Application of Ndufa7 gene in preparation of medicine for improving and / or treating diseases related to mitochondrial dysfunction

Abstract

The invention discloses an application of a NDufa7 gene in preparation of a medicine for improving and / or treating mitochondrial dysfunction related diseases. A NDufa7 gene is constructed to knock out a mouse and analyze the physiological function of the mouse, and it is found that NDufa7 deletion or expression down-regulation can cause mouse activity capability reduction, research capability weakening, body function reduction and myocardial hypertrophy induction, which indicates that NDufa7 is related to mitochondrial dysfunction related diseases such as neurodegenerative diseases and cardiovascular diseases. And overexpression of the NDufa7 gene in the cell finds that the NDufa7 gene can reduce the damage of oleic acid to the cell and improve the cell survival rate, which indicates that the NDufa7 gene can be used as a therapeutic target for the diseases related to the mitochondrial dysfunction, and a preparation for promoting the expression of the NDufa7 gene is used for preparing medicines for improving and / or treating the diseases related to the mitochondrial dysfunction.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of Ndufa7 gene in preparing a drug for improving and / or treating mitochondrial dysfunction or mitochondrial dysfunction-related diseases. Background Art

[0002] Mitochondrial dysfunction, also known as mitochondrial disease (MD), refers to energy metabolism disorders caused by dysfunction of the mitochondrial oxidative phosphorylation system or pyruvate dehydrogenase complex, which can occur at any age from neonatal to adulthood. Mitochondria are an important organelle in cells and play a vital role in providing energy and participating in a variety of cellular processes, including energy supply, cellular respiration, regulation of cell metabolism, apoptosis and signal transduction. Therefore, mitochondrial dysfunction has an important impact on the health of major human systems such as the cardiovascular system, nervous system, respiratory system, digestive system, urinary system, etc. Mitochondrial dysfunction can cause a series of mitochondrial dysfunction-related diseases, such as neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, Huntington's disease, as well as cardiovascular diseases such as myocardial hypertrophy, autism, diabetes, aging and / or tumors.

[0003] Neurodegenerative diseases (NDDs) are caused by the loss of neurons and / or their myelin sheaths, which worsen over time and eventually lead to impaired memory, cognition, behavior, sensory and / or motor function. Common chronic neurodegenerative diseases include Alzheimer's disease (AD), Parkinson's disease (PD), primary tauopathy (PART), frontotemporal dementia (FTD), amyotrophic lateral sclerosis (ALS) and Huntington's disease (HD). In recent years, in the research and exploration of the treatment of neurodegenerative diseases, it has been found that the occurrence of neurodegenerative diseases is closely related to mitochondrial dysfunction. Studies have shown that there are mtDNA defects and abnormal oxidative phosphorylation in the brain of AD patients. Through polymerase chain reaction (PCR) and blot hybridization detection, it was found that mtDNA breaks, base deletions and missense mutations appeared in the brain tissue of sporadic AD patients. Electron microscopy observation confirmed that the number of mitochondria increased, the structure was abnormal, and lamellar bodies and crystalline inclusions appeared. In addition, when mitochondrial function is impaired in neurons of AD patients, it will lead to insufficient energy supply to neurons and release a large amount of reactive oxygen species (ROS), inducing oxidative stress damage, calcium regulation imbalance, and ultimately triggering neuronal apoptosis.

[0004] Mitochondrial dysfunction is closely related to the occurrence of cardiovascular diseases. Mitochondria are the energy metabolism center of cells, which produce energy through oxidative phosphorylation to meet the high energy demand of the heart. Many important physiological activities of the heart, such as myocardial contraction and maintenance of intracellular homeostasis, require adenosine triphosphate (ATP) produced by mitochondria. Therefore, normal mitochondrial function is the premise and basis for normal physiological activities of the heart. Mitochondrial dysfunction characterized by abnormal respiratory chain function and ATP synthesis disorder is the cause of many cardiovascular diseases. Therefore, mitochondrial quality control and reduction of mitochondrial dysfunction in the early stage of the disease have become new directions for the treatment of cardiovascular diseases.

[0005] For example, myocardial hypertrophy (HCM) is a common and serious cardiovascular disease in which the heart responds to a large number of physiological and pathological stimuli. Hypertrophic cardiomyopathy is one of the main causes of heart failure and sudden death. Its clinical symptoms include dyspnea, chest pain, angina-like pectoris, fatigue, dizziness and syncope, palpitations, etc. after strenuous activity or emotional excitement, and even heart failure or sudden death in the late stage. With the advancement of genetics, more than 1,000 mutations associated with HCM have been discovered, most commonly in sarcomere genes. Biochemical and biophysical studies of isolated human cardiac myosin have shown that different HCM mutations have heterogeneous effects on actin sliding velocity, intrinsic force, and ATPase activity. At the cellular level, most HCM mutations increase total force generation and ATP utilization, resulting in higher myocardial energy requirements. HCM is accompanied by metabolic disorders, and increased oxidative damage leads to significant defects in mitochondrial structure and function, which are exacerbated by the failure of upregulation of mitochondrial quality control, thereby increasing energy compromise. Therefore, developing new strategies aimed at improving metabolism and mitochondrial function may be a promising way to slow the progression of HCM.

