Microfluidic chip for microbiological detection

Abstract

The invention discloses a micro-fluidic chip for microbiological detection. The micro-fluidic chip comprises a raw material pumping channel; the pressing chamber is used for providing variable air pressure in the raw material pumping channel; the raw material chamber is used for storing reaction raw materials; the check valve comprises a temporary storage chamber and a microsphere; the temporary storage cavity is formed in one side of the raw material pumping channel in the fluid movement direction. The raw material pumping mechanism provided by the invention is combined with a pneumatic-driven one-way check valve and a pressure-driven pressing chamber to realize accurate control of one-way pumping of fluid, so that the sensitivity and stability of a micro-fluidic chip can be ensured, and the situation that the acting force of a magnetic field on a magnetic bead-nucleic acid compound is weakened due to liquid backflow, so that magnetic beads are lost, and the service life of the micro-fluidic chip is prolonged is avoided. The nucleic acid recovery efficiency is reduced.

Description

Technical Field

[0001] The present application relates to the technical field of microfluidic chips, and in particular to a microfluidic chip for microbial detection. Background Art

[0002] At present, traditional methods for detecting foodborne pathogens include: plate count method, enzyme-linked immunosorbent assay method and polymerase chain reaction method. The plate count method achieves the quantification of target bacteria by counting the number of colonies. This method is accurate and reliable, but requires a long culture time; the enzyme-linked immunosorbent assay method uses enzyme-labeled antibodies to label target bacteria and catalyze the change of substrate-product signals to achieve the quantification of target bacteria. This method has high throughput and good specificity, but is prone to cross-contamination; the polymerase chain reaction method uses DNA polymerase to achieve large-scale replication of templates. This method has high sensitivity, but is prone to false positives due to aerosol contamination and is highly dependent on laboratory equipment. These problems limit the application of such traditional methods in on-site detection and remote areas. Therefore, more and more researchers are committed to developing portable, rapid, sensitive and stable detection methods to achieve quantitative detection of foodborne pathogens.

[0003] The manufacturing process of microfluidic chips is simple, and the functional components can be integrated. Multiple steps such as sampling, enrichment, cleaning and detection can be integrated. Currently, a variety of chips have been developed, combined with molecular biology to achieve target bacteria detection. The common chip power supply method is the injection pump, but the equipment is bulky and difficult to integrate; the current new chips that do not require an external power source include: finger pressure microfluidic chips, gravity-driven microfluidic chips, and capillary force-driven microfluidic chips. However, the above-mentioned microfluidic chips have poor sensitivity and stability during adjustment, and the recovery rate of nucleic acid molecules is low. Summary of the invention

[0004] The present application aims to solve at least one of the technical problems existing in the prior art. To this end, the present application proposes a microfluidic chip for microorganism detection with a high recovery rate.

[0005] In a first aspect of the present application, a microfluidic chip is provided, wherein the microfluidic chip comprises at least one raw material pumping mechanism, wherein the raw material pumping mechanism comprises:

[0006] Raw material pumping channel;

[0007] A pressing chamber, the pressing chamber is located upstream of the raw material pumping channel along the fluid movement direction, and the pressing chamber is used to provide a changing air pressure in the raw material pumping channel;

[0008] A raw material chamber, the raw material chamber is located on the raw material pumping channel and downstream of the pressing chamber, and the raw material chamber is used to store reaction raw materials;

[0009] A check valve is located on the raw material pumping channel at the downstream of the raw material chamber, and the check valve includes a temporary storage chamber and a microball; the temporary storage chamber is opened on one side of the raw material pumping channel along the direction of fluid movement; the size of the microball is configured to be able to move from the raw material pumping channel into the temporary storage chamber after the press chamber applies a set pressure to open the raw material pumping channel, and to move from the temporary storage chamber into the raw material pumping channel under the action of gravity after the press chamber removes the pressure to close the raw material pumping channel.

[0010] The microfluidic chip according to the embodiment of the present application has at least the following beneficial effects:

[0011] The raw material pumping mechanism provided in the present application combines a one-way check valve driven by air pressure and a pressure-driven pressing chamber to achieve precise control of one-way pumping of the fluid, thereby ensuring the sensitivity and stability of the microfluidic chip, and preventing liquid reflux from weakening the force of the magnetic field on the magnetic bead-nucleic acid complex, resulting in the loss of magnetic beads and reducing the recovery efficiency of nucleic acids.

[0012] In some embodiments of the present application, the temporary storage chamber is cylindrical, and the diameter of the temporary storage chamber is within 0.2 mm smaller than the diameter of the microsphere.

[0013] In some embodiments of the present application, the diameter of the temporary storage chamber and the raw material pumping channel is 1.4-1.6 mm, the diameter of the microsphere is 1.5-1.7 mm, and the diameter of the microsphere is 0.05-0.15 mm larger than the diameter of the temporary storage chamber and the raw material pumping channel.

[0014] In some embodiments of the present application, the microspheres are metal microspheres.

[0015] In some embodiments of the present application, the microfluidic chip further comprises a reaction mechanism connected to the raw material pumping mechanism, and the reaction mechanism comprises:

[0016] an incubation channel, the incubation channel being connected to the raw material pumping channel;

[0017] The magnetic field generating component is located on one side of the incubation channel. The magnetic field generating component includes a plurality of magnets arranged in parallel. The magnetic poles of adjacent magnets are in opposite directions and are separated by a spacer. A sawtooth structure is provided on the side of the spacer facing the incubation channel.

[0018] In some embodiments of the present application, the number of magnets is 3 to 10.

[0019] In some embodiments of the present application, the incubation channel is a reverse-folded serpentine tube.

[0020] In some embodiments of the present application, the microfluidic chip further includes a detection mechanism, which includes a detection chamber and a detection pipeline, one end of the detection pipeline is connected to the incubation channel, and the other end of the detection pipeline is connected to the detection chamber.

[0021] In some embodiments of the present application, the microfluidic chip further includes a waste liquid chamber, and a rotary valve is provided on the inspection pipeline, and the rotary valve is used to regulate the fluid in the inspection pipeline to enter the waste liquid chamber or the detection chamber.

[0022] In some embodiments of the present application, the microfluidic chip includes three raw material pumping mechanisms, and the raw material chambers in the three raw material pumping mechanisms are used to store a lysis solution, a washing solution, and an elution solution, respectively.

[0023] The second aspect of the present application provides an application of the aforementioned microfluidic chip in the preparation of a microbial detection product.

