Use of palmitoyltransferase zdhhc11 in preparation of drugs for treating osteoarthritis

Abstract

The application discloses application of palmitoyltransferase ZDHHC11 in preparation of a drug for treating osteoarthritis. ZDHHC11 catalyzes S-palmitoylation of a substrate APOD by specific binding, and then inhibits a GATA4-P65 signal pathway related to aging, and plays a protective role on aged cartilage cells. Increasing the expression level of Zdhhc11 in vivo helps to regulate extracellular matrix metabolism, inhibit cartilage cell aging, and delay the progression of osteoarthritis. The application first identifies ZDHHC11 as a key palmitoyltransferase, the expression level of which influences cartilage cell aging and osteoarthritis phenotype, and clarifies a downstream molecular mechanism of S-palmitoylation mediated by ZDHHC11 in delaying the progression of osteoarthritis, and verifies that increasing the expression level of Zdhhc11 in vivo can significantly reverse the osteoarthritis phenotype.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and in particular, relates to the application of palmitoyl transferase ZDHHC11 in the preparation of a drug for treating osteoarthritis. BACKGROUND

[0002] The typical pathological changes of osteoarthritis (OA) include degenerative changes of cartilage, synovial inflammation, subchondral bone lesions and secondary hyperostosis, which is a common and frequently-occurring disease that leads to joint pain and dysfunction, especially in the elderly population. The disease not only significantly reduces the quality of life and labor capacity of patients, but also constitutes a widespread social health problem, causing a huge social and economic burden, and becoming one of the major diseases affecting public health. Given the global trend of population aging and the increasing rate of obesity, the prevalence of osteoarthritis is expected to continue to rise. Although modern medicine has made some progress in the diagnosis and treatment of osteoarthritis, the current traditional treatment methods (including non-steroidal anti-inflammatory drugs, intra-articular injection of steroids or hyaluronic acid, physical therapy, etc.) can only relieve symptoms and cannot effectively inhibit disease progression, and even some treatment methods may be accompanied by some unavoidable side effects, resulting in many patients with advanced osteoarthritis having to choose artificial joint replacement surgery. However, joint replacement surgery is expensive and may be accompanied by surgical complications and anesthesia risks, and the postoperative recovery period is also longer. In addition, the life span of joint replacement surgery is limited, generally about 15-20 years, and some young patients may need to undergo secondary or even multiple surgeries. Therefore, if the degenerative progression of articular cartilage can be intervened or inhibited at an early stage of the development of osteoarthritis, the pain of patients with osteoarthritis will be significantly alleviated and their quality of life will be improved, which has great medical and social value. Therefore, in-depth study of the molecular mechanisms of the development of osteoarthritis is crucial for developing new osteoarthritis treatment and prognosis programs.

[0003] Recent studies have found that protein translational modifications (PTMs) affect inflammatory response and cell metabolism in articular cartilage tissue, and thus participate in the process of cartilage aging and osteoarthritis. Among them, lipidation modification as an important form of PTMs has important influence on intracellular localization, transport and stability of proteins, and also participates in the interaction between proteins. The most common and important protein lipidation modification is S-palmitoylation, also known as protein palmitoylation, which refers to the reversible process of palmitoyl group connected to the internal cysteine of protein through thioester bond. S-palmitoylation modification not only participates in various cell functions and signal transduction including cell adhesion, growth, division, etc., and its abnormality is also closely related to cell aging and the progression of various diseases, but there are few reports on the pathogenesis of S-palmitoylation modification in osteoarthritis.

[0004] The DHHC (Asp-His-His-Cys) family of palmitoyltransferases catalyzes the S-palmitoylation modification of protein substrates in cells, and its significant feature is the cysteine-rich domain, which contains a DHHC motif. Because this domain usually binds two Zn 2+ The DHHC family is also known as ZDHHC palmitoyltransferase. There are 23 members in the ZDHHC family in humans, including ZDHHC1 to ZDHHC9 and ZDHHC11 to ZDHHC24. Previous studies have shown that ZDHHC11 protein is anchored on the endoplasmic reticulum (ER) in cells, and has the functions of activating NF-kB signaling pathway and participating in immune response after infection, but its mechanism of regulating cartilage aging has not been reported. Therefore, future research work is expected to reveal the regulatory role and molecular mechanism of S-palmitoylation modification on the aging process of chondrocytes, and whether the palmitoyltransferases including ZDHHC11 can become a possible intervention target for the treatment of osteoarthritis, so as to provide experimental basis and theoretical reference for the development of new early diagnostic markers and therapeutic targets for osteoarthritis.

[0005] Meanwhile, due to the limitations of viral vector-based gene therapy, including immunogenicity, non-specific delivery, and packaging and manufacturing, the use of non-viral vector lipid nanoparticles (LNPs) to deliver mRNA of key genes in disease development to articular cartilage is an extremely attractive treatment option for osteoarthritis. Currently, LNPs have been approved by the FDA for drug and clinical trials to deliver RNA, and have broad application prospects in the medical field. However, the targeted delivery of LNP-mRNA complexes to chondrocytes has not been achieved. Therefore, the development of a new LNP technology for the treatment of osteoarthritis not only helps to break through the limitations of traditional gene therapy, but also is expected to bring revolutionary changes to the gene therapy of osteoarthritis. SUMMARY

[0006] The first object of the present application is to provide the application of palmitoyltransferase ZDHHC11 in the preparation of a drug for treating osteoarthritis, which overcomes the shortcomings of the prior art.

[0007] Preferably, the drug regulates the overexpression of palmitoyltransferase ZDHHC11 in chondrocytes.

[0008] Preferably, palmitoyltransferase ZDHHC11 mediates S-palmitoylation of apolipoprotein D (APOD), thereby playing a protective role on senescent chondrocytes.

[0009] Preferably, S-palmitoylated APOD participates in extracellular matrix metabolism and chondrocyte aging process by inhibiting the GATA4-P65 signaling pathway, thereby delaying the progression of osteoarthritis.

[0010] Preferably, the effective component of the drug includes a gene (Gene1D: 79844) or mRNA (NM_001393492.1) encoding palmitoyltransferase ZDHHC11, which is introduced into chondrocytes through an adenovirus vector or a lipid nanoparticle. The use of the drug in related animal models helps to increase the expression of Zdhhc11 in the animal model, thereby achieving the effect of delaying chondrocyte aging and improving the pathological phenotype of osteoarthritis.

[0011] Further, the drug is injected in situ at the osteoarticular joint.

[0012] The adenovirus vector is an adeno-associated virus, and the lipid nanoparticle is obtained by fusing a chondrocyte affinity peptide with a liposome.

[0013] The second object of the present application is to provide a drug for treating osteoarthritis, wherein the effective component of the drug comprises a coding gene or mRNA of ZDHHC11, and a carrier for introducing the drug into chondrocytes, wherein the carrier is an adenovirus carrier or a lipid nanoparticle, and the drug is introduced into chondrocytes through the adenovirus carrier or the lipid nanoparticle.

