Brain exosome targeted drug delivery system and application thereof

Abstract

The invention belongs to the field of naked plasmid gene therapy drugs, and particularly relates to a brain exosome targeted drug delivery system and application thereof. The drug loading system comprises a plasmid CMV (Cytomegalovirus)-RVG (Recombinant Virus Growth) Wherein the base sequence of the plasmid CMV-RVG-SirA is as shown in SEQ ID No. 1 (sequence identifier number 1). The Lamp2b protein on the surface of an exosome membrane generated by the plasmid CMV-RVG-SirA on the mouse liver is fused with the RVG polypeptide; the exosome can penetrate through a blood brain barrier to reach the brain through blood circulation. The expression product of the essential grain in the exosome is ampk alpha-siRNA, and the ampk alpha-siRNA can be complementarily paired with ampk alpha-mRNA in a hypothalamic nerve cell of a mouse, so that the ampk alpha-mRNA is ineffective.

Description

Technical Field

[0001] The present application belongs to the field of naked plasmid gene therapy drugs, and specifically relates to a brain exosome targeted drug delivery system and its application. Background Art

[0002] AMKP, or AMP-dependent protein kinase, is a key molecule in regulating bioenergy metabolism and is the core of the study of diabetes and other metabolic-related diseases. It is expressed in various metabolism-related organs and can be activated by various stimuli in the body, including cell stress, exercise, and many hormones and substances that can affect cell metabolism. Recent studies have shown (Milbank E, Dragano NRV, González-García I, et al. Small extracellular vesicle-mediated targeting of hypothalamic ampkαcorrects obesity through BAT activation. Nat Metab. 2021; 3(10): 1415-1431. doi: 10.1038 / s42255-021-00467-8) that the regulation of AMPK in the hypothalamus is a typical mechanism for regulating energy balance. AMPKα is an isoform of AMPK expressed by the human gene. Inhibition of AMPKα expression in the hypothalamus leads to increased sympathetic nervous system (SNS) activity, thereby stimulating brown adipose tissue (BAT) thermogenesis, increasing energy expenditure, and subsequently leading to weight loss independent of food intake.

[0003] RNA interference (RNAi) can specifically target mRNA and regulate its protein expression before its biogenesis, and is considered a promising therapeutic tool to manipulate the expression of disease-related genes. RNAi therapy has encountered many problems and has fallen far short of expectations in clinical translation. The development of RNAi therapy has gone through two major stages. In the first stage, small interfering RNAs (siRNAs) or chemically modified stable siRNAs were synthesized and directly injected for systemic delivery; however, these siRNAs could not effectively pass biological barriers to reach target genes. In the second stage, various delivery vehicles (e.g., lipid nanoparticles, cationic polymers, and viruses) or coupled ligands (e.g., triantennary acetylgalactosamine) were invented to improve the delivery efficiency of siRNA in vivo. In previous studies (Fu Z, Zhang X, Zhou X, et al. In vivo self-assembled small RNAs as a new generation of RNAi therapeutics. Cell Res. 2021; 31(6): 631-648. doi: 10.1038 / s41422-021-00491-z), a combinatorial and programmable plasmid was designed to use the liver as a tissue chassis to guide the self-assembly of exogenous siRNAs into secretory exosomes and promote the systemic delivery of self-assembled siRNAs in vivo. However, before the modification, due to the blood-brain barrier, the exosomes produced by the liver were systematically delivered in the systemic circulation and could not enter the brain, and did not contain AMPKα-siRNA, and could not achieve the effect of weight loss. Summary of the invention

[0004] In response to the above technical problems, the present invention replaces the Lamp2b-GFP-siRNA gene sequence in the plasmid CMV-Lamp2b-GFP-siRNA with the RVG-Lamp2b-ampkα-siRNA gene sequence. The RVG gene in the RVG-Lamp2b-ampkα-siRNA is a rabies virus peptide gene, and the specific sequence is TACACCATTTGGATGCCCGAGAATCCGAGACCAGGGACACCTTGTGACATT TTTACCAATAGCAGAGGGAAGAGAGCATCCAACGGG. The rabies virus peptide (RVG) can be fused with the exosome membrane protein (Lamp2b), so that the exosome membrane surface produced by the liver carries the rabies virus peptide (RVG) and reaches the brain through the blood-brain barrier, and the efficiency of siRNA presentation is also increased accordingly.