[0024] The third aspect of the present application provides a method for detecting microorganisms for non-disease diagnosis purposes, which comprises using any of the aforementioned microfluidic chips.

[0025] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become apparent from the description below, or will be learned through the practice of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a schematic diagram of the structure and working principle of a check valve in one embodiment of the present application.

[0027] Figure 2 It is a schematic structural diagram of a magnetic field generating component in one embodiment of the present application.

[0028] Figure 3 Schematic diagram of the structure of a rotary valve in one embodiment of the present application.

[0029] Figure 4 It is a schematic plan view of a rotary valve in one embodiment of the present application.

[0030] Figure 5 It is a schematic diagram of the structure of a microfluidic chip in one embodiment of the present application.

[0031] Figure 6 It is a diagram of the detection steps of a microfluidic biosensor in one embodiment of the present application.

[0032] Figure 7 The following is the optimization comparison result of the iron microspheres in the check valve at different diameters in one embodiment of the present application, wherein A is the relationship between the diameter of the iron microspheres and the backflow distance, and B is the specific result shown in A.

[0033] Figure 8This is the optimization comparison result of the pressing intensity and pressing time in the microfluidic chip in one embodiment of the present application. Among them, A is the comparison result of the pressing intensity, the upper end (yellow) part is the distance of fluid reflux, and the lower end (blue-green) part is the pumping distance after the fluid refluxes and stabilizes, that is, the actual pumping distance. The red line marked part in (B) is the distance of fluid reflux.

[0034] Fig. 9 This is the result of the verification of the effect of fixing magnetic beads in a high gradient magnetic field and the nucleic acid recovery efficiency in one embodiment of the present application. Among them, A is the brightness change of nucleic acid after magnetic bead washing, B is the effect of incubation time on nucleic acid recovery rate, and C is the comparison of nucleic acid recovery rate with different magnets.

[0035] Fig.10 It is the optimization result of the cleavage mode and amplification conditions in one embodiment of the present application. Among them, A is the comparison result of different cleavage modes, B is the optimization comparison result of different cleavage temperatures, C is the optimization comparison result of different amplification temperatures, D is the optimization comparison result of different amplification times and primer amounts, and E is the optimization comparison result of different probe amounts.

[0036] Fig.11 It is the performance evaluation result of the biosensor in one embodiment of the present application. Among them, A and B are the detection results of Salmonella typhimurium at different concentration gradients and the fitted linear regression curves, C and D are the detection results of Listeria monocytogenes at different concentration gradients and the fitted linear regression curves, and E and F are the detection results of Escherichia coli O157:H7 at different concentration gradients and the fitted linear regression curves.

[0037] Fig.12 It is the simulation result of the high gradient magnetic field and the permanent magnet in one embodiment of the present application. Among them, A is the simulation result of the two by FEMM software, and B and C are the change trends of the magnetic field intensity at the incubation channel position above the magnet of the high gradient magnetic field and the permanent magnet respectively.

[0038] Reference numerals: first pressing chamber 111, second pressing chamber 112, third pressing chamber 113, first raw material chamber 121, second raw material chamber 122, third raw material chamber 123, microsphere 130a, temporary storage chamber 130b, first check valve 131, second check valve 132, third check valve 133, incubation channel 140, rotary valve 150, protrusion 151, waste liquid chamber 160, first template chamber 171, second template chamber 172, third template chamber 173 3. Fourth template chamber 174, fifth template chamber 175, first detection chamber 181, second detection chamber 182, third detection chamber 183, fourth detection chamber 184, fifth detection chamber 185, air hole 190, magnetic field generating assembly 200, first magnet 211, second magnet 212, third magnet 213, fourth magnet 214, fifth magnet 215, first spacer 221, second spacer 222, third spacer 223, fourth spacer 224. DETAILED DESCRIPTION

[0039] The following will clearly and completely describe the concept of the present application and the technical effects produced in combination with the embodiments, so as to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of them. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present application.

[0040] The embodiments of the present application are described in detail below. The described embodiments are exemplary and are only used to explain the present application, and should not be understood as limiting the present application.

[0041] In the description of this application, "several" means more than one, "more" means more than two, "greater than", "less than", "exceed", etc. are understood to exclude the number itself, and "above", "below", "within", etc. are understood to include the number itself. If there is a description of "first" or "second", it is only used for the purpose of distinguishing technical features, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features or implicitly indicating the order of the indicated technical features.

[0042] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein are only for the purpose of describing the embodiments of this application and are not intended to limit this application.

[0043] In the description of the present application, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials, or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described may be combined in any one or more embodiments or examples in a suitable manner.

[0044] In a first aspect of the present application, a microfluidic chip is provided, the microfluidic chip comprising at least one raw material pumping mechanism, the raw material pumping mechanism comprising a raw material pumping channel, a pressing chamber, a raw material chamber and a check valve.

[0045] The pressing chamber is located upstream of the raw material pumping channel along the direction of fluid movement, and is used to provide a changing air pressure in the raw material pumping channel, thereby driving the fluid in the channel to move along the direction of movement. Specifically, the pressure change caused by the changing air pressure drives the raw material solution in the raw material pumping channel to flow along the direction of fluid movement, and further refers to the reaction of the raw material chamber continuing to move downstream through the check valve. The pressing chamber specifically includes a cavity and a pressing surface that covers the surface of the cavity and can undergo elastic deformation. By pressing the pressing surface, the volume of the air stored in the cavity changes, and then enters the raw material pumping channel under the action of pressure. The material of the pressing surface can be any organic material known in the art that can undergo elastic deformation, such as elastomer (such as at least one of SBS, SEBS, TPV, TPU, EVA, POE, TPO, etc.), rubber (such as at least one of natural rubber, styrene-butadiene rubber, butadiene rubber, chloroprene rubber, nitrile rubber, hydrogenated nitrile rubber, EPDM rubber, silicone rubber, fluororubber, butyl rubber, polysulfide rubber, polyacrylate rubber, etc.), fluorinated ethylene-propylene copolymer, polyvinyl chloride, etc. In some embodiments, the pressing surface of the pressing chamber is provided with an opening, and when the pressing force is released, the gas can enter from the opening by using the internal negative pressure.

[0046] The raw material chamber is located on the raw material pumping channel and downstream of the pressing chamber, and the raw material chamber is used for storing reaction raw materials.