[0014] Preferably, the adenovirus carrier is an adeno-associated virus, and the lipid nanoparticle is obtained by fusing a cartilage cell affinity peptide with a liposome.

[0015] Preferably, the effective component of the drug is injected in situ at a joint to achieve overexpression of ZDHHC11 in chondrocytes.

[0016] The third object of the present application is to provide a method for screening a candidate compound for treating osteoarthritis, wherein the method comprises:

[0017] a) contacting the candidate compound with chondrocytes; b) detecting the expression level of palmitoyltransferase ZDHHC11 in the chondrocytes after the contacting, taking palmitoyltransferase ZDHHC11 as a marker; and c) selecting a candidate compound capable of increasing the expression level of palmitoyltransferase ZDHHC11 as a candidate compound for treating osteoarthritis.

[0018] Compared with the prior art, the present application has at least the following advantages or beneficial effects:

[0019] The present application first identifies ZDHHC11 as a key palmitoyltransferase, and increasing the expression level of ZDHHC11 helps to improve the aging of chondrocytes and the osteoarthritis phenotype, and clarifies the role of ZDHHC11-mediated substrate S-palmitoylation in the pathogenesis of osteoarthritis, specifically including regulating the synthesis and catabolism of the extracellular matrix of chondrocytes, inhibiting the aging process of cells, etc. The embodiments of the present application provide experimental basis and theoretical reference for developing new early diagnostic markers and therapeutic targets for osteoarthritis. Meanwhile, the present application proposes to prepare LNPs for selective cell targeting by fusing CAPs with liposomes, and to target chondrocytes in a rat model to treat osteoarthritis. This not only helps to achieve the targeted delivery of LNP-mRNA complexes to chondrocytes for the first time, but also is expected to break through the limitations of gene therapy based on viral vectors, and provide a new idea for the targeted treatment of osteoarthritis.

[0020] At the mechanism level, the application first discovers that ZDHHC11 catalyzes S-palmitoylation of the substrate APOD by specific binding, thereby inhibiting the aging-related GATA4-P65 signal pathway and playing a protective role on aging chondrocytes. Increasing the expression level of Zdhhc11 in vivo helps to regulate extracellular matrix metabolism, inhibit chondrocyte aging, and delay the progression of osteoarthritis, thereby suggesting that future research targeting ZDHHC11 is expected to provide a potential new strategy for delaying the occurrence and development of early clinical osteoarthritis. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 To study the disorder process of palmitoylation modification in chondrocytes, which involves the screening and identification of palmitoyl transferase ZDHHC11, wherein A is the level of total palmitoylation of substrate proteins in human chondrocytes treated or not treated with 200 μM H2O2 for 48 hours to simulate excessive oxidative stress conditions, detected by ABE palmitoylation experiment; B is the heat map visualization of the expression levels of ZDHHC1-9, ZDHHC11-25 in mouse chondrocytes treated or not treated with 200 μM H2O2 for 48 hours to simulate excessive oxidative stress conditions, detected by real-time fluorescence quantitative PCR (RT-qPCR) (n=3 in each group), "ns" represents P>0.05, "*" represents P<0.05, "**" represents P<0.01, "***" represents P<0.001; C is the expression of each type of palmitoyl transferase ZDHHC family in human and mouse chondrocytes identified by Southern blot; D is the expression of ZDHHC11 and aging marker gene P53 in young and aged human chondrocytes detected by Western blot protein expression.

[0022] Figure 2 For the immunohistochemical staining results of the medial and lateral knee meniscus cartilage tissues of the osteoarthritis patients (scale, 100 μm).

[0023] Figure 3 For the Pearson correlation analysis of the fluorescence intensity of ZDHHC111 in the articular cartilage tissue of the osteoarthritis patients and its Kellgren Lawrence (K-L) classification (n=5), P<0.05.

[0024] Figure 4Functional verification of ZDHHC11 in vitro knockdown, wherein A is RT-qPCR detection of the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4) related genes, aging related secretory phenotype (MMP3, IL-6), aging related genes (P21, P53) in chondrocytes after ZDHHC11 knockdown (n = 9); B is Western blot detection of the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4) related genes, aging related secretory phenotype (MMP3), aging related genes (P21, P53) and ZDHHC11 in chondrocytes after ZDHHC11 knockdown; C is Alcian blue staining to detect the glycosaminoglycan deposition of chondrocytes after ZDHHC11 knockdown; D is SA-β-gal staining to detect the aging of chondrocytes after ZDHHC11 knockdown (scale, 50 μm).

[0025] Figure 5 Functional verification of ZDHHC11 in vitro overexpression, wherein A is RT-qPCR detection of the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4) related genes, aging related secretory phenotype (MMP3, IL-6), aging related genes (P21, P53) in chondrocytes after ZDHHC11 overexpression (n = 9); B is Western blot detection of the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4) related genes, aging related secretory phenotype (MMP3), aging related genes (P21, P53) and ZDHHC11 in chondrocytes after ZDHHC11 overexpression; C is Alcian blue staining to detect the glycosaminoglycan deposition of chondrocytes after ZDHHC11 overexpression; D is SA-β-gal staining to detect the aging of chondrocytes after ZDHHC11 overexpression treated with H2O2 (scale, 50 μm).

[0026] Figure 6 Micro-CT analysis of mouse bone hyperplasia, wherein A is the Micro-CT image of wild type sham group (n = 6), Zdhhc11 knockout (Zdhhc11 cKO) sham group (n = 6), Zdhhc11 cKO modeling group treated with medial meniscus instability operation (DMM) (n = 6) and Zdhhc11 AAV treated Zdhhcl1 cKO group (n = 6) mice (scale, 2.5 mm); B is the quantitative analysis result of the number of bone hyperplasia of mice in each group, “***” indicates P < 0.001.

[0027] Figure 7A is the result of safranin O and fast green staining and immunohistochemical staining of joint cartilage tissue of mice in ZDHHC11 in vivo function verification, wherein A is wild type sham group, Zdhhc11 cKO-sham group, Zdhhc11 cKO-DMM group and Zdhhc11 AAV treatment Zdhhcl1 cKO group, scale 50 μm; B is the pathological section score of joint cartilage of each group based on OARSI standard, and the quantitative cartilage injury is "***" P<0.001.

[0028] Figure 8 A is the intersection diagram between the results of immunoprecipitation mass spectrometry and the public database GSE57218 and GSE185064 related to osteoarthritis, and the candidate proteins (APOD, TF) interacting with ZDHHC11 are identified; B is the result of APOD and TF palmitoylation site predicted by CSS-palm 4.0 software, wherein APOD (C185) has the highest score; C is the result of computer simulation molecular docking analysis to predict the interaction between ZDHHC11 and the C185 site of APOD.

[0029] Figure 9 A is the schematic diagram of the conservation of C185 palmitoylation modification site on APOD of different species; B is the result of ABE palmitoylation experiment to detect the palmitoylation level of APOD protein of wild type (APOD-WT) and mutant type (APOD-C185A) of C185 site on APOD in human chondrocytes.