[0006] Ndufa7 is located at 19p13.2 in the human chromosome, in the inner membrane of mitochondria, and is an important subunit of mitochondrial respiratory chain complex I, but its exact function in mitochondria is still unclear. The relevance of the Ndufa7 gene to mitochondrial dysfunction and related diseases, including neurodegenerative diseases and cardiovascular diseases, and the role it plays are also unclear. Summary of the invention

[0007] The purpose of the present invention is to provide a new treatment direction for mitochondrial dysfunction (MD) and related diseases, including neurodegenerative diseases, cardiovascular diseases, etc. Specifically, it provides the use of Ndufa7 gene in the preparation of drugs for preventing, improving and / or treating mitochondrial dysfunction and mitochondrial dysfunction-related diseases, providing an important basis for drug development.

[0008] To achieve the above objectives, the technical solutions adopted by the present invention are as follows:

[0009] Ndufa7 is a subunit of the mitochondrial respiratory chain complex I, and its specific function in mitochondria has not been reported so far. The inventors have found through experimental research that the loss of the Ndufa7 gene will lead to abnormalities in the mitochondrial respiratory chain and ATP synthesis, increased oxidative stress, loss of mitochondrial structural integrity and other related mitochondrial function declines, thereby confirming that there is a close correlation between the Ndufa7 gene and diseases related to mitochondrial dysfunction caused by mitochondrial energy metabolism.

[0010] The present invention also discovered through proteomic analysis that the Ndufa7 gene can affect the oxidative phosphorylation of cardiomyocytes, and for the first time confirmed the association between the Ndufa7 gene and various neurodegenerative diseases such as Parkinson's disease and Alzheimer's disease, as well as cardiovascular diseases such as myocardial hypertrophy. Ndufa7 is involved in the pathogenesis of various neurodegenerative diseases and cardiovascular diseases such as myocardial hypertrophy, providing an important theoretical basis for the prevention, improvement or treatment of neurodegenerative diseases or cardiovascular diseases such as myocardial hypertrophy and drug screening.

[0011] The present invention constructs Ndufa7 gene knockout mice through gene editing, and analysis of their physiological functions shows that Ndufa7 deficiency or down-regulated expression will lead to reduced activity, weakened exploration ability, and decreased physical function of mice, and interfering with the expression of the Ndufa7 gene can induce the occurrence of myocardial hypertrophy, confirming that Ndufa7 is down-regulated in neurodegenerative diseases and / or myocardial hypertrophy caused by mitochondrial dysfunction.

[0012] The Ndufa7 gene expression product inhibits the expression of mitochondrial fission proteins Drp1 and / or Fis1; inhibits the mRNA expression level of antioxidant proteins Trx1 and / or Prdx2; and inhibits the mRNA expression level of myocardial hypertrophy markers ANP and / or BNP.

[0013] The inventors found through experimental investigation that compared with wild-type mice, the mRNA expression levels of mitochondrial fission proteins Drp1, Fis1 and antioxidant proteins Trx1 and Prdx2 in Ndufa7 gene knockout mice were significantly increased, indicating that Ndufa7 can inhibit the expression of mitochondrial fission proteins Drp1 and / or Fis1 and inhibit the mRNA expression levels of antioxidant proteins Trx1 and / or Prdx2, thereby affecting the regulation of mitochondrial fission. When the Ndufa7 gene is missing, it will lead to mitochondrial dynamics dysfunction and trigger a series of mitochondrial dysfunction-related diseases.

[0014] Overexpression of Ndufa7 gene has a significant protective effect against OA-induced cytotoxicity.

[0015] Therefore, upregulating the Ndufa7 gene can have a positive improvement effect on a series of problems caused by mitochondrial dysfunction.

[0016] Based on the research results of the present invention, in the first aspect, the present invention provides the use of Ndufa7 in the preparation of a drug for preventing, improving and / or treating mitochondrial dysfunction or mitochondrial dysfunction-related diseases. Specifically, it includes the use of the Ndufa7 gene as a target in the preparation of a drug for preventing, improving and / or treating mitochondrial dysfunction or mitochondrial dysfunction-related diseases. Preferably, the drug includes an expression promoter of the Ndufa7 gene.