[0047] refer to Figure 1, shows a check valve in an embodiment of the present application, the check valve is located on the raw material pumping channel downstream of the raw material chamber, and the check valve includes a temporary storage chamber 130b and a microsphere 130a. The temporary storage chamber 130b is opened on one side of the raw material pumping channel 100 along the fluid movement direction, specifically, the temporary storage chamber 130b has an open end and a closed end, and the angle between the open end and the closed end and the fluid movement direction is an acute angle, that is, 0<α<90°. In some embodiments, α is 1°, 2°, 3°, 4°, 5°, 6°, 7°, 8°, 9°, 10°, 15°, 20°, 25°, 30°, 35°, 40°, 45°, 50°, 55°, 60°, 65°, 70°, 75°, 80°, 81°, 82°, 83°, 84°, 85°, 86°, 87°, 88°, 89°. In some embodiments, α≤60°. In some embodiments, α≥10°. In some embodiments, 10°≤α≤60°. In some embodiments, the temporary storage chamber 130b is cylindrical. The size of the microball 130a is configured so that after the pressing chamber applies a set pressure, the microball 130a can move from the raw material pumping channel into the temporary chamber 130b to open the raw material pumping channel, and can move from the temporary chamber 130b into the raw material pumping channel under the action of gravity to close the raw material pumping channel after the pressing chamber removes the pressure. Among them, moving into the temporary storage chamber 130b can be that part of the microsphere 130a enters the temporary storage chamber 130b or the microsphere 130a enters the temporary storage chamber 130b as a whole, thereby opening 1% to 100% of the channel height in the raw material pumping channel 100, for example, it can be 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of the channel height. The percentage of the open channel height is the percentage of the distance h1 between the highest position reached by the microsphere 130a under pressure and the bottom of the raw material pumping channel and the height h2 of the raw material pumping channel near the check valve (if it exceeds 100%, it will be calculated as 100%).

[0048] In some embodiments, the diameter d2 of the microsphere is larger than the diameter d1 of the temporary storage chamber 130b. In some embodiments, the diameter d2 of the microsphere is larger than the diameter d1 of the temporary storage chamber 130b by 5mm, 4mm, 3mm, 2mm, 1mm, 0.9mm, 0.8mm, 0.7mm, 0.6mm, 0.5mm, 0.4mm, 0.3mm, 0.2mm, 0.19mm, 0.18mm, 0.17mm, 0.16mm, 0.15mm, 0.14mm, 0.13mm, 0.12mm, 0.11mm, 0.1mm, 0.09mm, 0.08mm, 0.07mm, 0.06mm, 0.05mm, 0.04mm, 0.03mm, 0.02mm, 0.01mm. In some embodiments, the density of the microsphere is greater than 1g / cm 3 , 2g / cm 3 , 3g / cm 3 , 4g / cm 3 , 5g / cm 3 , 6g / cm 3 , 7g / cm 3 , 8g / cm 3 , 9g / cm 3 、10g / cm 3 . In some embodiments, the material of the microspheres is at least one of an organic material and an inorganic material. In some embodiments, the microspheres are metal microspheres. In some embodiments, the microspheres are iron microspheres. It is understood that metal microspheres or iron microspheres are not limited to microspheres that do not contain other materials. For example, other materials may be doped, modified, or coated on the surface or inside. Specifically, the performance of the microspheres, such as corrosion resistance, may be improved by coating the surface of the microspheres.

[0049] By pressing the pressing chamber (for example, with a finger), the internal air pressure increases and drives the liquid to flow forward, thereby causing the microsphere 130a in the corresponding check valve to rise, the raw material pumping channel is opened, and the fluid can pass through the check valve; when the pressure of the pressing chamber is released, the internal air pressure decreases, and the negative pressure in the channel attracts gas to enter from the opening of the pressing chamber, and the microsphere 130a in the check valve falls back to its original position due to gravity, thereby preventing the liquid from flowing back.

[0050] In some embodiments, the diameters of the temporary storage chamber and the raw material pumping channel are independently 1 to 2 mm, for example, 1 mm, 1.1 mm, 1.2 mm, 1.3 mm, 1.4 mm, 1.5 mm, 1.6 mm, 1.7 mm, 1.8 mm, 1.9 mm, 2 mm. In some embodiments, the diameters of the temporary storage chamber and the raw material pumping channel are independently 1.4 to 1.6 mm. In some embodiments, the diameters of the temporary storage chamber and the raw material pumping channel are the same.

[0051] In some embodiments, the diameter of the microsphere is 1 to 2 mm, for example, 1 mm, 1.1 mm, 1.2 mm, 1.3 mm, 1.4 mm, 1.5 mm, 1.6 mm, 1.7 mm, 1.8 mm, 1.9 mm, 2 mm. 1.5 to 1.7 mm, in some embodiments, the diameter of the microsphere is 1.5 to 1.7 mm. In some embodiments, the diameter of the microsphere is 0.05 to 0.15 mm larger than the diameter of the temporary storage chamber and the raw material pumping channel, respectively.

[0052] In some embodiments, the microfluidic chip further comprises a reaction mechanism connected to the raw material pumping mechanism, Figure 5 The reaction mechanism includes an incubation channel 140, which is connected to the raw material pumping channel. The raw material is transported to the incubation channel 140 through the raw material pumping channel for incubation.

[0053] In some embodiments, the reaction mechanism is further provided with a magnetic field generating component 200, and the magnetic field generating component 200 is located on one side of the incubation channel 140. Figure 2 , the magnetic field generating assembly 200 includes a plurality of magnets arranged in parallel, the magnetic poles of adjacent magnets are in opposite directions and are separated by a spacer, and a sawtooth structure is provided on the side of the spacer facing the incubation channel. For example, the first magnet 211 and the second magnet 212 are separated by a first spacer 221. In some embodiments, the sawtooth structure has sawtooths arranged along the length direction of the magnet, for example, they may be evenly distributed along the length direction of the magnet. In some embodiments, the magnet has two magnetic poles arranged relative to each other in the thickness direction perpendicular to the length direction. Such staggered arrangement of mutually repelling magnets and sawtooths can form a high gradient magnetic field, which leads to the gathering of magnetic lines of force and then controls the effective fixation of the magnetic beads, thereby achieving effective recovery of DNA and ensuring the sensitivity of the biosensor.

[0054] In some embodiments, the number of magnets in the magnetic field generating assembly is 3 to 10, for example, 3, 4, 5, 6, 7, 8, 9, or 10.

[0055] In some embodiments, the incubation channel is a reverse-folded serpentine tube.