[0030] Figure 10 A is the result of ABE palmitoylation experiment to detect the effect of knockdown of ZDHHC11 on the palmitoylation modification level of APOD in human chondrocytes; B is the result of ABE palmitoylation experiment to detect the effect of overexpression of ZDHHC11 on the palmitoylation modification level of APOD in human chondrocytes; C is the result of in vitro detection of palmitoyl acyl transferase (PAT) activity, which reflects whether ZDHHC11 can catalyze S-palmitoylation of C185 site mutant APOD protein.

[0031] Figure 11A, for the functional validation of APOD overexpression in vitro, where A is the mRNA level of anabolism (SOX9, COL2A1), catabolism (ADAMTS4) related genes, senescence related secretory phenotype (MMP3, IL-6), senescence related genes (P21, P53) and APOD in human chondrocytes after overexpression of wild type APOD (OE-APOD) and C185 site mutant APOD (OE-APOD-C185A) were detected by RT-qPCR (n=3 for each group), “ns” means P>0.05, “*” means P<0.05, “**” means P<0.01, “***” means P<0.001, “*” means statistical significance between control and OE-APOD, “#” means statistical significance between control and OE-APOD-C185A; B is the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4) related genes, senescence related secretory phenotype (MMP3), senescence related genes (P21, P53) and APOD in human chondrocytes of control, OE-APOD and OE-APOD-C185A were detected by Western blot; C is the cell senescence of human chondrocytes of control, OE-APOD and OE-APOD-C185A after 48 hours of 200 μM H2O2 treatment to simulate excessive oxidative stress conditions were detected by SA-β-gal staining (scale bar, 50 μm); D is the glycosaminoglycan deposition of human chondrocytes of control, OE-APOD and OE-APOD-C185A were detected by Alcian blue staining.

[0032] Figure 12 A, for the preliminary exploration of downstream molecules of ZDHHC11 catalyzed S-palmitoylation of substrates, where A is the intersection diagram of differential genes (|log2FC|>2.5) of human chondrocytes after ZDHHC11 or APOD knockdown by transcriptome sequencing (RNA-seq), from which three candidate downstream molecules: GATA4, AFF2 and NANOS1 were identified; B is the mRNA level of GATA4, AFF2 and NANOS1 in human chondrocytes of control and ZDHHC11 knockdown detected by RT-qPCR (n=3); C is the mRNA level of GATA4, AFF2 and NANOS1 in human chondrocytes of control and APOD knockdown detected by RT-qPCR (n=3); D is the visualization result of the difference of osteoarthritis related signaling pathways after ZDHHC11 or APOD knockdown determined by bioinformatics analysis, which includes the NF-κB signaling pathway.

[0033] Figure 13To preliminarily verify the downstream signaling pathway of ZDHHC11-mediated palmitoylation, A is the RT-qPCR detection of GATA4 levels in control and ZDHHC11-knockdown human chondrocytes (n=9), "***" indicates P<0.001; B is the RT-qPCR detection of GATA4 levels in control and ZDHHC11-overexpressing human chondrocytes (n=9), "***" indicates P<0.001; C is the Western blot detection of protein expression levels of GATA4, p-P65, P65 and ZDHHC11 in control and ZDHHC11-knockdown human chondrocytes; D is the Western blot detection of protein expression levels of GATA4, p-P65, P65 and ZDHHC11 in control and ZDHHC11-overexpressing human chondrocytes.

[0034] Figure 14 To further verify the GATA4-P65 signaling pathway downstream of ZDHHC11, A is the Western blot detection of the effect of ZDHHC11 knockdown on P65 phosphorylation in human chondrocytes, and whether this effect can be reversed by silencing GATA4; B is a statistical chart of the results of re-quantitative analysis of p-P65 immunofluorescence images after transfection of APOD siRNA, ZDHHC11 siRNA or (and) GATA4 siRNA in human chondrocytes (n=9), "***" indicates P<0.001.

[0035] Figure 15 To verify the relationship between the ZDHHC11-APOD-GATA4-P65 axis and the senescence of chondrocytes and the pathological phenotype of osteoarthritis, A is the Western blot detection of protein expression levels of GATA4, P65 and p-P65 in young and senescent human chondrocytes; B is the Western blot detection of whether in vitro supplementation of APOD can reverse the effects of ZDHHC11 knockdown on chondrocyte senescence and extracellular matrix (ECM) metabolism, specifically detecting the protein expression levels of GATA4, COL2A1, SOX9, ADAMTS4, MMP3, P53, P21 and ZDHHC11.

[0036] Figure 16Preparation, injection and characterization of selective cartilage cell targeted LNPs, in which A is the schematic diagram of the assembly of cartilage cell targeted LNPs and Zdhhc11 mRNA and intra-articular injection; B is the schematic diagram of transmission electron microscopy (TEM) evaluation of Zdhhc11 mRNA@LNP and Zdhhc11 mRNA@LNP-CAP particle morphology (scale, 100 nm); C is the statistical result of the hydrodynamic diameter of each type of LNP; D is the statistical result of the change of the Zeta potential of each type of LNP; E is the encapsulation efficiency (EE%) of mRNA@LNPs quantitatively detected by fluorescence RiboGreen method.

[0037] Figure 17 Western blotting to confirm that the prepared LNPs can effectively enter human cartilage cells and be converted into functional proteins, the effect of each type of LNP on the expression of COL2A1, ADAMTS4 and ZDHHC11 proteins in human cartilage cells.

[0038] Figure 18 Micro-CT analysis of rat osteophyte formation, in which A is the Micro-CT image of the sham negative control group (n=6), the DMM modeling group (n=6), the LNP treated DMM modeling (DMM+LNP) group (n=6), the Zdhhc11 mRNA@LNP treated DMM modeling (DMM+mRNA@LNP) group (n=6) and the CAP fused Zdhhc11 mRNA@LNP treated DMM modeling (DMM+mRNA@LNP-CAP) group (n=6) rats (scale, 5 mm); B is the quantitative analysis result of the number of osteophytes in each group of rats, and “***” indicates P<0.001.

[0039] Figure 19 In vivo treatment effect verification of LNP for delivering ZDHHC11 mRNA, in which A is the result of alcian blue and picrosirius staining and Col2a1, Mmp3, P21 immunohistochemical staining of the articular cartilage tissue of the sham group, the DMM modeling group, the DMM+LNP group, the DMM+mRNA@LNP group and the DMM+mRNA@LNP-CAP group rats (scale, 50 μm); B is the quantitative cartilage damage based on the OARSI standard for scoring the articular cartilage pathological sections of each group, and “***” indicates P<0.001

[0040] Figure 20Figures for the immunofluorescence images of Gata4 and p-P65 in the articular cartilage tissues of rats in the groups of sham, DMM modeling, DMM+LNP, DMM+mRNA@LNP and DMM+mRNA@LNP-CAP (scale bar, 50 μm); B is the quantitative statistical result of Gata4-positive cells in each group (n=6), and “***” indicates P<0.001; C is the quantitative statistical result of p-P65-positive cells in each group (n=6), and “***” indicates P<0.001. DETAILED DESCRIPTION

[0041] In order to make the objectives, technical solutions and advantages of the embodiments of the present application clearer, the following will clearly and completely describe the embodiments of the present application in conjunction with specific embodiments. The specific conditions not mentioned in the embodiments are carried out according to conventional conditions or the conditions suggested by the manufacturers. The reagents or instruments not mentioned by the manufacturers are all conventional products that can be purchased in the market.