[0017] As a specific optional embodiment, the present invention provides the use of an expression promoter of Ndufa7 gene in the preparation of a drug for preventing, improving and / or treating mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

[0018] And the use of the Ndufa7 gene expression box or the expression vector containing the Ndufa7 gene in the preparation of drugs for preventing, improving and / or treating mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

[0019] Preferably, the mitochondrial dysfunction-related diseases include neurodegenerative diseases, cardiovascular diseases, autism, diabetes, aging and / or tumors caused by mitochondrial dysfunction.

[0020] Preferably, the neurodegenerative disease includes at least one of Parkinson's disease, Alzheimer's disease, Huntington's disease, primary tauopathy, frontotemporal dementia, and amyotrophic lateral sclerosis.

[0021] Preferably, the cardiovascular disease is such as myocardial hypertrophy (including myocardial fibrosis), myocardial injury, etc.

[0022] In a second aspect, the present invention provides a mouse model with Ndufa7 gene knockout for use in screening or evaluating drugs for treating mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

[0023] In a third aspect, the present invention provides the use of a reagent for detecting the expression level of the Ndufa7 gene in preparing a kit for diagnosing mitochondrial dysfunction or a disease related to mitochondrial dysfunction.

[0024] Specifically, the Ndufa7 gene is downregulated in mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

[0025] In addition, the present invention also provides a method for constructing an animal model of diseases related to mitochondrial dysfunction, specifically, knocking out the Ndufa7 gene of the animal used to construct the model or inhibiting the expression of the Ndufa7 gene to construct an animal model of diseases related to mitochondrial dysfunction.

[0026] Preferably, the animal can be selected from mice.

[0027] Optionally, the Ndufa7 gene is knocked out by CRISPR / Cas9 gene editing technology to inhibit its expression.

[0028] The Ndufa7 gene expression-deficient mice have obvious mitochondrial dysfunction, which can cause a series of diseases and symptoms related to mitochondrial dysfunction. It has important application value in related disease research and drug development.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] (1) The present invention found that the loss of Ndufa7 gene will lead to abnormalities in mitochondrial respiratory chain and ATP synthesis, increased oxidative stress, loss of mitochondrial structural integrity and other related mitochondrial function decline, thus confirming that there is a close correlation between Ndufa7 gene and mitochondrial dysfunction-related diseases caused by mitochondrial energy metabolism.

[0031] (2) The present invention discovered through proteomic analysis that the Ndufa7 gene can affect the oxidative phosphorylation of cardiomyocytes, and for the first time confirmed the association between the Ndufa7 gene and various neurodegenerative diseases such as Parkinson's disease and Alzheimer's disease.

[0032] (3) The present invention constructs Ndufa7 knockout mice through gene editing, and analyzes their physiological functions. It is found that the absence or down-regulation of Ndufa7 expression will lead to reduced activity, weakened exploration ability, and decreased physical function of mice. Interference with the expression of the Ndufa7 gene can induce the occurrence of myocardial hypertrophy, which fully confirms that Ndufa7 is involved in the pathogenesis of various neurodegenerative diseases and myocardial hypertrophy.

[0033] (4) The present study showed that overexpression of the Ndufa7 gene had a significant protective effect against OA-induced cytotoxicity.

[0034] Therefore, upregulating the Ndufa7 gene can have a positive improvement effect on a series of problems caused by mitochondrial dysfunction, and the Ndufa7 gene can be used as a therapeutic target for diseases related to mitochondrial dysfunction. The present invention provides an important basis for the preparation of drugs for preventing, improving or treating diseases related to mitochondrial dysfunction. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a flow chart of FASP treatment of cardiac proteins in Example 1.

[0036] Figure 2This is the analysis of Fis1 and Drp1 mRNA expression levels in Example 2, wherein Figure A shows the mRNA expression levels of Fis1 in WT and KO mice, and Figure B shows the mRNA expression levels of Drp1 in WT and KO mice.

[0037] Figure 3 This is the analysis of Trx1 and Prdx2 mRNA expression levels in Example 2, wherein Figure A shows the mRNA expression levels of Trx1 in WT and KO mice, and Figure B shows the mRNA expression levels of Prdx2 in WT and KO mice.

[0038] Figure 4 This is the analysis of ANP and BNP mRNA expression levels in Example 2, wherein Figure A shows the mRNA expression levels of ANP in WT and KO mice, and Figure B shows the mRNA expression levels of ANP in WT and KO mice.