[0056] In some embodiments, the microfluidic chip further includes a detection mechanism, which includes a detection chamber and a test pipe, one end of which is connected to the incubation channel, and the other end of which is connected to the detection chamber. In some embodiments, a template chamber is also provided on the test pipe, and a test chamber is connected downstream of the template chamber. The template solution required for the reaction enters the template chamber through the test pipe in advance for quantification, and the quantified template solution enters the test chamber from the template chamber through the test pipe for reaction and detection.

[0057] In some embodiments, reference Figure 5 The detection chamber includes a first detection chamber 181, and the template chamber includes a first template chamber 171. The first template chamber 171 and the first detection chamber 181 are connected through a test delivery pipe, and are connected to the incubation channel 140 through the test delivery pipe. In some embodiments, an air hole 190 is further provided on the other side of the template chamber relative to the side connected to the detection chamber.

[0058] In some embodiments, the microfluidic chip further includes a waste liquid chamber 160, and a rotary valve 150 is provided on the inspection pipeline, and the rotary valve 150 is used to regulate the fluid in the inspection pipeline to enter the waste liquid chamber 160 or the detection chamber. Figure 3 and Figure 4 In some embodiments, the rotary valve 150 includes a main body and a protrusion 151 at one end of the main body. There are multiple protrusions 151, and the protrusions 151 include open protrusions and closed protrusions. An open protrusion can be connected to another open protrusion through a channel inside the main body, so that the inspection pipeline is in a conducting state when it contacts it; the closed protrusion is not connected to the channel inside the main body, so that when the inspection pipeline contacts this type of protrusion, the pipeline is in a disconnected state, which ultimately plays a role in regulating the flow direction of the fluid.

[0059] In some embodiments, the microfluidic chip includes three raw material pumping mechanisms, referring to Figure 5 The first raw material pumping mechanism includes a first pressing chamber 111, a first raw material chamber 121 and a first check valve 131, the second raw material pumping mechanism includes a second pressing chamber 112, a second raw material chamber 122 and a second check valve 132, and the third raw material pumping mechanism includes a third pressing chamber 113, a third raw material chamber 123 and a third check valve 133. The first raw material chamber 121, the second raw material chamber 122 and the third raw material chamber 123 are used to store a lysate, a washing solution and an eluent, respectively.

[0060] In some embodiments, the magnetic field generating assembly 200 includes a first magnet 211, a second magnet 212, a third magnet 213, a fourth magnet 214, and a fifth magnet 215 arranged in parallel, and the magnetic poles of adjacent magnets are opposite and are separated by a first spacer 221, a second spacer 222, a third spacer 223, and a fourth spacer 224, respectively. The first spacer 221, the second spacer 222, the third spacer 223, and the fourth spacer 224 are provided with a sawtooth structure on one side facing the incubation channel 140. In some embodiments, each spacer and the sawtooth structure thereon are magnetically conductive materials, specifically, iron-based materials, such as Fe2O3. In some embodiments, the bottom width of a single sawtooth is 0.5 to 2 mm. In some embodiments, the height of a single sawtooth is 0.5 to 2 mm. In some embodiments, the mutually repelling magnets and one or more spacers of the device are assembled together by a 3D printing fixture.

[0061] In some embodiments, the detection mechanism includes a plurality of template chambers and a plurality of detection chambers. In some embodiments, the detection mechanism includes a first template chamber 171, a second template chamber 172, a third template chamber 173, a fourth template chamber 174, a fifth template chamber 175, and a first detection chamber 181, a second detection chamber 182, a third detection chamber 183, a fourth detection chamber 184, and a fifth detection chamber 185.

[0062] The second aspect of the present application provides the use of the above-mentioned microfluidic chip in the preparation of a microbial detection product. The present application also relates to a microbial detection product, which includes the above-mentioned microfluidic chip.

[0063] The third aspect of the present application provides a method for detecting microorganisms for non-disease diagnosis purposes, which comprises using any of the aforementioned microfluidic chips.

[0064] In some embodiments, the detection method includes injecting a sample, magnetic beads, and a lysis solution into a lysis solution chamber, injecting a washing solution into a washing solution chamber, injecting an eluent into an eluent chamber, standing for a period of time for lysis, pressing the first pressing chamber to pump the sample mixture in the first raw material chamber to an incubation channel, incubating for a period of time, allowing the magnetic field generating component to fix the magnetic bead-DNA complex in the incubation channel, and discharging the waste liquid into the waste liquid chamber; pressing the second pressing chamber to pump the washing solution to the incubation channel, and discharging the washing solution to the waste liquid chamber after incubation for a period of time; pressing the third pressing chamber to pump the eluent to the incubation channel, and after incubation for a period of time, pumping the eluent to the template chamber of the detection mechanism, and then pumping a set volume of the eluent containing the DNA sample from the template chamber to the detection chamber for mixing, causing an amplification reaction, and detecting the amplification product.

[0065] The present application is described below in conjunction with specific embodiments.

[0066] Example 1

[0067] This embodiment provides a sensor, which mainly relates to a microfluidic chip, as follows:

[0068] The overall structure of the microfluidic chip (length 87mm, width 57mm, height / thickness 7mm) is formed by bonding the upper and lower chips after plasma bombardment (the upper and lower chips are both 3.5mm thick). Figure 1 and Figure 5 The length and width described in the size are the length direction and width direction in the figure, and the height (or thickness) is the direction of the plane perpendicular to the length direction and width direction.

[0069] The upper chip includes all functional structures and fluid channels. All structures are connected by straight channels (width 1mm; height 1mm). The specific structure is as follows:

[0070] The first pressing chamber 111, the second pressing chamber 112, and the third pressing chamber 113 (all of which have a diameter of 12.4 mm and a height of 2 mm) are used to be pressed by fingers to form a changing air pressure inside, thereby providing power. In addition, air inlet holes (with a diameter of 1 mm) are opened on the surfaces of the three pressing chambers as air inlets.

[0071] The first raw material chamber 121, the second raw material chamber 122, and the third raw material chamber 123 are three diamond-shaped chambers, which are used to store lysis solution, washing solution and eluent respectively, and thus can also be called a lysis solution chamber (length 14.68mm, width 10mm, height 3mm), a washing solution chamber (length 14.68mm, width 10mm, height 2mm) and an eluent chamber (length 10mm, width 6mm, height 1mm).

[0072] The first raw material chamber 121, the second raw material chamber 122, and the third raw material chamber 123 are connected to the first check valve 131, the second check valve 132, and the third check valve 133 at their downstream. The three check valves have the same structure, which is a pneumatic one-way valve composed of a small iron ball 130a (diameter 1.7mm). A nearly cylindrical temporary storage chamber 130b (diameter 1.6mm; inclined angle 45°) is designed above the small iron ball to complete the movement of the iron ball caused by the change in air pressure, thereby realizing one-way pumping of the fluid.