[0042] The embodiments of the present application provide an application of palmitoyl transferase ZDHHC11 in the preparation of a drug for treating osteoarthritis.

[0043] In some embodiments of the present application, the ZDHHC11 described above is a key palmitoyl transferase, which inhibits the activation of the GATA4-P65 signaling pathway by specifically binding to the substrate APOD protein and catalyzing S-palmitoylation thereof, thereby playing a role in regulating the metabolism of the extracellular matrix of chondrocytes and delaying the aging of chondrocytes.

[0044] In some embodiments of the present application, the coding gene or mRNA of the Zdhhc11 described above is introduced into chondrocytes by using an adeno-associated virus (AAV) or a lipid nanoparticle (LNP) as a carrier to achieve overexpression in a related animal model, thereby delaying the aging of chondrocytes and improving the pathological phenotype of osteoarthritis in vivo.

[0045] The features and performances of the present application are further described in detail in conjunction with the following embodiments.

[0046] Embodiment 1

[0047] This embodiment is the research method and experimental means in the present application

[0048] I. Obtaining and processing of human articular cartilage tissue specimens

[0049] Knee cartilage samples were collected from patients with primary osteoarthritis after total knee arthroplasty. Patients were divided into young group (≤65 years old) and old group (>65 years old) according to age, and part of the samples obtained were divided into medial and lateral meniscus. All samples were used for collecting human chondrocytes and related histological experiments. The acquisition and processing of samples have obtained the informed consent of the patients and the approval of the ethics committee.

[0050] 1. Immunohistochemistry

[0051] After fixation, the articular cartilage tissue samples were decalcified. After deparaffinization of paraffin sections, antigen repair was performed. After treatment with 3% H2O2, the sections were blocked with 5% goat serum, and the primary antibody was incubated overnight. The next day, the sections were incubated with the corresponding secondary antibody, incubated with DAB developing solution for 1 minute, and finally stained with hematoxylin solution for 2 minutes. Optical microscope was used to take images of articular cartilage tissue. For detailed operation steps, please refer to the following reference: Shen S et al. circPDE4B prevents articular cartilage degeneration and promotes repair by acting as a scaffold for RIC8A and MID1. Ann Rheum Dis. 2021 Sep;80(9):1209-1219.

[0052] 2. Kellgren Lawrence (K-L) classification

[0053] According to the knee imaging manifestations (X-ray / CT / MRI) of osteoarthritis patients in clinic, the severity of knee joint degeneration was evaluated. From light to heavy, it was divided into: 0 level (normal knee joint), I level, II level, III level, IV level. Among them, 0 level: the knee X-ray is completely normal, without osteoarthritis performance. I level: suspicious osteophyte formation or suspicious joint space narrowing. II level: definite osteophyte formation with possible joint space narrowing and possible cyst formation. III level: definite osteophyte formation with moderate joint space narrowing and bone cyst formation. IV level: definite large osteophyte formation with severe joint space narrowing and subchondral sclerosis, deformity.

[0054] II. Construction and processing of animal models

[0055] 1. Animal acquisition and breeding

[0056] Male C57BL / 6 mice or SD rats were selected for the experiment. The required animals were bred under pathogen-free conditions, and the breeding temperature was maintained at about 25°C, and the environment was kept at a 12-hour light / dark cycle. Zdhhc11 fl / flMice were purchased from Suzhou SAIYE Biotechnology Co., Ltd. and were injected intraperitoneally with Aggrecan CreERT2 Mice were crossbred to establish the Zdhhcll conditional knockout (cKO) mouse strain. To induce expression of Cre recombinase to achieve inducible knockout of Zdhhcll, 2-month-old male Zdhhcll fl / fl Aggrecan CreERT2 Mice were injected intraperitoneally for 5 consecutive days, once a day, with tamoxifen (TAM, Sigma, USA) dissolved in corn oil at a dose of 100 pg / g (body weight).

[0057] 2. Medial meniscus destabilization (DMM) surgery

[0058] Male C57BL / 6 mice or SD rats were randomly divided into different groups (n = 6), and the animals were weighed on the day of surgery. Anesthesia was induced by intraperitoneal injection of 1% pentobarbital at a dose of 50 mg / kg. After the knee joint was fixed and disinfected, the patellar ligament was incised medially with a scalpel blade to expose the joint cavity. The fat pad between the femoral condyles was bluntly separated to expose the intercondylar region. The medial meniscus tibial ligament was cut with microsurgical scissors, and then washed with sterile saline and sutured the skin incision. In the sham operation group, only the skin was incised and directly sutured without removal of the medial meniscus tibial ligament. After the operation, the animals were placed under an infrared heat lamp until they fully recovered from anesthesia and were returned to the cage. Amoxicillin was injected subcutaneously at a dose of 20 mg / kg per body weight to prevent infection, and buprenorphine was injected subcutaneously at a dose of 0.05 mg / kg per body weight at 0 and 4 hours after the operation for analgesia.

[0059] 3. Treatment method for animal treatment experiments

[0060] Zdhhcll AAV was constructed by Shanghai Hanheng Biotechnology Co., Ltd. In the mouse adeno-associated virus (AAV) treatment experiment, the Zdhhcll AAV treatment group of mice (cKO-DMM + Zdhhcll AAV) received intra-articular injection two weeks after DMM modeling, with an injection volume of 10 pL. In the lipid nanoparticle (LNP) treatment experiment, 10-week-old rats were selected for intra-articular injection, once a week for a total of 6 weeks, with an injection volume of 25 pL.

[0061] 4. Micro-CT and quantitative analysis

[0062] The knee joint samples of animals were fixed in 4% paraformaldehyde for 48 hours, and washed and stored in 70% ethanol. Then the samples were scanned in a 17 mm scanning tube by high resolution μCT (Skyscan 1072, Belgium) (the scanning volume was 11 mm3, the scanning condition was current 180 mA, voltage 50000 V, and the acquisition time was 5 minutes). After the CT images were collected, three-dimensional imaging reconstruction was performed by Skyscan software to observe the osteophyte formation. The quantitative analysis of the number of osteophytes in each group of animals was performed by one-way ANOVA, and the significance of the data was evaluated by GraphPad Prism.

[0063] 5. Safranin O and Fast Green staining

[0064] After the knee joints of animals were scanned by Micro-CT, the tissues were decalcified with 12.5% EDTA for one week, then dehydrated in ethanol and embedded in melted paraffin. All the knee joint tissues were cut into 5 μm thick sections under a microscope. The paraffin sections were dewaxed with xylene and rehydrated in gradient ethanol and PBS. Then the sections were stained with 1% Fast Green for 5 minutes, soaked in 1% acetic acid for 5 seconds, and then stained with 1% Safranin O solution for 10 minutes. After dehydration in gradient ethanol, the sections were mounted with neutral resin, and the images of the articular cartilage tissues were taken under a microscope.