[0005] The technical solution of the present invention is as follows:

[0006] In a first aspect, the present invention provides a brain exosome targeted drug delivery system, the drug delivery system comprising a plasmid CMV-RVG-Sir A ;

[0007] Among them, plasmid CMV-RVG-Sir A Including RVG-Lamp2b-ampkα-siRNA.

[0008] Plasmid (CMV-RVG-Sir A ) The Lamp2b protein on the surface of the exosome membrane produced in the mouse liver is fused with the RVG polypeptide; the exosome can pass through the blood-brain barrier and reach the brain through blood circulation. The expression product of this microparticle in the exosome is ampkα-siRNA, which can complementally pair with ampkα-mRNA in the mouse hypothalamic neurons, rendering ampkα-mRNA ineffective.

[0009] According to the specific implementation of the present application, the plasmid CMV-RVG-Sir A The preparation method comprises the following steps:

[0010] The Lamp2b-GFP-siRNA gene sequence on the plasmid CMV-Lamp2b-GFP-siRNA was replaced with the RVG-Lamp2b-ampkα-siRNA gene sequence; thus, the plasmid CMV-RVG-Sir A ;

[0011]

[0012]

[0013] In a second aspect of the present application, a drug targeting brain exosomes is provided, which adopts the above-mentioned brain exosome targeted drug delivery system.

[0014] According to a specific embodiment of the present application, the drug is administered by tail vein injection.

[0015] According to the specific implementation of the present application, the injection dose is 1-5 mg / kg according to the weight of the mouse, and the injection is once every 1-3 days.

[0016] The third aspect of the present application provides a drug for treating obesity, characterized by using the brain exosome targeted drug delivery system described in claims 1-3.

[0017] According to a specific embodiment of the present application, the drug is administered by tail vein injection.

[0018] According to the specific implementation of the present application, the injection dose is 1.5-2.5 mg / kg according to the weight of the mouse, and the injection is once every 1-3 days.

[0019] In the fourth aspect of the present application, the protective plasmid CMV-RVG-Sir A Application in the preparation of drugs targeting brain exosomes.

[0020] The fifth aspect of the present application is to protect the plasmid CMV-RVG-Sir A Application in the preparation of drugs for treating obesity.

[0021] Beneficial effects of the present invention:

[0022] (1) The present invention adds rabies virus peptides that can target the brain to the exosome membrane produced by the original plasmid.

[0023] (2) The present invention changes the previous invasive method of exosome administration and only administers the exosomes via tail vein injection.

[0024] (3) The present invention can effectively reduce the weight of obese mice and improve their body fat percentage and diabetes condition. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is the plasmid map in Example 1;

[0026] Figure 2 is CMV-RVG-Sir in Example 1 A qPCR performed after transfection into HT22 cells;

[0027] Figure 3 is CMV-RVG-Sir in Example 1 AWestern blot performed after transfection into HT22 cells;

[0028] Figure 4 is CMV-RVG-Sir in Example 1 A Data statistics after Western blot performed after transfection into HT22 cells;

[0029] Figure 5 This is a Western blot of HT22 cells after transfection with exosomes in Example 3;

[0030] Figure 6 is CMV-RVG-Sir in Example 3 A After injection into mice, the resulting weight changes;

[0031] Figure 7 is CMV-RVG-Sir in Example 3 A After injection into mice, the resulting changes in BAT area temperature;

[0032] Figure 8 is CMV-RVG-Sir in Example 3 A Data statistics of BAT area temperature changes within 25 days after injection into mice;

[0033] Fig. 9 This is the glucose tolerance test (GTT) performed on HFD mice in Example 4;

[0034] Fig.10 This is the qPCR of HFD mouse liver performed in Example 4;

[0035] Fig.11 This is the qPCR of the hypothalamus of HFD mice performed in Example 4;