[0073] The incubation channel 140 is a serpentine reverse folded structure (the total length of the folded part after stretching is 33 mm; the width is 1 mm; the height is 1 mm). The incubation channel 140 is used to pre-embed silicon-based magnetic beads to achieve extraction and purification of nucleic acids through electrostatic adsorption.

[0074] In addition, a cylindrical hole (4.8mm in diameter) is provided on the upper chip, which runs through the upper chip. This cylindrical hole is used to combine the 3D printed rotary valve 150. The main body of the rotary valve 150 is cylindrical, with a diameter of 5.1mm and a height of 9.9mm. Four protrusions 151 are provided at one end, and the adjacent protrusions 151 are perpendicular to the center of the circle on the cross section perpendicular to the axial direction. The overall shape and size of the outside of the protrusion 151 are consistent, the protrusion length is 3mm, the protrusion width is 3mm, and the protrusion height is 0.45mm. The connecting hole diameter is 1mm. The four protrusions 151 are of two different types: solid "break" and hollow "pass" connected to the inside of other protrusions 151. The four protrusions 151 are respectively connected to different positions of the pipeline to achieve flexible selection of the flow path.

[0075] The waste liquid chamber 160 is a cylindrical chamber (12 mm in diameter and 3.5 mm in height) and is connected to an outlet of a flow path of the rotary valve 150 .

[0076] The first template chamber 171, the second template chamber 172, the third template chamber 173, the fourth template chamber 174, and the fifth template chamber 175 are five diamond-shaped chambers of the same size (length 6mm, width 3mm, height 1mm), which are used as temporary storage chambers for templates. The first detection chamber 181, the second detection chamber 182, the third detection chamber 183, the fourth detection chamber 184, and the fifth detection chamber 185 are five cylindrical chambers of the same size (diameter 5mm, height 2.6mm), which are used as RAA reaction chambers.

[0077] The lower chip has a groove (length 34mm, width 18mm, height 2.5mm) to accommodate the magnetic field generating assembly to achieve effective fixation of magnetic beads. The magnetic field generating assembly 200 includes a first magnet 211, a second magnet 212, a third magnet 213, a fourth magnet 214, and a fifth magnet 215. These five magnets are consistent in size (length 30mm, width 4mm, thickness 2mm), and are all composed of N poles and S poles, but the N poles of adjacent magnets are relative to N poles, and the S poles are relative to S poles, so that these five magnets repel each other. Moreover, the first spacer 221, the second spacer 222, the third spacer 223, and the fourth spacer 224 are sequentially arranged between adjacent magnets in the five magnets, and the four spacers are consistent in size (length 30mm, width 4mm, thickness 1mm), and have a consistent sawtooth structure on one side (towards the incubation channel 140 during subsequent compounding). Each spacer and the sawtooth structure thereon are made of magnetic iron-based material. The bottom of a single sawtooth is 1mm wide and 1mm high. The mutually repelling magnets and one or more spacers of the device are assembled together through a 3D printing fixture.

[0078] In addition to the above-mentioned microfluidic chip, the sensor is also provided with a bracket (length 90mm, width 60mm, height 7mm), on which a platform (length 87mm, width 57mm, height 2mm) is provided, and the platform is used to install the above-mentioned microfluidic chip. The platform is also provided with a groove (length 30.1mm, width 14.1mm, height 3.5mm), and the groove is used to accommodate the magnetic field generating component 200 of the microfluidic chip.

[0079] Among them, precise control of fluid pumping plays an important role in ensuring the sensitivity and stability of the biosensor. Liquid reflux will weaken the force of the magnetic field on the magnetic bead-nucleic acid complex, resulting in the loss of magnetic beads, thereby reducing the recovery efficiency of nucleic acids. In this embodiment, a pneumatically driven check valve and a finger-driven pressing chamber are combined to achieve unidirectional pumping of the fluid, such as Figure 1 As shown, the check valve is composed of a microball 130a and a temporary storage chamber 130b, wherein the temporary storage chamber 130b is cylindrical and the microball 130a is an iron ball. When a pressing chamber is pressed by a finger, the internal air pressure increases and drives the liquid to flow forward, thereby causing the microball 130a in the corresponding check valve to rise, the channel is opened, and the fluid can pass through the check valve; when the finger releases the pressing chamber, the internal air pressure decreases, and the negative pressure in the channel attracts the gas to enter from the opening of the pressing chamber, and the microball 130a in the check valve falls back to its original position by gravity, thereby preventing the liquid from flowing back.

[0080] Example 2

[0081] This embodiment uses the microfluidic chip of Example 1 to detect multiple bacteria. The detection process involves a fluorescence signal acquisition device (length 120 mm, width 80 mm, height 112 mm), which is equipped with a bracket for holding a high-gradient magnetic field and a microfluidic chip, as well as an LED light strip (excitation wavelength 470 nm) and an amber cutoff filter (510 nm) for exciting and observing fluorescence signals.

[0082] The target bacteria and non-target bacteria used for detection in this embodiment include Salmonella typhimurium (ATCC 14028), Escherichia coli O157:H7 (ATCC 43888), Listeria monocytogenes (ATCC 13932), Bacillus cereus (ATCC 11778) and Staphylococcus aureus (ATCC 25923). All strains were stored at -80°C.

[0083] Take 50 μL of bacterial solution and place it in 5 mL of LB broth for 16 hours (37°C, 180 rpm). After the culture is completed, take 50 μL and dilute it to 10 6 The bacteria were then spread on LB plate culture medium and the colonies were counted after 16 hours of culture to calculate the original bacterial concentration.