[0065] 6. Histological scoring

[0066] The articular cartilage sections were scored based on the scoring criteria of the International Osteoarthritis Research Society (OARSI). The quantitative scoring of cartilage damage was scored as 0, 0.5, 1-6. Among them, 0 points for completely normal articular cartilage; 0.5 points for loss of a small part of the cartilage tissue staining, but no structural changes; 1 point for a small part of the joint surface wear and fibrosis under the cartilage surface, without loss of chondrocytes or cartilage matrix; 2 points for vertical cracks extending downward to the cartilage surface layer, with partial loss of cartilage surface matrix; 3 points for vertical cracks / damage extending downward to the calcified cartilage layer, with <25% of the joint surface damaged; 4 points for vertical cracks / damage extending downward to the calcified cartilage, with 25%-50% of the joint surface damaged; 5 points for vertical cracks / damage extending downward to the calcified cartilage, with 50%-75% of the joint surface damaged; 6 points for vertical cracks / damage extending downward to the calcified cartilage, with >75% of the joint surface damaged. Each sample was evaluated by three independent researchers who were blinded to the experimental design, and the significance of the data was evaluated by GraphPad Prism (version 8.0.1).

[0067] III. Cell and molecular experiments

[0068] 1. Primary chondrocyte culture

[0069] Human knee joint cartilage samples were obtained under sterile conditions, cut into small pieces, and washed with PBS three times. Then they were digested in 0.2% collagenase type II (Sigma, USA) at 37°C overnight. The supernatant was then filtered with a 100-micron cell strainer (Biosharp, China) and centrifuged at 1000 rpm for 5 minutes. Then they were washed with PBS three times and finally cultured in DMEM high-glucose medium supplemented with 10% fetal bovine serum (FBS) at 37°C in a 5% CO2 incubator. When collecting mouse cartilage cells, the articular cartilage of the femoral head and femoral condyle of 5-day-old C57BL / 6 mice was obtained, and the other steps were the same as those for human cartilage cells.

[0070] 2. Acyl-biotin exchange (ABE) palmitoylation experiment

[0071] The cartilage cells were mixed with lysis buffer for 30 minutes. Then the lysate was ultrasonicated and centrifuged. The supernatant was then blocked, cut and biotinylated, and finally incubated with streptavidin magnetic beads. After incubation, the level of palmitoylation of the protein was detected by Western blot. For detailed steps, see the reference: Yao H et al. Inhibiting PD-L1 palmitoylation enhances T-cell immune responses against tumours. Nat Biomed Eng. 2019 Apr;3(4):306-317.

[0072] 3. Western blot

[0073] The cultured cartilage cells were placed on ice and gently scraped with a cell scraper. RIPA lysis buffer was added and incubated at 4°C for 1 hour, and then denatured by boiling at 100°C for 5 minutes. The total protein sample was subjected to polyacrylamide gel electrophoresis (SDS-PAGE) separation, then transferred to a PVDF membrane and blocked with 5% skim milk at room temperature. The corresponding primary antibody was incubated at 4°C overnight. The next day, TBST was used to wash three times, then the HRP-conjugated secondary antibody was incubated at room temperature for 1 hour. Finally, the binding of the antibody was detected using chemiluminescent substrate (ECL) and chemiluminescent gel imaging system (Bio-Rad, USA), and the bands were exposed and developed.

[0074] 4. RNA extraction and real-time fluorescent quantitative PCR (RT-qPCR)

[0075] Total RNA was extracted from cells using the AG RNAex Pro kit (Aicore Biosciences), and reverse transcribed into cDNA using the PrimeScript RT kit (Aicore Biosciences). qRT-PCR was performed using the SYBR Green PCR kit (Yisheng Biosciences) on an ABI 7500 sequencing system (Applied Biosystems, USA). -△△CT Methods: β-Actin gene was used as an internal reference to calculate mRNA expression levels, and GraphPad Prism (version 8.0.1) was used to evaluate the significance of the data.

[0076] 5. Southern blot

[0077] Total cellular RNA was extracted from chondrocytes, and cDNA was synthesized according to the above method. mRNA expression was analyzed by PCR using specific PCR primers for Blast-verified genes. The PCR amplification program was as follows: pre-denaturation at 95°C for 3 minutes, followed by 35 cycles (each cycle included denaturation at 95°C for 15 seconds), annealing at 60°C for 15 seconds, extension at 72°C for 5 seconds, and a final extension at 72°C for 5 minutes. PCR amplification products were separated by gel electrophoresis at 150 V for 30 minutes in 1% to 1.5% TAE (Tris acetate EDTA buffer) and stained with YeaRed nucleic acid dye (Yisheng Bio) and visualized on a chemiluminescence system (Bio-Rad, USA).

[0078] 6. Alcian blue staining

[0079] Chondrocytes were fixed with 4% paraformaldehyde for 30 minutes at room temperature and then washed three times with PBS. The cells were then incubated in 1% Alcian blue solution (Sigma, USA) at room temperature for 1 hour, and random images were captured using an Olympus microscope (Olympus, Japan). Image J (version 1.5.3) was used to perform shift operations and quantitative analysis on the original Alcian blue images using the same parameters.

[0080] 7. β-galactosidase activity staining (SA-β-gal)

[0081] A SA-β-gal staining kit (Biyuntian Biotechnology) was used according to the manufacturer's instructions to assess senescence-related β-galactosidase levels in cells. The treated chondrocytes were fixed at room temperature for 30 minutes and washed three times with PBS. The PBS was then discarded, and SA-β-gal staining solution (pH 6.0) was added and incubated overnight at 37°C. The cells were observed and images were captured using a standard light microscope.

[0082] 8. Immunofluorescence staining

[0083] Chondrocytes were fixed with 4% paraformaldehyde for 15 min and washed with PBS for 3 times. Then the cells were permeabilized with 0.1% Triton X-100 for 15 min and washed with PBS for 3 times. The chondrocytes were then blocked with 5% goat serum for 1 hour at room temperature, and then incubated with the primary antibody overnight at 4°C. The next day, the cells were washed with PBS for 3 times and incubated with the fluorescently conjugated goat anti-rabbit IgG secondary antibody (Fisher BioReagents) for 1 hour at room temperature. The nuclei were counterstained with DAPI for 5 min before mounting. All images were taken under a fluorescent inverted microscope.

[0084] 9. Co-immunoprecipitation (Co-IP)

[0085] rProteinA / G MagBeads (Thermo Scientific) were used and the manufacturer's instructions were followed. The treated cells were collected and mixed with RIPA buffer, and the supernatant was collected after centrifugation. The magnetic beads were used to adsorb the antibody, and then the sample containing the antigen was added and placed in a rotation mixer overnight at 4°C. The next day, the magnetic bead-antibody-antigen complex was magnetically separated, and the supernatant was collected. The IP protein in the complex was released using protein thermal denaturation, and was detected by Western blot or mass spectrometry.