[0039] Figure 5 Figure 3 is the result of the open field experiment analysis in Example 3, wherein Figure A is the representative movement trajectory of WT, KO adult mice and WT, KO elderly mice in the open field experiment, Figure B is the representative activity heat map of WT, KO adult mice and WT, KO elderly mice in the open field experiment, Figure C is the total distance of mouse movement in the open field experiment, Figure D is the average speed of mouse movement in the open field experiment, Figure E is the immobility time of mice in the open field experiment, and Figure F is the residence time of mice in the central area of ​​the open field experiment.

[0040] Figure 6 These are the analysis results of the elevated plus maze experiment in Example 3, wherein Figure A is the representative movement trajectory of WT, KO adult mice and WT, KO elderly mice in the elevated plus maze experiment, Figure B is the representative activity heat map of WT, KO adult mice and WT, KO elderly mice in the elevated plus maze experiment, Figure C is the total distance of the open arm movement of the mice in the elevated plus maze experiment, Figure D is the open arm residence time of the mice in the elevated plus maze experiment, Figure E is the total distance of the closed arm movement of the mice in the elevated plus maze experiment, and Figure F is the closed arm residence time of the mice in the elevated plus maze experiment.

[0041] Figure 7 These are the HE and WGA heart tissue staining images in Example 4, wherein Figure A is the HE staining image of the heart tissue of KO and WT mice at 2 months and 10 months of age, Figure B is the wheat germ agglutinin (WGA staining) detection of the cross-sectional area of ​​myocardial cells in the heart tissue of KO and WT mice at 2 months and 10 months of age, Figure C is the HE stained heart size of KO and WT mice at 2 months and 10 months of age, and Figure D is the statistical cross-sectional area of ​​myocardial cells in KO and WT mice at 2 months and 10 months of age.

[0042] Figure 8These are Masson and picrosirius red heart tissue staining images in Example 4, wherein Figure A is a Masson staining image of heart tissue of KO and WT mice at 2 months and 10 months of age, Figure B is a picrosirius red staining image of heart tissue of KO and WT mice at 2 months and 10 months of age, Figure C is a statistical analysis of the percentage of collagen fiber area between KO and WT mice at 2 months and 10 months of age in Masson staining, and Figure D is a statistical analysis of the percentage of collagen fiber area between KO and WT mice at 2 months and 10 months of age in picrosirius red staining.

[0043] Fig. 9 The Western Blot diagram of mitochondrial respiratory chain-related protein expression in Example 5, wherein Figure A shows the protein expression level of SDHB in WT and KO mice, and Figure B shows the protein expression level of NDUFB8 in WT and KO mice. Figure C shows the protein expression level of MTCO2 in WT and KO mice, and Figure D shows the protein expression level of ATP5A1 in WT and KO mice.

[0044] Fig.10 This is the survival rate of H9C2 cardiomyocytes and H9C2 cardiomyocytes overexpressing Ndufa7 gene after oleic acid treatment.

[0045] Fig.11 This is the survival rate of PC-12 neurons and PC-12 neurons overexpressing Ndufa7 gene after oleic acid treatment.

[0046] In the figures, *P<0.05; **P<0.01; ***P<0.001. DETAILED DESCRIPTION

[0047] In order to make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0048] The experimental animal species involved in the present invention include: C57BL / 6 wild-type mice (WT mice), and Ndufa7 gene knockout mice (KO mice) constructed by CRISPR / Cas9 gene editing technology, and the ID of the Ndufa7 gene is 66416 (https: / / www.ncbi.nlm.nih.gov).

[0049] Example 1 Proteomic Analysis

[0050] (1) Extraction and concentration determination of cardiac proteins

[0051] After the WT and KO mice were dissected and the hearts were removed, they were placed in normal saline in an ice bath and pulsated until no blood was discharged. The hearts were transferred to a new normal saline culture dish for washing, and the process was repeated 4 to 5 times until there was no obvious red blood in the solution. The water was absorbed by filter paper and then frozen in liquid nitrogen. The frozen heart was removed, and 1 mL of lysis solution was added to every 100 mg of tissue according to the weight of the heart. The lysis solution was 2% w / v SDS (sodium dodecyl sulfate) and 0.1 M DTT (dithiothreitol). The mouse heart tissue homogenate was fully homogenized at a frequency of 60 Hz for 150 s, and then placed in a 95°C constant temperature mixer for heating and incubation for 5 min. The heated and incubated tissue homogenate was quickly aspirated 3 to 5 times. After 18 cycles of ultrasonic crushing (10 s ultrasonic pulse, 20 s interval time, total ultrasonic time 3 min, ultrasonic crusher power set to 30% of the maximum output power), the sample was always immersed in an ice water bath during the ultrasonic process to prevent the protein from being degraded or denatured due to heat generated by ultrasonic vibration. Centrifuge the sonicated solution at room temperature for 10 min (20238 g), and carefully transfer the supernatant to a new 1.5 mL centrifuge tube. Take out 10 μL of the supernatant, dilute it 100 times with Milli-Q water, and use a UV spectrophotometer to determine its protein concentration. Select a spectral scan from 190 nm to 350 nm, and record the absorbance values ​​(A) of the sample at 230 nm, 280 nm, and 320 nm wavelengths, respectively. Calculate the protein concentration according to the following calculation formula:

[0052] Protein concentration (μg / μL) = 183 × (A 230 -A 320 )-75.8×(A 280 -A 320 )

[0053] (2) Protein enzymatic hydrolysis and peptide collection

[0054] According to the calculated concentration, a protein solution containing 200 μg of protein was taken out, and 8 MUA solution (urea) was added to a total volume of 60 μL. After oscillation and mixing, 30 μL (containing 100 μg of protein) was taken out and mixed with 200 μLUA solution. The mixed solution was then added to an ultrafiltration tube (30 kDa molecular weight cutoff, processing capacity 0.5 mL).

[0055] The specific experimental steps are as follows: Figure 1 As shown, the peptide samples were finally obtained, which were packaged, dried, and stored at low temperature.

[0056] (3) Analysis and data processing

[0057] The peptides were analyzed by Nano-UHPLC-MS / MS using the Ultimate 3000RSLCnano nanoliter HPLC system and timsTOF Pro online ion mobility time-of-flight mass spectrometry, and the raw data collected by the mass spectrometry were analyzed using MaxQuant. The analysis results were collated and statistically analyzed using Perseus (ver.2.0.6.0). The protein data with statistically significant differences obtained by Perseus analysis were analyzed by Fold Change card value and then bioinformatics analysis was performed.

[0058] Among them, the Fold Change card value analysis standard is:

[0059] The proteins with Fold Cha content Fold change>1.2 (up-regulated) or <0.83 (down-regulated) between the two groups were obtained to obtain the differential proteins in the comparison between each two groups.

[0060] The quantitative information of the obtained proteins was statistically analyzed, and the adult and old WT and KO mice were compared to find the differentially expressed protein maps, and the KEGG signaling pathway enrichment was performed for the obtained proteins with significant differences. Table 1 shows the KEGG signaling pathway enrichment of adult mice, and Table 2 shows the KEGG signaling pathway enrichment of old mice. From the differential protein sets of each pathway, it can be found that the Ndufa7 gene can affect the oxidative phosphorylation of cardiomyocytes, and in the differential protein signaling pathway enrichment of WT and KO mice, it was found that the expression changes of Naufa7 are closely related to neurodegenerative diseases such as Parkinson's disease (PD), Alzheimer's disease (AD), and Huntington's disease (HD). The KEGG signaling pathway enrichment results provide a theoretical basis for subsequent pathway research.

[0061] Table 1 KEGG signaling pathway enrichment in adult mice

[0062]

[0063] Table 2 Enrichment of KEGG signaling pathways in aged mice

[0064]

[0065] Example 2 Fluorescence quantitative PCR analysis

[0066] 1. RNA extraction from cardiac tissues of WT and KO mice

[0067] (1) Take out the heart tissue sample, grind it into powder under liquid nitrogen, and immediately transfer it to Buffer RL. Add 500 μL Buffer RL for every 20 mg of ground tissue, mix well, and lyse.

[0068] (2) Place the lysed sample into a collection tube, centrifuge at 12000 rpm for 30 seconds, and collect the filtrate;

[0069] (3) Add 0.5 times the volume of anhydrous ethanol to the filtrate and mix thoroughly;

[0070] (4) Transfer to a collection tube, centrifuge at 12000 rpm for 30 s, and discard the filtrate;

[0071] (5) Add 700 μL Buffer RW1 to the collection tube, centrifuge at 12000 rpm for 30 s, and discard the filtrate;

[0072] (6) Add 700 μL Buffer RW2 to the collection tube, centrifuge at 12000 rpm for 30 s, and discard the filtrate;

[0073] (7) Add 500 μL of Buffer RW2 to the collection tube, centrifuge at 12,000 rpm for 2 min, transfer the adsorption column in the collection tube to a centrifuge tube, add 100 μL of RNase-free ddH2O to the adsorption column, let stand at room temperature for 1 min, and centrifuge at 12,000 rpm for 1 min to elute the RNA;

[0074] (8) The obtained RNA was diluted with ddH2O to a final concentration of 1000 ng / μL.

[0075] 2. Reverse transcription

[0076] Reverse transcribe the obtained RNA sample into cDNA: remove the genomic DNA from the extracted total RNA, prepare the gene removal mixture formula as shown in Table 3, add each component to the reaction tube, mix it by pipetting and centrifuge it briefly, and place it in the PCR instrument, and the reaction conditions are set to 42℃ for 2min. After the reaction is completed, add 4μL of 5×HiScript III qRT SuperMix to the mixture, mix it and centrifuge it briefly, and place it in the PCR instrument for reverse transcription amplification, and the reaction conditions are 37℃, 15min; 85℃, 5s. After the reverse transcription is completed, the product can be directly used for RT-PCR.