[0084] The inv A gene of ATCC 14028, the flic gene of ATCC 43888, and the hly A gene of ATCC 13932 were selected as target genes. The specific primers were designed and screened using PrimerPremier 5 software, the specificity of the primers was verified using Primer-blast software, and the specific fluorescent probes were designed for the amplified sequences using SnapGene software. All nucleic acid sequences were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0085] The final primer and probe sequences are as follows:

[0086] inv AF:ATTGGCGATAGCCTGGCGGTGGGTTTTGTTGT(SEQ ID NO.1);

[0087] inv AR: TACCGGGCATACCATCCAGAGAAAATCGGGCCGC (SEQ ID NO. 2);

[0088] inv Aprobe:CTCTATTGTCACCGTGGTCCAGTTTATCG(FAM-dT)T(THF)T(BHQI-dT)ACCAAAGGTTCAG[C3-spacer](SEQ ID NO.3);

[0089] hly AF: AAAATTTGGTACTGCATTTAAAGCTGTA (SEQ ID NO.4);

[0090] hly AR: AAATCTGGAAGGTCTTGTAGGTTCAT (SEQ ID NO.5);

[0091] hly Aprobe:AATCAGTGAAGGGAAAATGCAAGAAGAAG(FAM-dT)C(THF)T(BHQ1-dT)AGTTTTAAACAAATTT[C3-spacer](SEQ ID NO.6);

[0092] flic F: TGCAGGCAACTTGACGACTAACAACGCTGGTAG (SEQ ID NO. 7);

[0093] flic R: TTAACGGAGCTACTGGAGAGGTTGTCGCAGG (SEQ ID NO. 8);

[0094] flic probe: AGCGAAGGTAGTGACGGTGCTTCTCTGACAT(FAM-dT)C(THF)A(BHQl-dT)GGCACTGAATATAC[C3-spacer](SEQ ID NO.9).

[0095] The specific experimental process is as follows, refer to Figure 6 , and combined with Figure 5 :

[0096] (1) Clean the microfluidic chip with alcohol (75%, v / v) and then rinse it with ultrapure water three times.

[0097] (2) The mixed solution (including 185 μL sample, 15 μL silica-based magnetic beads and 20 μL lysis solution), 150 μL washing solution and 30 μL elution solution are respectively injected into the first raw material chamber 121, the second raw material chamber 122 and the third raw material chamber 123, and the RAA premix (50 μL system) is respectively injected into the first detection chamber 181, the second detection chamber 182, the third detection chamber 183, the fourth detection chamber 184, and the fifth detection chamber 185.

[0098] (3) Let stand for 5 minutes to allow bacteria to lyse.

[0099] (4) The lysed sample in the first raw material chamber 121 is pumped into the incubation channel 140 of the DNA purification area by pressing the first pressing chamber 111, and allowed to stand for 2 minutes so that the silica-based magnetic bead-DNA complex is fixed in the incubation channel 140 by the magnetic field generating component 200, and the rotary valve 150 is adjusted to pump the waste liquid after the reaction into the waste liquid chamber 160 by pressing the first pressing chamber 111.

[0100] (5) The washing liquid in the second raw material chamber 122 is pumped into the incubation channel 140 of the DNA purification area by pressing the second pressing chamber 112, and allowed to stand for 3 minutes. Then, the washing liquid is pumped into the waste liquid chamber 160 by pressing the second pressing chamber 112 to remove impurities in the reaction system.

[0101] (6) By pressing the third pressing chamber 113, the eluent in the third raw material chamber 123 is pumped into the incubation channel 140 of the DNA purification area, and allowed to stand for 10 minutes to elute the DNA bound to the surface of the magnetic beads into the eluent.

[0102] (7) The rotary valve 150 is adjusted to pump the eluent evenly to the third template chamber 173 , the fourth template chamber 174 , and the fifth template chamber 175 in the detection area by pressing the third pressing chamber 113 .

[0103] (8) Tilt the chip to allow the eluent to flow from the template chamber into the corresponding detection chamber to achieve mixing of the DNA and RAA premix.

[0104] (9) Turn on the heating module and precisely control the RAA reaction at 39°C for 25 minutes to amplify the target DNA.

[0105] (10) Turn on the blue LED light strip (excitation wavelength: 470 nm), collect fluorescence images using a smartphone through a cutoff filter (510 nm), measure the fluorescence signal using Image J software, and construct a linear relationship between fluorescence intensity and target bacteria concentration.

[0106] Among them, the RAA reaction system is as follows:

[0107] Table 1. RAA system

[0108] Reagents Volume (μL) Liquid A 29.4 Liquid B 2.5 Upstream primer (10 μM) 2.0 Downstream primer (10 μM) 2.0 Probe (10 μM) 0.9 template 9.0 NF Water 4.2 Total volume 5.0

[0109] The template in the experimental group was the eluate containing the eluted DNA, the template in the blank control (Blank) was replaced by NF water, and the template in the positive control (Control) was provided by the kit. The volume of the template is controlled by the volume of the template chamber, and the volume of these template chambers is only 9μL. The excess liquid cannot enter the template chamber and is discharged to the waste liquid chamber. Therefore, the volume of the template that finally enters the detection chamber through tilting is fixed to 9μL.

[0110] Example 3: Investigation of the mechanism of the check valve

[0111] The diameter of the temporary storage chamber of the check valve and the size of the microballs are crucial to the effect of the check valve in preventing backflow. Referring to the above embodiment, the diameter of the raw material pumping channel and the cylindrical temporary storage chamber at the location of the control check valve are both 1.6 mm, and iron microballs with diameters of 1.5 mm, 1.6 mm, and 1.7 mm are verified. The pumping process of check valves of different sizes is photographed with a mobile phone, and the pumping and backflow conditions are recorded, so as to determine the influence of iron balls of different sizes on the sealing of the one-way valve.

[0112] The results are as follows Figure 7 It shows that the sealing effect becomes better as the diameter of the small iron ball becomes larger. A small iron ball with a diameter of 1.5 mm will cause a backflow of 5.38 mm, a small iron ball with a diameter of 1.6 mm will cause a backflow of 2.29 mm, and a small iron ball with a diameter of 1.7 mm will only cause a backflow of 0.5 mm. This has a negligible effect on fluid pumping. Therefore, this paper chooses a small iron ball with a diameter of 1.7 mm to construct a one-way check valve.

[0113] Example 4: Comparison of different pressures on preventing backflow

[0114] The effects of pressing degree and pressing time on the check valve to prevent backflow were verified. Referring to the above-mentioned embodiment, PDMS pillars of different heights were set under the pressing chamber to control the pressing degree, and a timer was used to control the pressing time. The pumping process of the check valve under different pressing conditions was filmed with a mobile phone to record its pumping and backflow conditions.

[0115] The results are as follows Figure 8 As shown, when the pressing degree is 2 / 5 of the pressing chamber height, the reflux situation is general, and the reflux distances are 3.25mm (1s), 2.81mm (2s) and 4.63mm (3s) respectively; when the pressing degree is 4 / 5 of the pressing chamber height, the reflux situation is best improved, and the reflux distances are 0.73mm (1s), 1.5mm (2s) and 4.24mm (3s) respectively; when the pressing degree is the pressing chamber height, the reflux situation is most obvious, and the reflux distances are 10.95mm (1s), 30.96mm (2s) and 49.46mm (3s) respectively.