[0036] Fig.12 is the Western blot of the hypothalamus of HFD mice in Example 4;

[0037] Fig.13 is the qPCR of UCP1-mRNA in white adipose tissue in Example 4;

[0038] Fig.14 is the qPCR of UCP1-mRNA in brown adipose tissue in Example 4;

[0039] Fig.15 is the qPCR of UCP3-mRNA in white adipose tissue in Example 4;

[0040] Fig.16 This is the qPCR of UCP3-mRNA in brown adipose tissue in Example 4. DETAILED DESCRIPTION

[0041] Example 1: Plasmid preparation process

[0042] (1) Using molecular cloning technology, the gene sequence of Lamp2b-GFP-siRNA in CMV-Lamp2b-GFP-siRNA was replaced with RVG-Lamp2b-ampkα-siRNA; the plasmid CMV-RVG-Sir A (Plasmid map see Figure 1 ); the transformed plasmid (CMV-RVG-Sir A ) were transformed into Stbl3 competent cells, plated on a culture dish containing spectinomycin, and cultured at 37°C overnight;

[0043] The plasmid CMV-Lamp2b-GFP-siRNA contains the PCDNA6.2 vector; the base sequence information of the PCDNA6.2 vector comes from: https: / / www.biofeng.com / zaiti / Gateway / pcDNA6.2-N-EmGFP-DEST.html.

[0044] (2) Pick a single clone colony in a 12 mL shaking tube and shake it at 37°C and 220 rpm for 16 h. Inoculate the small shaken bacterial solution into a 2 L shaking flask containing 1 L LB medium containing spectinomycin and shake it at 37°C and 220 rpm for 20 h. The obtained bacterial solution is used for plasmid extraction to obtain high-concentration and high-quality target plasmids.

[0045] (3) CMV-RVG-Sir A 36 h after transfection into HT22 cells, RNA was extracted from the cells and qPCR of AMPKα-mRNA was performed. Figure 2 You can see CMV-RVG-Sir A Reduced AMPKα-mRNA levels in HT22 cells;

[0046] (4) CMV-RVG-Sir A After 36 hours of transfection into HT22 cells, proteins were extracted from the cells and Western blot was performed. Figure 3 It can be seen that HT22 cells were transfected with CMV-RVG-Sir A Then inhibit the synthesis of AMPK, Figure 4 It is the data statistics of Western blot;

[0047] (5) The target plasmid was transfected into 293T cells. After 24 hours, the cell culture medium was collected and the exosomes were extracted. The exosomes contained AMPkα-siRNA, and then the exosomes were transfected into HT22 cells. Figure 5 It can be seen that the synthesis of AMPK was inhibited after HT22 cells were transfected with exosomes.

[0048] Example 2: Construction of non-alcoholic fatty liver disease mouse model

[0049] (1) High fat diet (HFD) is the most basic way to model non-alcoholic fatty liver disease. Ordinary feed is replaced with 60% high-fat feed for 2 months until the average weight of mice reaches 35g;

[0050] (2) Measure the weight and body temperature of mice every day.

[0051] Example 3: Plasmid injection

[0052] (1) HFD mice were divided into two groups. One group was injected with a negative control plasmid (CMV-ScrR) as the control group; the other group was injected with the constructed plasmid (CMV-RVG-Sir A ), as the treatment group;

[0053] (2) By Figure 6 It can be seen that during the treatment period, the weight of mice decreased significantly; Figure 7 It can be seen that the body temperature of the BAT area of ​​the mice in the treatment group was higher than that in the control group; Figure 8 Here are the daily BAT area temperatures during the treatment period, and I have seen a significant statistical difference between the treatment and control groups.