[0077] Table 3

[0078] Contents volume <![CDATA[RNase-freeddH2O]]> To 16μL 4×gDNA wiper Mix 4μL Template RNA Total RNA:1

[0079] 3. Fluorescence quantitative PCR detection

[0080] The RT-PCR primer sequences used in this experiment are shown in Table 4. RT-PCR results GAPDH was used as an internal reference and 2 -ΔΔCt Analysis Methods The relative expression levels of mRNA were analyzed.

[0081] Table 4

[0082] Primers Sequence (5′-3′) GAPDH-Forward AAGAAGGTGGTGAAGCAGG GAPDH-Reverse GAAGGTGGAAGAGTGGGAGT ANP-Forward GCTTCCAGGCCATATTGGAG ANP-Reverse GGGGGCATGACCTCATCTT BNP-Forward AGTCCTTCGGTCTCAAGGCA BNP-Reverse CCGATCCGGTCTATCTTGTGC Fis1-Forward AGAGCACGCAATTTGAATATGCC Drp1-Forward ACCGGGAATGACCAAAGTACC Drp1-Reverse TGGGATTACTGATGAACCGAAGA Trx1-Forward CAAGCCCTTCTTCCATTCC Trx1-Reverse GCAACATCCTGGCAGTCAT Prdx2-Forward CACCTGGCGTGGATCAATACC Prdx2-Reverse GACCCCTGTAAGCAATGCCC

[0083] Results As shown in 2-4, compared with WT mice, the mitochondrial fission proteins Drp1 and Fis1 in KO mice with Ndufa7 gene deletion were significantly increased, indicating abnormal mitochondrial fission and dysfunction in mitochondrial dynamics; Trx1 can remove ROS in cells, thereby reducing oxidative damage to lipids, proteins and DNA. Prdx is abundantly expressed in the heart and has a protective effect on cardiomyocytes. Trx1 and Prdx2, as two oxidative stress proteins in cells, have antioxidant and ROS scavenging effects. RT-PCR results showed that the mRNA expression levels of antioxidant proteins Trx1 and Prdx2 in the hearts of KO mice were significantly increased. In addition, myocardial hypertrophy is accompanied by overexpression of myocardial hypertrophy markers nppa (ANP) and nppb (BNP). Compared with the WT group, the mRNA expression levels of myocardial hypertrophy markers ANP and BNP in the hearts of KO mice were significantly increased.

[0084] Example 3 Analysis and evaluation of major physiological functions

[0085] In order to explore whether the activity and exploratory abilities of KO mice were affected after Ndufa7 gene knockout, an open field test was performed on 4-month-old and 10-month-old WT mice and KO mice to observe the spontaneous activities and exploratory behaviors of the mice. The results were then confirmed by an elevated plus maze test. The specific methods are as follows.

[0086] (1) Open field test

[0087] Without interference from other animals, the mice were transferred from the mouse room to the special cage rack of the behavioral laboratory two hours in advance. The open field box device consisted of an 80cm×80cm white plastic bottom plate and 45cm black plastic high walls on four sides. After debugging the camera and the parameter values, the area of ​​the white plastic bottom plate was divided into 9 squares, and the mice were placed in the central square. The total distance, total speed, static time and residence time in the central square of the mice within 5 minutes were monitored by the video system. Before each mouse was placed in the test box, the white plastic bottom plate was wiped clean with alcohol to remove feces and urine to remove odors and prevent interference with the movement of the next mouse. The entire experimental environment was kept at 25°C and kept quiet, with consistent light brightness.

[0088] (2) Elevated plus maze test

[0089] The elevated plus maze consists of two open arms and two closed arms of about 35 cm, which cross to form a central area, two open arms, and two closed arms. After debugging the camera and the parameter values, it is divided into five parts: the central area, two open arms, and two closed arms. The mice are placed in the central area, and the video system is used to monitor the mice's retention time and distance in the open and closed arms within 5 minutes. Before each mouse is placed in the experimental box, the feces and urine left by the previous mouse are removed and wiped clean with alcohol to prevent interference with the movement of the next mouse. The entire experimental environment is kept at 25°C and quiet, with consistent light brightness.

[0090] The results are as follows Figure 5 As shown, the total activity distance and average speed of 4-month-old adult KO mice were significantly reduced compared with WT mice of the same age (P<0.001), and the time spent exploring the central area was also significantly reduced (P<0.01). At the same time, the resting time of KO mice during the monitoring period was significantly increased compared with WT mice (P<0.05).