[0116] The above results show that the longer the pressing time, the longer the fluid pumping distance, but the more obvious the reflux. This shows that in most cases, a longer pressing time will result in a longer pumping distance and actual pumping distance; but in a few cases, because the small iron ball cannot fall in time and the air cannot enter from the pores in time, the reflux will be very serious, resulting in a shorter actual pumping distance. Taking the above results into consideration, this application finally selected a pressing degree of 4 / 5 and a pressing time of 1s as the optimal pressing conditions.

[0117] Embodiment 3 and embodiment 4 optimize the diameter, pressing strength and pressing time of the iron microsphere of the one-way check valve, explore its mechanism and effect of preventing backflow, and finally realize the one-way pumping of fluid that can be precisely controlled. Compared with the existing iron ball one-way valve, the one-way check valve proposed in the embodiment of the present application combines a small iron ball with a pressing chamber, which can be well integrated into the finger-pressing microfluidic chip. Only by pressing the chamber to cause air pressure changes, the up and down movement of the small iron ball can be realized, which can prevent liquid backflow and realize liquid pumping, killing two birds with one stone. Compared with the existing thin film one-way valve, the one-way check valve only needs a double-layer PDMS structure, can be directly integrated into the chip, does not require a three-layer or even multi-layer PDMS chip, and can reduce the complexity of chip design; and the pumping volume of the one-way check valve proposed in the present application is determined by the volume of the pressing chamber, and the pumping chamber can be designed according to the experimental requirements, which greatly improves the volume of a single pumping, can save pressing time, and simplify the operation steps.

[0118] Example 5: Comparison of magnetic field fixation effects

[0119] refer to Figure 2 and Figure 5 First, silicon-based magnetic beads are introduced into the incubation channel 140 of the DNA purification area in the microfluidic chip, and then the microfluidic chip is placed above the magnetic field generating component 200, so that the incubation channel 140 and the magnetic field generating component 200 overlap in the vertical direction, thereby the silicon-based magnetic beads are fixed in the incubation channel 140 under the action of the magnetic field force. Then, ultrapure water is injected into the area, and the process is repeated three times. The brightness of the supernatant solution is measured respectively and compared with the ultrapure water and magnetic bead solution.

[0120] The results are as follows Fig. 9 As shown in A, the brightness of the supernatant obtained after different washing times is at the same level as that of ultrapure water, which is quite different from that of the magnetic bead solution. The above results show that the magnetic field can effectively fix the silica-based magnetic beads, and multiple washing steps will not cause the loss of the magnetic bead-nucleic acid complex.

[0121] Example 6: Comparison of incubation time

[0122] The incubation time of the eluate and the magnetic bead-nucleic acid complex was verified. Referring to Examples 1 and 2, the magnetic beads were first used to adsorb the lysed Salmonella typhimurium (185 μL, 10 7 CFU / mL), the mixed solution was injected into the magnetic field area for purification, and eluted with elution solution. Finally, the recovered nucleic acid concentration was measured by Nanodrop and compared with the nucleic acid concentration recovered by Tiangen kit (76ng / μL).

[0123] The results are as follows Fig. 9 As shown in Figure B, when the incubation time was 5 minutes, the DNA recovery efficiency was 33%. When the incubation time was increased to 10 minutes, the DNA recovery efficiency increased to 84%. Further increasing the incubation time did not result in higher recovery efficiency. Therefore, 10 minutes was selected as the optimal incubation time.

[0124] Example 7: Comparison of the fixing effects of different magnetic fields

[0125] Comparative Example 1: This comparative example provides a sensor, which differs from Example 1 in that a single permanent magnet of the same size is used to replace the magnetic field generating component.

[0126] Referring to Example 2 and Example 6, the nucleic acid recovery efficiency of the high gradient magnetic field in the sensor of Example 1 and the single permanent magnet in the sensor of Comparative Example 1 were compared. Fig. 9 As shown in Figure C, the high gradient magnetic field of the magnetic field generating assembly in Example 1 controls the magnetic beads to form chains, increases the contact area between the surface of the magnetic beads and the reagent, and greatly improves the recovery efficiency of nucleic acids. In Comparative Example 1, a single permanent magnet fixes the magnetic beads in a pile in the incubation channel, and only the magnetic beads on the surface can contact the reagent, so its nucleic acid recovery efficiency is low.

[0127] Compared with the ordinary single permanent magnet as the magnetic bead fixing method of the magnetic field, the high gradient magnetic field of the magnetic field generating assembly proposed in this embodiment is through the staggered arrangement of mutually repelling magnets and sawtooth. Since the magnets repel each other and the sawtooth can achieve a good magnetic conductivity effect, the magnetic flux per unit area is greatly increased, the magnetic flux density is effectively improved, and the magnetic field strength and magnetic field gradient are higher than ordinary permanent magnets. In this way, dense magnetic lines of force are formed at the tip of the sawtooth, and the magnetic beads are more likely to move along the direction of the magnetic lines of force in the magnetic field. Therefore, the magnetic field can gather the magnetic beads at the tip of the sawtooth and form a chain, increase the probability of a single magnetic bead contacting the reagent, and improve the recovery efficiency and purification efficiency of nucleic acids. Experimental results show that compared with commercial kits, this high gradient magnetic field nucleic acid recovery method can achieve a nucleic acid recovery efficiency of ~85% in a shorter time.

[0128] Example 8: Comparison of lysis conditions

[0129] Reference Example 2, using Salmonella typhimurium (100 μL, 10 7 CFU / mL) compared four common lysis methods: thermal lysis, ultrasonic lysis, lysis solution and nucleic acid release agent. Among them, thermal lysis was boiled at 75℃ for 10 minutes, ultrasonic lysis was ultrasonicated at 40kHz for 3 minutes, lysis solution was mixed at room temperature for 5 minutes (sample: lysis solution = 1:1, the main component of lysis solution is proteinase K), nucleic acid release agent was mixed at room temperature for 5 minutes (sample: nucleic acid release agent = 5:1, nucleic acid release agent is Amp Future WLD8201), 5μL of the lysed nucleic acid was taken for PCR amplification, and the nucleic acid concentration was measured using Nanodrop. The results are as follows Fig.10 As shown in A, the results show that the lysis effect of the lysis solution and the nucleic acid releaser is slightly better than that of thermal lysis and ultrasonic lysis. Since the lysis solution method can process a small sample volume and is not suitable for application in microfluidic chips, the nucleic acid releaser is selected as the lysis method in the embodiment of the present application.

