtgcggaaggagtga-3', SEQ ID NO. 7.

[0053] (3) At the same time, the lung-pep-linker-mcherry gene module was introduced into the pRSF-1b vector, and the mcherry reporter gene fluorescent protein with targeting peptide was constructed for in vivo functional verification of the targeting peptide.

[0054] 2. The recombinant positive plasmids pRSF-J23119-IL-10-his, pRSF-J23119-lung-pep-linker-IL-10-his (N-terminal targeting peptide IL-10), and pRSF-J23119-his-linker-IL-10-lung-pep (C-terminal targeting peptide IL-10) were introduced into the competent DH5α strain (normal group) and the DH5α strain with genome synchronization lysis module (lysis group) by chemical transformation, and then inoculated into LB medium at a ratio of 1:100 and cultured at 37°C for 16 hours until the logarithmic growth phase (OD 600 = 0.5). The expression of IL-10 protein was detected by WB and the results showed that the N-terminally modified IL-10 could be expressed normally (see Appendix Figure 1 ), and the lysis ability was tested by measuring the protein content in the supernatant by Elisa. The one with the highest expression level was the one that was transferred with N-targeted peptide IL-10 (lysis group), and its secretion reached a maximum of 2300pg / mL. Figure 2 As shown, WB results showed that the expression level of IL-10 after N-terminal connection with targeting peptide was higher than that of unmodified IL-10; Elisa results showed that there was no IL-10 expression in the supernatant of the bacterial solution of DH5α strain transferred, while IL-10 expression in the bacterial lysate of DH5α strain transferred with genome synchronous lysis module was normal.

[0055] Example 2

[0056] 1. Preparation of sodium alginate@chitosan two-component hydrogel capsules

[0057] The gel micro-nano particles containing engineered bacteria were mass-produced using a dual-syringe pump microfluidic device. The pRSF-J23119-lung-pep-linker-IL-10-his engineered bacteria that can be lysed were cultured with LB medium at a concentration of 2.5%, and the bacterial solution containing the engineered bacteria that synchronously lysed and released IL-10 was obtained after culturing at 37°C for 16 hours. The bacterial solution containing the engineered bacteria that synchronously lysed and released IL-10 was fully mixed with a 1% sodium alginate solution in a volume ratio of 1:1 to prepare an inner prepolymer solution (sodium alginate bacterial solution prepolymer solution). The outer solution was prepared with a 5% calcium chloride solution. The sodium alginate bacterial solution prepolymer solution was filled into the inner syringe pump, and the flow rate was set to 50 μL / min. The 5% calcium chloride solution was added to the outer syringe pump, and the flow rate was set to 1500 μL / min, to prepare a uniform micron-sized single-layer engineered bacteria capsule coated with sodium alginate. The sodium alginate-coated single-layer engineering bacteria capsule was placed in a 1% chitosan solution, and the positive and negative charge adsorption principle was utilized to slowly stir the solution to form a double-layer coated two-component micro-nano gel particle, i.e., the sodium alginate@chitosan two-component hydrogel-coated engineering bacteria capsule (see Appendix Figure 3 ). It was determined that the particle size of the sodium alginate@chitosan two-component hydrogel-encapsulated engineered bacteria capsule was 4-7 μm, which was used for subsequent animal oral experiments.

[0058] The same method was used to produce control IL-10 hydrogel capsules, N-terminal modified IL-10 hydrogel capsules, and C-terminal modified IL-10 hydrogel capsules.

[0059] 2. Sodium alginate@chitosan two-component hydrogel-coated engineered bacteria capsules were inoculated into 15 mL of intestinal simulated fluid at a ratio of 1:100 for culture. 100 μL of bacterial suspension was taken every hour and added to a 96-well plate. Three replicates were taken each time. The 96-well plate was treated with 4% paraformaldehyde in advance with 100 μL per well, and its 12-hour growth curve was recorded. The groups were divided into control group DH5α, IL-10 hydrogel capsule, N-terminal modified IL-10 hydrogel capsule, and C-terminal modified IL-10 hydrogel capsule, as shown in the attached Figure 4 The hydrogel capsule can ensure the growth activity of the engineered bacteria in the intestinal simulated fluid.

[0060] 3. Inoculate the sodium alginate@chitosan two-component hydrogel-coated engineered bacteria capsules in LB medium, gastric simulated fluid (GIF), and intestinal simulated fluid (SIF) respectively. Take 100 μL of bacterial suspension every hour and add it to a 96-well plate. Repeat 3 times each time. Treat the 96-well plate with 4% paraformaldehyde in advance with 100 μL per well, and record its 24-hour growth curve. Observe the activation of the sodium alginate@chitosan two-component hydrogel-coated engineered bacteria capsules in different environments and the resurrection of the engineered bacteria. As shown in the attached Figure 5 As shown, the chitosan shell of the sodium alginate@chitosan two-component hydrogel-wrapped engineered bacteria capsule can protect the sodium alginate core from being dissolved under acidic conditions, can remain closed in gastric simulated fluid, and can release the engineered bacteria well in intestinal simulated fluid.