[0091] The elevated plus maze experiment is to observe the activity and exploration ability of mice through the conflicting behaviors formed by the mice's autonomous exploration of new and strange environments and the fear they produce in a high-hanging open environment. At the same time, in an open, unprotected high-hanging environment, the movement state of the mice also reflects the anxiety of the mice. The total movement distance and residence time of the mice in the open arms within the specified time and the total movement distance and residence time of the closed arms were statistically analyzed ( Figure 6 , CDEF), the results showed that the total distance traveled and the time spent in the open arm area in the high suspension of adult and elderly KO mice were significantly reduced compared with WT mice of the same age (P<0.05), and the total distance traveled and the time spent in the closed arm area did not change significantly. It can be seen that in the same period of time, in the open arm area in the high suspension and open state, compared with WT mice, the activity and exploration abilities of adult and elderly KO mice were reduced, and the performance became more obvious with the increase of age.

[0092] In summary, Ndufa7 - / - The mice showed reduced activity and exploratory abilities, while Ndufa7 - / - The mice showed certain anxiety during activities, further demonstrating the association between Ndufa7 and neurodegenerative diseases.

[0093] Example 4 Histopathological Analysis

[0094] In order to evaluate the cardiac morphological changes of KO mice and observe the state and size changes of cardiomyocytes and the microscopic morphological changes, heart tissues were obtained from adult KO mice and WT mice of the same age as old KO mice for HE and WGA staining. The chromatin in the cell nucleus and the nucleic acid in the cytoplasm were stained purple-blue by HE dye, and the components in the cytoplasm and extracellular matrix were stained red. In addition, WGA dye can dye the cardiomyocyte membrane green.

[0095] HE staining results showed that the myocardial cells of WT mice were closely arranged, with normal cell structure, clear nucleus and nucleolus structure, while the myocardial gaps of KO mice were significantly enlarged and the cell boundaries were unclear ( Figure 7 , A). The results of WGA staining showed that compared with WT mice, the area of ​​myocardial cells in KO mice at the same age was larger, and with the increase of age, the arrangement of myocardium changed from neat to disordered ( Figure 7 , B). The data analysis results showed that the cross-sectional area of ​​myocardial cells in adult KO mice and aged mice was significantly larger than that in WT mice, and the heart volume of KO mice was larger than that of WT mice at the same age ( Figure 7 , CD). In summary, Ndufa7 - / - It causes myocardial hypertrophy in mice and the symptoms become more severe with age.

[0096] Myocardial fibrosis is an important indicator in the pathological myocardial hypertrophy. Masson and picrosirius red staining was performed on adult and elderly WT and KO mice of the same batch to evaluate the degree of myocardial fibrosis in the mouse heart. After Masson staining, muscle fibers were red, collagen fibers were green or blue, and picrosirius red stained collagen fibers red and muscle fibers yellow. The results of Masson staining and picrosirius red staining showed that compared with WT mice, KO mice had an increased collagen fiber area at the same age, a high degree of fibrosis, and the area of ​​collagen fibers gradually increased with age ( Figure 8 , AB). The statistical results of collagen fiber area by Masson and picrosirius red showed that collagen deposition in the KO group increased significantly and the degree of myocardial fibrosis increased with the increase of age ( Figure 8 , CD). In summary, Ndufa7 - / - Can cause myocardial fibrosis in mice.

[0097] Example 5 Analysis of mitochondrial respiratory chain-related protein expression

[0098] To explore Ndufa7 - / -The expression of mitochondrial respiratory chain-related proteins in mice was detected by western blotting, and the expression of mitochondrial complex I subunit NDUFB8 protein, mitochondrial complex II subunit SDHB protein, mitochondrial complex IV subunit MTCO2 protein, and mitochondrial complex V subunit ATP5A1 protein was detected. GAPDH was used for standardization, and the gray value analysis of the results was performed using ImageLab software. The results are shown in Fig. 9 As shown in the figure, compared with WT mice of the same age, the expression levels of complex II subunit SDHB protein, complex IV subunit MTCO2 protein and complex V subunit ATP5A1 protein in the hearts of KO mice were significantly upregulated, with significant differences (P<0.05). The expression level of complex I subunit NDUFB8 protein showed a downward trend in adult mice, but there was no significant difference (P>0.05), while in old mice, the expression level of NDUFB8 protein in KO mice was significantly decreased (P<0.01).

[0099] In summary, Ndufa7 - / - It leads to high expression of mitochondrial respiratory chain complex subunits SDHB, MTCO2 and ATP5A1 proteins, while the expression of NDUFB8 protein located in complex I is reduced. Its expression disorder is associated with the occurrence and development of various diseases such as Alzheimer's disease, diabetes, cardiovascular disease, aging, autism and tumors.