[0086] 10. In vitro detection of palmitoyl transferase (PAT) activity

[0087] Recombinant ZDHHC11 (Hangzhou Huaan Biotech) and recombinant APOD (Hangzhou Huaan Biotech) were mixed in 25 μL of reaction buffer at 25°C for 1 hour, and then biotin pyridyl azide (50 μM) was added to the mixture. The mixture was then loaded into a 30 kDa centrifugal filter column (Bi Yun Tian Biotech) to remove free biotin pyridyl azide. Finally, streptavidin magnetic beads (Bi Yun Tian Biotech) were used for incubation to enrich biotin-labeled proteins. After incubation, the palmitoylated proteins were released by protein thermal denaturation, and were detected by Western blot.

[0088] 11. Transfection of chondrocyte siRNA

[0089] Customized APOD siRNA, ZDHHC11 siRNA, and GATA4 siRNA were synthesized by Shanghai Jimai Gene to knock down specific mRNA. Lipofectamine RNAi MAX transfection reagent (Invitrogen, USA) was used according to 1 μL / 10 5The cells were transfected into chondrocytes, and the medium was changed 8 hours after transfection. The cell RNA and protein were extracted 48 hours later. Table 1 lists all the siRNA sequences required for the experiment. The two bases at the 3' end of the sequence were replaced with protruding TT to enhance the stability of the siRNA double-stranded complex, thereby increasing the knockdown efficiency of siRNA.

[0090] Table 1

[0091] si-APOD #1 (Human) GUACCUGCAUCAUCCAACU si-APOD #2 (Human) GGAAAGAUCAAAGUGUUAA si-ZDHHC11 #1 (Human) CCAGAAGCCAUACUCAAUAA si-ZDHHC11 #2 (Human) CCAGAAGCCAUACUCAAUA si-GATA4 (Human) CAGAGAGUGUGUCAACUGU

[0092] 12、Gene overexpression and adeno-associated virus infection

[0093] APOD and APOD-C185A overexpression plasmids were provided by Beijing Genki Bio, and ZDHHC11 overexpression plasmids were provided by Wuhan Moliang Bio. One day before transfection, HEK293 cells were seeded in a 10 cm culture dish with a surface pretreatment, with a density of 70%-80%. The medium was discarded and replaced 1 hour in advance. After the plasmid was extracted, the helper plasmids (pMD2.G and psPAX2) were co-transfected into HEK293 cells with Opti-MEM medium containing Lipofectamine 3000 (Invitrogen, USA). The medium was discarded and replaced 6 hours after incubation. The virus was collected 24 hours after the medium was replaced and the medium was replaced again. The virus was collected 48 hours later and stored at 4°C. The supernatant was centrifuged at 4°C and 3000 rpm for 15 minutes, and the medium was purified by passing through a 0.45 μm filter (Millipore, Billerica, MA, USA). The virus containing polybrene was used to infect human primary chondrocytes in good growth condition, and the final concentration of polybrene was 10 μg / mL. After mixing, the cells were incubated in an incubator for 24 hours, and then the medium was replaced. The overexpression efficiency was verified by RT-qPCR.

[0094] Four, computer simulation molecular docking analysis

[0095] The molecular docking program HADDOCK (version 2.4) was used, which is an information-driven flexible molecular docking method for modeling of biomolecular complexes. HADDOCK combines various experimental and / or bioinformatics data to drive modeling, and can flexibly handle complex molecular conformations, focusing on the spatial part of the intermolecular interaction. Finally, PyMOL (version 3.0.3) was used for data result analysis and plotting operations.

[0096] Five, preparation and characterization of mRNA-LNP

[0097] Lipid nanoparticles (LNP) were formulated using ionizable lipids, including SM-102, DSPE-PEG-MAL, DSPC, and cholesterol, at a molar ratio of 50:1.5:10:38.5. 25 μΐ of mRNA (1000 ng / μΐ) was dissolved in 50 μΐ of Tris buffer (20 mM) at pH 4.0, and then mixed with lipids dissolved in ethanol for 1 min in a microfluidic device to maintain a volume ratio of mRNA to lipids at 3:1. The mixture was then incubated at room temperature for 15 min, and then 1.5 volumes of 1x PBS solution was added to further reduce the ethanol concentration.

[0098] Nanoparticles were obtained using a 0.22 μιη filter and stored at 4 °C for later use. Images were taken using transmission electron microscopy (TEM). The hydrodynamic diameter and Zeta potential of the LNP were measured using a Zetasizer Nano ZS90 (Malvern Instruments, Malvern, UK). The encapsulation efficiency of mRNA was determined using a modified Quant-iT TM RiboGreen RNA assay (Invitrogen TM , USA).

[0099] Six, Results

[0100] 1. Screening and identification of palmitoyltransferase ZDHHC11

[0101] Figure 1 A shows that under the condition of excessive oxidative stress of chondrocytes, the palmitoylation level of intracellular substrate total protein is significantly reduced, indicating that palmitoylation modification is disordered in chondrocytes. At the same time Figure 1 B shows that under this condition, the mRNA expression level of palmitoyltransferase ZDHHC11 is significantly down-regulated. The expression of each type of known palmitoyltransferase ZDHHC family in humans and mice was identified by Southern blot, and five common palmitoyltransferases, ZDHHC5, ZDHHC11, ZDHHC13, ZDHHC20, and ZDHHC21, showed consistent high abundance changes Figure 1 C) Western blot detection found that the protein expression of ZDHHCl 1 was lower and the expression of aging marker gene P53 was higher in aged human chondrocytes (P4 generation) compared with young human chondrocytes (P0 generation).

[0102] 2. Exploring the clinical relevance of palmitoyltransferase ZDHHC11

[0103] Immunohistochemical staining of the medial and lateral knee meniscus cartilage tissues of young (≤65 years) and elderly (>65 years) osteoarthritis patients was performed. Figure 2 As shown, the level of ZDHHC11-positive cells in the lateral meniscus of young osteoarthritis patients was higher.

[0104] Pearson correlation analysis of the fluorescence intensity of ZDHHC11 and its Kellgren Lawrence (KL) grade is shown in Figure 2. Figure 3 As shown in the figure, the fluorescence intensity of ZDHHC11 was negatively correlated with the KL grade, indicating that ZDHHC11 may be an indicator of disease severity in patients with osteoarthritis. The difference between the two groups was statistically significant when P < 0.05.

[0105] 3. Exploring the functional validation of palmitoyltransferase ZDHHC11 in vitro

[0106] To investigate the effect of ZDHHC11 on the progression of age-related osteoarthritis, ZDHHC11 siRNA was transfected into primary human chondrocytes for functional verification of ZDHHC11 knockdown in vitro. RT-qPCR results showed that compared with the control group, ZDHHC11 knockdown decreased the expression of ECM anabolism-related genes (COL2A1, SOX9), increased the expression of ECM catabolism-related genes (ADAMTS4), increased the expression of SASPs markers (MMP3, IL-6), and increased the expression of cell senescence-related genes (P53, P21). Figure 4 A). Western blot experiments also showed similar results ( Figure 4 B). Figure 4 As shown in C, knockdown of the ZDHHC11 gene leads to a decrease in the deposition of ECM in chondrocytes. In addition, the positive area of ​​SA-β-gal staining in human chondrocytes increases after knockdown of ZDHHC11, indicating that knockdown of the ZDHHC11 gene can significantly induce cell senescence ( Figure 4 D).