[0054] Example 4: Mouse Experiment

[0055] (1) After 20 days of treatment, a GTT experiment was performed. The mice were fasted for 16 hours, and their blood glucose was measured as the starting blood glucose value. A glucose solution with a concentration of 2 g / kg was intraperitoneally injected, and the blood glucose values ​​were measured 15, 30, 60, and 90 minutes after the injection. Fig. 9 It can be seen that the diabetic condition of HFD mice improved after treatment;

[0056] (2) After 30 days of treatment, the mice were perfused with 1xPBS and 4% PFA, and the liver, brain, and adipose tissue were removed. RNA from the hypothalamus (VMH) and liver was extracted and qPCR was performed. Fig.10 , Fig.11 It can be seen that the AMPKα-mRNA levels in the liver and hypothalamus are decreased;

[0057] (3) Extract protein from mouse hypothalamus tissue and perform Western blot. Fig.12 It can be seen that the synthesis of AMPK in the hypothalamus of HFD mice in the treatment group was inhibited;

[0058] (4) RNA was extracted from brown adipose tissue (BAT) and white adipose tissue (WAT) and qPCR was performed to analyze the changes in the AMPKα downstream signaling pathway. Fig.13 It can be seen that the UCP1-mRNA level in the white adipose tissue of the treated mice increased; Fig.14 It can be seen that the UCP1-mRNA level in brown adipose tissue of mice in the treatment group increased; Fig.15 It can be seen that the UCP3-mRNA level in the white adipose tissue of the treated mice increased; Fig.16 It can be seen that the UCP3-mRNA level in the brown adipose tissue of mice in the treatment group was increased.

[0059] Any numerical value mentioned in the present invention includes all values ​​that increase by one unit each time from the lowest value to the highest value if there is only an interval of two units between any minimum value and any maximum value. For example, if the amount of a component, or the value of a process variable such as temperature, pressure, time, etc. is declared to be 50-90, in this specification it means that 51-89, 52-88... and 69-71 and 70-71 are specifically listed. For non-integer values, 0.1, 0.01, 0.001 or 0.0001 can be appropriately considered as a unit. These are just some specially specified examples. In this application, in a similar manner, all possible combinations of numerical values ​​between the listed lowest and highest values ​​are considered to have been disclosed.

[0060] It should be noted that the embodiments described above are only used to explain the present invention and do not constitute any limitation to the present invention. The present invention has been described with reference to typical embodiments, but it should be understood that the words used therein are descriptive and explanatory words, rather than restrictive words. The present invention may be modified as specified within the scope of the claims of the present invention, and the present invention may be revised without departing from the scope and spirit of the present invention. Although the present invention described therein relates to specific methods, materials and embodiments, it does not mean that the present invention is limited to the specific examples disclosed therein, on the contrary, the present invention can be extended to all other methods and applications with the same functions.

Claims

1. A brain exosome targeted drug delivery system, characterized in that: The drug delivery system includes plasmid CMV-RVG-Sir A ; Among them, plasmid CMV-RVG-Sir A Including RVG-Lamp2b-ampkα-siRNA.

2. The brain exosome targeted drug delivery system according to claim 1, characterized in that: The plasmid CMV-RVG-Sir A The preparation method comprises the following steps: The Lamp2b-GFP-siRNA gene sequence on the plasmid CMV-GFP-siRNA was replaced with the RVG-Lamp2b-ampkα-siRNA gene sequence; thus, the plasmid CMV-RVG-Sir A ; The base sequence of the Lamp2b-GFP-siRNA gene is shown in SEQ ID No.

1. The base sequence of the RVG-Lamp2b-ampkα-siRNA gene is shown in SEQ ID No.

2.

3. A drug targeting brain exosomes, characterized in that: The brain exosome targeted drug delivery system according to claim 1 or 2 is used.

4. The drug according to claim 3, characterized in that Administration was via tail vein injection.

5. The drug according to claim 4, characterized in that The injection dose is 1-5 mg / kg according to the mouse body weight, and the injection is once every 1-3 days.

6. A drug for treating obesity, characterized in that: The brain exosome targeted drug delivery system according to claim 1 or 2 is used.

7. The drug according to claim 6, characterized in that Administration was via tail vein injection.

8. The drug according to claim 7, characterized in that The injection volume is 1.5-2.5 mg / kg according to the weight of the mouse, and the injection is once every 1-3 days.

9. Plasmid CMV-RVG-Sir A Application in the preparation of drugs targeting brain exosomes.

10. Plasmid CMV-RVG-Sir A Application in the preparation of drugs for treating obesity.

Images