[0100] Example 6 Protective effect of overexpressing Ndufa7 gene on cells

[0101] Oleic acid (OA) can produce a series of toxic effects on cells, leading to a series of pathological changes. Therefore, OA solution is often used to treat cells for 48 hours to establish various cytotoxicity models.

[0102] In this example, H9C2 cells (heart) and PC-12 cells (nerve) were used as examples to detect the cell survival rate after overexpression of the Ndufa7 gene in the cells and induction with oleic acid (OA), and to explore the protective effect of overexpression of the Ndufa7 gene on OA-induced cytotoxicity.

[0103] 1. Construction of overexpression vector

[0104] Based on the commercially available pEGFP-C1, the Ndufa7 gene sequence (ID: 66416) was inserted between the multiple cloning sites Xho1 and BamH1 to construct the overexpression vector pEGFP-C1-Ndufa7.

[0105] 2. Cell culture

[0106] H9C2 cells (heart) and PC-12 cells (nerve) were cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2 incubator. When the cell confluence reached 70% to 80%, the cells were digested with 0.25% trypsin-EDTA and passaged at a ratio of 1:3. Cells in the logarithmic growth phase were used for the experiment.

[0107] 3. Modeling

[0108] 18 hours after cell plating, the culture medium was changed to DMEM medium containing 5% fetal bovine serum and 0.5% fatty acid-free bovine serum albumin, and the plasmid pEGFP-C1 empty vector and pEGFP-C1-Ndufa7 overexpression vector were transfected into the cells. The cell lines were exposed to oleic acid (OA) or solvent (BSA aqueous solution) control induction treatment for 24 hours, and the CCK8 cell survival rate assay was repeated 3 times.

[0109] 4. CCK8 detection of cell viability

[0110] Add 10 μL of CCK8 working solution (the volume ratio of CCK8 reagent stock solution to complete culture medium is 1:9) to each well of the 96-well plate, incubate in a 37°C incubator for 45 min, detect the absorbance at 450 nm with an enzyme reader, and calculate the cell survival rate.

[0111] Cell survival rate / %=[(A experimental group-A blank group) / (A control group-A blank group)]×100%.

[0112] 5. Results

[0113] Results Fig.10 and 11 .

[0114] Depend on Fig.10 and 11 It can be seen that in the experimental group where Ndufa7 was not overexpressed in the cells, the survival rates of H9C2 and PC-12 cells in the OA stimulation group decreased after OA stimulation compared with the control group, indicating that OA stimulation caused toxicity to the cells, resulting in a significant decrease in cell survival rate. After pEGFP-C1-Ndufa7 was overexpressed in the cells, the decrease in cell survival rate was significantly improved under the same OA stimulation. Under the same OA stimulation, the survival rate of cells overexpressing pEGFP-C1-Ndufa7 was significantly higher than that of cells not overexpressing Ndufa7.

[0115] The results showed that overexpression of Ndufa7 gene had a significant protective effect against OA-induced cytotoxicity.

[0116] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. Use of Ndufa7 in the preparation of drugs for preventing, improving and / or treating mitochondrial dysfunction or diseases related to mitochondrial dysfunction.

2. Use of the Ndufa7 gene as a target in the preparation of drugs for preventing, improving and / or treating mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

3. Use of an expression promoter of the Ndufa7 gene in the preparation of a drug for preventing, improving and / or treating mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

4. Use of the Ndufa7 gene expression cassette or an expression vector containing the Ndufa7 gene in the preparation of a drug for preventing, improving and / or treating mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

5. Application of Ndufa7 knockout animal models in screening or evaluating drugs for the treatment of mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

6. Use of a reagent for detecting the expression level of Ndufa7 in the preparation of a kit for diagnosing mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

7. The use according to any one of claims 1 to 6, characterized in that: The diseases associated with mitochondrial dysfunction include neurodegenerative diseases, cardiovascular diseases, autism, diabetes, aging and / or tumors.

8. The use according to claim 7, characterized in that: The neurodegenerative disease includes at least one of Parkinson's disease, Alzheimer's disease, Huntington's disease, primary tauopathy, frontotemporal dementia, and amyotrophic lateral sclerosis.

9. The use according to claim 6, characterized in that: The Ndufa7 gene is down-regulated in mitochondrial dysfunction or mitochondrial dysfunction-related diseases.

10. A method for constructing an animal model of a disease related to mitochondrial dysfunction, characterized in that: For the animals used to construct the model, the Ndufa7 gene is knocked out or the expression of the Ndufa7 gene is inhibited to construct an animal model of mitochondrial dysfunction-related diseases.

Images