[0107] To verify the above results, the function of ZDHHC11 overexpression in vitro was verified, as shown in Figure 5 Compared with the control group, ZDHHC11 overexpression increased the expression of ECM anabolism-related genes (COL2A1, SOX9), decreased the expression of ECM catabolism-related genes (ADAMTS4), decreased the expression of SASPs markers (MMP3, IL-6), and decreased the expression of cell senescence-related genes (P53, P21). Figure 5 A). Western blot experiments also showed similar results ( Figure 5 B). Figure 5ZDHHC11 gene overexpression leads to increased deposition of cartilage ECM, as shown in FIG. C. In addition, after H2O2 treatment, the positive area of SA-β-gal staining of ZDHHC11 overexpressed human chondrocytes is reduced, indicating that overexpression of the ZDHHC11 gene inhibits chondrocyte aging Figure 5 D).

[0108] 4. Verify that Zdhhc11 can improve the osteoarthritis pathological phenotype of mice

[0109] To further study the effect of ZDHHC11 on osteoarthritis and aging phenotype in vivo, 2-month-old Zdhhc11 cKO male C57BL / 6J mice were subjected to DMM surgery, and intra-articular injection of Zdhhc11 AAV was performed 2 weeks after surgery. The mice were sacrificed 8 weeks after surgery and the articular cartilage samples were collected. Micro-CT analysis of mouse bone hyperplasia is shown in Figure 6 As shown in FIG. C, compared with the Zdhhc11 cKO-sham group, the number of bone hyperplasia in mice after DMM surgery increased significantly, and the degradation of cartilage was effectively delayed after supplementing Zdhhc11, and the number of bone hyperplasia decreased significantly, indicating that increasing the expression level of Zdhhc11 in mice can help reverse the severity of osteoarthritis.

[0110] As shown in Figure 7 A, the articular cartilage tissues of the above 4 groups of mice were subjected to safranin O fast green staining, and the results showed that the articular cartilage of Zdhhc11 cKO mice after DMM surgery was significantly destroyed, and the degree of destruction of articular cartilage tissue of Zdhhc11 cKO mice after injection of Zdhhc11 AAV was significantly reduced; the molecular indicators of osteoarthritis were evaluated by immunohistochemical staining, and the results showed that after DMM surgery, the expression of Col2a1 related to ECM synthesis and metabolism decreased, the expression of SASPs markers (Mmp3, Il-6) increased, and the expression of P21 related to cell aging increased, and supplementing Zdhhc11 significantly reduced the related phenotypes of cell aging and osteoarthritis. The results of articular cartilage pathological section score of each group of mice based on OARSI standard showed that Zdhhc11 can significantly reduce the osteoarthritis performance in mice Figure 7 B).

[0111] 5. Explore the substrate and action site of palmitoyltransferase ZDHHC11

[0112] Immunoprecipitation mass spectrometry (IP-MS) was performed in Zdhhc11 overexpressed human chondrocytes. As shown in Figure 8A, the IP-MS analysis results were intersected with public databases GSE57218 and GSE185064 (|log2FC|>1.5), and two candidate proteins that may interact with ZDHHC11 were identified: APOD, TF. Given that ZDHHC11 is a known palmitoyltransferase, it is speculated that the proteins interacting with it may undergo palmitoylation process. Therefore, the CSS-palm 4.0 software was used to predict the palmitoylation sites of the candidate substrate proteins APOD and TF, and the results are shown in Figure 8 B, in which APOD(C185) has the highest score. Computer simulation of molecular docking analysis also further proves the interaction between ZDHHC11 and the C185 site of APOD Figure 8 C).

[0113] To identify the exact site of S-palmitoylation catalyzed by ZDHHC11 on the substrate, as shown in Figure 9 A, the C185 palmitoylation modification site of APOD protein in different species is highly conserved. ABE palmitoylation experiment further verified that compared with APOD-WT, APOD protein with C185 site mutation cannot undergo palmitoylation Figure 9 B).

[0114] To verify the effect of ZDHHC11 on the palmitoylation of APOD, the palmitoylation level of APOD before and after ZDHHC11 knockdown was compared by ABE palmitoylation experiment. As shown in Figure 10 A, ZDHHC11 knockdown significantly reduces the palmitoylation state of APOD. However, overexpression of ZDHHC11 can reverse this effect Figure 10 B). In vitro PAT detection results show that ZDHHC11 can catalyze the palmitoylation of APOD-WT, but cannot catalyze the palmitoylation of APOD protein with C185 site mutation Figure 10 C).

[0115] 6. Verify the function of ZDHHC11 acting on substrate APOD protein

[0116] Functional verification was performed by overexpressing APOD in vitro. RT-qPCR results showed that after overexpression of APOD, ECM synthesis and metabolism related genes (COL2A1, SOX9) were up-regulated, ECM decomposition and metabolism related genes (ADAMTS4) were down-regulated, SASPs markers (MMP3, IL-6) were down-regulated, and cell aging related genes (P53, P21) were down-regulated. On the contrary, overexpression of APOD mutant (APOD-C185A) exacerbated cell aging and osteoarthritis phenotype Figure 11 A). Western blot experiment also showed similar results Figure 11B). In addition, SA-β-Gal staining Figure 11 C) and Alcian blue staining Figure 11 D) confirmed that overexpression of APOD could promote ECM deposition and inhibit chondrocyte senescence, while overexpression of APOD-C185A had the opposite effect.

[0117] 7. Verification of ZDHHC11 mediated palmitoylation process through inhibition of senescence-associated GATA4-P65 signaling pathway.

[0118] To further explore the downstream molecules of ZDHHC11 catalyzed S-palmitoylation of substrates, ZDHHC11 or APOD was selectively knocked down in human chondrocytes, and RNA-seq was performed to evaluate the changes in downstream genes. The intersection of differentially expressed genes (|log2FC|>2.5) is shown in Figure 12 A, thus identifying three candidate downstream molecules: GATA4, AFF2, and NANOS1. RT-qPCR further verification showed that only GATA4 expression exhibited a sustained change after ZDHHC11 Figure 12 B) or APOD Figure 12 C) knockdown. Previous studies have shown that GATA4 plays an important role in the process of cell senescence, and its expression increases in senescent cells, thereby activating the NF-κB signaling pathway to regulate inflammatory responses. In this process, GATA4 may interact with other transcription factors or signaling molecules to jointly regulate the activity of NF-κB. As shown in Figure 12 D, several pathways related to osteoarthritis were identified by bioinformatics methods, including the NF-κB signaling pathway.