[0061] Example 3

[0062] 1. Intestinal retention efficiency in the setting of lung tumors

[0063] Construction of C57BL / 6J mouse lung cancer in situ model: Twelve 5-week-old C57BL / 6J male mice (Nanjing Jicui Experimental Animal Co., Ltd.) were randomly divided into four groups, 3 mice in each group. Six C57BL / 6J male mouse in situ carcinoma models were constructed by intrapulmonary injection of cell suspension, and the tumor growth of mice was observed by IVIS in vivo imaging system. All 6 model mice were successfully constructed. The experimental groups were: control group (healthy mice) + PBS gavage, control group (healthy mice) + gel particle gavage, in situ carcinoma mice + PBS gavage, in situ carcinoma mice + gel particle gavage.

[0064] The animal experiment was conducted at the Animal Experiment Center of Xuzhou Medical University. All mice were raised in a room with a strictly controlled light-dark cycle (lights on at ZT (ZeitgeberTime) 7 and lights off at ZT19) and had free access to water. On the 21st day after tumor inoculation, mice in the corresponding groups were gavaged with gel particles, and the remaining control groups were gavaged with PBS. The intestines of the mice were taken 3 hours later, and the mcherry fluorescence signal was observed using the IVIS in vivo imaging system. The results are shown in the attached Figure 6 , the gel particles can be normally retained in the intestines of healthy mice and tumor mice.

[0065] 2. Determination of the targeting function of the sodium alginate@chitosan two-component hydrogel-encapsulated engineered bacteria capsule of the present invention

[0066] Twelve 5-week-old C57BL / 6J rats (Nanjing Jicui Experimental Animal Co., Ltd.) were selected and randomly divided into 4 groups, with 3 rats in each group. There were 3 rats in the control group, 3 rats in the mcherry group, 3 rats in the N-terminal targeting peptide group, and 3 rats in the C-terminal targeting peptide group. The control group was orally gavaged with PBS, the mcherry group was orally gavaged with pRSF-J23119-his-IL-10-mcherry gel particles, the N-terminal targeting peptide group was orally gavaged with pRSF-J23119-lung-pep-linker-IL-10-mcherry-his gel particles, and the C-terminal targeting peptide group was orally gavaged with pRSF-J23119-his-mcherry-IL-10-linker-lung-pep gel particles. The enrichment of mcherry fluorescence signal in the lungs was observed by IVIS in vivo imaging system at 10 minutes, 1 hour, and 6 hours after gavage. The results are shown in the attached Figure 7 , the N-terminal targeting peptide group and the C-terminal targeting peptide group were significantly enriched in the lungs.

[0067] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0068] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A lung-targeted cytokine engineering bacterial system, characterized in that: The system comprises a pRSF-J23119-lung-pep-linker-IL-10-his engineering bacterium with a genome synchronous lysis module and a sodium alginate@chitosan two-component hydrogel.

2. A lung-targeted cytokine engineering bacterial system according to claim 1, characterized in that: The pRSF-J23119-lung-pep-linker-IL-10-his engineering bacteria with a genome synchronous cleavage module comprises a constitutive promoter J23119, an anti-inflammatory cytokine IL-10, a flexible linker, a lung epithelial cell targeting peptide lung-pep and a genome synchronous cleavage module.

3. A lung-targeted cytokine engineering bacterial system according to claim 2, characterized in that: The nucleotide sequence of the lung epithelial cell targeting peptide lung-pep is shown in SEQ ID NO.

2.

4. A lung-targeted cytokine engineering bacterial system according to claim 2, characterized in that: The genome synchronization lysis module can be used at a cell density of 4.8*10 8 CFU / ml triggers bacterial lysis to release the target targeted therapeutic factors.

5. The method for constructing the lung-targeted cytokine engineering bacterial system according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1: The IL-10 fragment was connected to the plasmid pRSF-1b chassis by red homologous recombination technology to construct pRSF-J23119-IL-10. Next, lung-pep and flexible linker were extended in sequence at the N-terminus of pRSF-J23119-IL-10 by vector self-circularization, and his purification tag was loaded at the C-terminus to obtain pRSF-J23119-lung-pep-linker-IL-10-his plasmid. The constructed pRSF-J23119-lung-pep-linker-IL-10-his plasmid was chemically transferred into the competent DH5α strain with a genome synchronous lysis module to obtain the pRSF-J23119-lung-pep-linker-IL-10-his engineered bacteria capable of lysis; S2: Use a dual-syringe pump microfluidic device to prepare sodium alginate@chitosan two-component hydrogel to encapsulate the engineered bacteria obtained in the previous step: The pRSF-J23119-lung-pep-linker-IL-10-his engineering bacteria were cultured to the logarithmic growth phase, and the bacteria were mixed with 1% sodium alginate solution in equal proportions to obtain an internal prepolymer solution; Prepare 5% calcium chloride solution to obtain external prepolymer solution; The inner prepolymer solution was loaded into the inner injection pump, and the flow rate was set to 50 μL / min. The outer prepolymer solution was added into the outer injection pump, and the flow rate was set to 1500 μL / min, to prepare a single-layer engineering bacteria capsule coated with sodium alginate; Then, the sodium alginate-coated single-layer engineered bacteria capsule is placed in a 1% chitosan solution, and the positive and negative charge adsorption principle is utilized to slowly stir the solution to form double-layer coated two-component micro-nano gel particles, namely, sodium alginate@chitosan two-component hydrogel-coated engineered bacteria capsules.

6. Use of the lung-targeted cytokine engineered bacteria system according to any one of claims 1 to 4 or the sodium alginate@chitosan two-component hydrogel-encapsulated engineered bacteria capsule obtained by the construction method of claim 5 in the preparation of oral dosage forms of drugs targeting lung tissue.

Images