[0119] Preliminary verification of the downstream signaling pathway of ZDHHC11 mediated palmitoylation. RT-qPCR results showed that the expression of GATA4 significantly increased in human chondrocytes with ZDHHC11 knockdown Figure 13 A), while overexpression of ZDHHC11 significantly decreased the expression of GATA4 in chondrocytes Figure 13 B). Western blot results showed that the expression of GATA4 and the phosphorylation level of P65 significantly increased in human chondrocytes with ZDHHC11 knockdown Figure 13 C), while overexpression of ZDHHC11 had the opposite effect Figure 13 D).

[0120] Further verification of the GATA4-P65 signaling pathway downstream of ZDHHC11. As shown in Figure 14As shown in A, Western blot analysis found that knockdown of ZDHHC11 promoted the phosphorylation of P65, but this effect was abolished by GATA4 silencing. Quantitative analysis of p-P65 also reached a consistent conclusion ( Figure 14 B).

[0121] Verify the relationship between the ZDHHC11-APOD-GATA4-P65 axis and chondrocyte aging and osteoarthritis pathological phenotype. Western blot analysis showed that the expression levels of GATA4 and p-P65 increased significantly with age ( Figure 15 A). At the same time Figure 15 As shown in (B), in vitro supplementation of APOD can reverse the effects of ZDHHC11 knockdown on chondrocyte senescence and ECM metabolism.

[0122] 8. Effects of Zdhhc11 mRNA@LNP on articular cartilage degeneration and osteoarthritis pathological phenotypes

[0123] Studies have shown that chondrocyte-affinity peptides (CAPs) are peptides that have been studied and designed for chondrocyte targeting. These peptide sequences bind to specific molecules or receptors in cartilage tissue, enabling the targeted delivery of drugs, genes, or nanomaterials to chondrocytes for the treatment of diseases such as cartilage degeneration, arthritis, or cartilage damage. Therefore, by fusing CAPs with liposomes to prepare selective chondrocyte-targeted LNPs, they were able to improve the osteoarthritis phenotype in rats.

[0124] like Figure 16 As shown in the figure, the particle morphology of Zdhhc11 mRNA@LNP and Zdhhc11 mRNA@LNP-CAP was evaluated by TEM. Both showed a nearly spherical morphology, but compared with mRNA@LNPs, the LNPs fused with CAPs had a larger diameter and a Zeta potential closer to 0 mV. The encapsulation efficiency (EE%) of mRNA@LNPs was quantitatively detected by the fluorescent RiboGreen method. The average encapsulation efficiency was 95.7%, while the average encapsulation efficiency of mRNA@LNP-CAP was approximately 50%. Figure 17 As shown in Figure 3, Western blot results further confirmed that the prepared LNPs could effectively enter primary chondrocytes and be converted into functional protein ZDHHC11.

[0125] Micro-CT images were collected to evaluate the osteophyte formation in rats, such as Figure 18As shown in FIG. 10A, the number of osteophytes in rats injected intra-articularly with Zdhhcl lmRNA@LNP or Zdhhcl lmRNA@LNP-CAP was significantly lower than that in other groups, and the effect of the DMM+mRNA@LNP-CAP group was particularly obvious, indicating that Zdhhcl lmRNA@LNP or Zdhhcl lmRNA@LNP-CAP can significantly alleviate the pathological phenotype of DMM surgery-induced osteoarthritis.

[0126] Further, the in vivo therapeutic effect of Zdhhcl lmRNA@LNP and Zdhhcl lmRNA@LNP-CAP was verified by rat articular cartilage tissue safranin O-fast green staining and immunohistochemical staining of Col2a1, Mmp3 and P21. As shown in FIG. 10B, after treatment, the degenerative changes of the cartilage of the rats were significantly reduced, and the expression of Col2a1 was up-regulated, and the expression level of Mmp3 was reduced, indicating that the ECM decomposition and metabolism process of chondrocytes was inhibited, and the synthesis and metabolism process was enhanced. After treatment, the expression of the cell senescence marker P21 was reduced, further supporting the anti-cell senescence effect of mRNA@LNP. Figure 19 A, after treatment, the degenerative changes of the cartilage of the rats were significantly reduced, and the expression of Col2a1 was up-regulated, and the expression level of Mmp3 was reduced, indicating that the ECM decomposition and metabolism process of chondrocytes was inhibited, and the synthesis and metabolism process was enhanced. After treatment, the expression of the cell senescence marker P21 was reduced, further supporting the anti-cell senescence effect of mRNA@LNP. As shown in FIG. 10B, after intra-articular injection of Zdhhcl lmRNA@LNP or Zdhhcl lmRNA@LNP-CAP, the OARSI score of the articular cartilage pathological section was significantly reduced. Figure 19 B, after intra-articular injection of Zdhhcl lmRNA@LNP or Zdhhcl lmRNA@LNP-CAP, the OARSI score of the articular cartilage pathological section was significantly reduced.

[0127] The GATA4-P65 signaling pathway downstream of ZDHHC11 was verified in vivo. As shown in FIG. 11A, after treatment of Zdhhcl lmRNA@LNP, the number of Gata4-positive cells and p-P65-positive cells in rats with DMM-induced osteoarthritis was significantly reduced, indicating that Zdhhcl 1 can significantly inhibit the GATA4-P65 signaling pathway in vivo. Figure 20 A, after treatment of Zdhhcl lmRNA@LNP, the number of Gata4-positive cells and p-P65-positive cells in rats with DMM-induced osteoarthritis was significantly reduced, indicating that Zdhhcl 1 can significantly inhibit the GATA4-P65 signaling pathway in vivo.

Claims

1. Use of palmitoyl transferase ZDHHC11 in the preparation of a drug for treating osteoarthritis.

2. Use according to claim 1, characterized in that, The drug regulates the overexpression of palmitoyl transferase ZDHHC11 in chondrocytes.

3. Use according to claim 1, characterized in that, The effective component of the drug includes a gene or mRNA encoding palmitoyl transferase ZDHHC11, which is introduced into chondrocytes through an adenovirus vector or a lipid nanoparticle.

4. Use according to claim 3, characterized in that, The drug is injected in situ at the site of osteoarthritis.

5. Use according to claim 3, characterized in that, The adenovirus vector is an adeno-associated virus, and the lipid nanoparticle is obtained by fusing a cartilage cell affinity peptide with a liposome.

2. The drug for treating osteoarthritis according to claim 1, wherein the drug is used for treating osteoarthritis in the knee joint.

3. The drug for treating osteoarthritis according to claim 1, wherein the drug is used for treating osteoarthritis in the hip joint.

4. The drug for treating osteoarthritis according to claim 1, wherein the drug is used for treating osteoarthritis in the ankle joint.

5. The drug for treating osteoarthritis according to claim 1, wherein the drug is used for treating osteoarthritis in the shoulder joint.

6. The drug for treating osteoarthritis according to claim 1, wherein the drug is used for treating osteoarthritis in the elbow joint.

7. The drug for treating osteoarthritis according to claim 1, wherein the drug is used for treating osteoarthritis in the wrist joint.

8. The drug for

Images