[0130] The applicable temperature of the nucleic acid releaser was verified, and the nucleic acid releaser was used to lyse Salmonella typhimurium at different temperatures (185 μL, 10 7 CFU / mL), 5 μL of the lysed nucleic acid was taken for PCR amplification, and the nucleic acid concentration was measured using Nanodrop. The results were as follows Fig.10 As shown in B, the results show that the lysis effect is poor at 20°C, and the nucleic acid concentration is only 36ng / μL. When the temperature is raised to 25-35°C, the lysis effect is significantly improved, and the nucleic acid concentration is between 76 and 93ng / μL. This result shows that this lysis method can also achieve good results at room temperature (25°C), avoiding the use of a temperature controller.

[0131] Example 9: Comparison of amplification conditions

[0132] Referring to the above-mentioned Examples 2 to 8, the amplification temperature was verified, and 9 μL of Salmonella typhimurium nucleic acid template (10 6 CFU / mL), 2 μL upstream primer, 2 μL downstream primer and 0.6 μL fluorescent probe (FAM-BHQ) were used to amplify RAA at different temperatures, and the fluorescence signal intensity was measured. The results are shown in Fig.10 As shown in C, the results show that 39°C is the optimal reaction temperature.

[0133] Under the optimized conditions, different amplification times (10min, 15min, 20min, 25min, 30min) and primer amounts (1.5μL, 2.0μL, 2.5μL, 3.0μL) were further verified. The results are as follows: Fig.10As shown in D, the results show that the fluorescence intensity increases with the increase of amplification time. When the amplification time increases from 10min to 25min, the fluorescence intensity is significantly increased from 8200~12067 to 26252~49166, and longer amplification does not cause more obvious signal changes, so 25min is selected as the optimal amplification time. In addition, the fluorescence intensity increases with the increase of primer dosage. When the amplification time is 25min and the primer dosage increases from 1.5μL to 2.0μL, the fluorescence intensity is significantly increased from 26252 to 46770, and a larger amount of primers does not cause more obvious signal changes, so 2.0μL is selected as the optimal primer dosage.

[0134] Under the above optimized conditions, the dosage of fluorescent probe (0.3 μL, 0.6 μL, 0.9 μL, 1.2 μL, 1.5 μL) was verified, and the results are as follows Fig.10 As shown in E, the results show that the fluorescence intensity increases with the increase of probe dosage. When the amplification time is 25 min and the primer dosage is 2.0 μL, the fluorescence intensity is significantly increased from 30778 to 49837 when the probe dosage increases from 0.3 μL to 0.9 μL. Moreover, longer amplification time does not cause more obvious signal changes. Therefore, 0.9 μL is selected as the optimal probe dosage.

[0135] Example 10

[0136] In order to explore the sensitivity of the finger-pressure microfluidic biosensor, specific primers and specific fluorescent probes were designed for the conserved sequences of the three target bacteria with reference to Example 2. Under the optimal conditions obtained in the previous example, the sensor was used to detect Salmonella typhimurium (1×10 1 ~1×10 6 CFU / mL), Listeria monocytogenes (4×10 1 ~4×10 6 CFU / mL) and E. coli O157:H7 (5×10 1 ~5×10 6 CFU / mL), and the detection limit was calculated using the three-fold standard deviation method.

[0137] The results are as follows Fig.11 As shown, according to Fig.11 The results in A and B show that when the concentration of Salmonella typhimurium increases from 1×10 1 CFU / mL increased to 1×10 6 CFU / mL, and its corresponding fluorescence intensity also increased from 10013 to 46296, and its linear detection range was 1×10 1 ~1×10 6CFU / mL, the corresponding linear relationship can be expressed as y = 7426.2 × lg (C) + 2458.1 (R 2 =0.98), and the lower limit of detection was 9 CFU / mL.

[0138] according to Fig.11 In C and D, the results show that when the concentration of Listeria monocytogenes cells increased from 4 × 10 1 CFU / mL increased to 4×10 6 CFU / mL, and the corresponding fluorescence intensity also increased from 13365 to 65077, with a linear detection range of 4×10 1 ~4×10 5 CFU / mL, the corresponding linear relationship can be expressed as y = 9422.4 × lg (C) - 3623.8 (R 2 =0.98), and the lower limit of detection was 38 CFU / mL.

[0139] according to Fig.11 E and F, the results show that when the concentration of E. coli O157:H7 increases from 5×10 1 CFU / mL increased to 5×10 6 CFU / mL, and its corresponding fluorescence intensity also increased from 10057 to 42205, and its linear detection range was 5×10 1 ~5×10 5 CFU / mL, the corresponding linear relationship can be expressed as y = 5658.1 × lg (C) - 818.77 (R 2 =0.97), and the lower limit of detection was 48 CFU / mL.

[0140] Embodiment 11

[0141] The high gradient magnetic field and permanent magnet used in Example 7 were simulated by FEMM software. The results are as follows: Fig.12 As shown in A, the results show that when magnets of the same size repel each other, the high gradient magnetic field of the magnetic field generating assembly used in the embodiment of the present application has more dense magnetic lines of force passing through the sawtooth tip, while when there is only a single permanent magnet, only a small amount of magnetic lines of force pass through the upper channel position, which indicates that the magnetic field gradient of the high gradient magnetic field is stronger than that of an ordinary permanent magnet. Even if the four corners of the permanent magnet have a higher magnetic field strength, the magnetic field strength at the upper channel position is weaker than that of the high gradient magnetic field.

[0142] In addition, the simulation software was used to derive the trend of the magnetic field intensity at the channel position above the magnet. The results are as follows: Fig.12 B and C, the results show that the high gradient magnetic field is reduced from 1T to 0.2T, while the ordinary permanent magnet is reduced from 0.48T to 0.15T.

[0143] The present application is described in detail above in conjunction with the embodiments, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A microfluidic chip, characterized in that: The invention comprises at least one raw material pumping mechanism, wherein the raw material pumping mechanism comprises: Raw material pumping channel; A pressing chamber, the pressing chamber is located upstream of the raw material pumping channel along the direction of fluid movement, and the pressing chamber is used to provide a changing air pressure in the raw material pumping channel; a raw material chamber, the raw material chamber being located on the raw material pumping channel and downstream of the pressing chamber, and the raw material chamber being used for storing reaction raw materials; A check valve, the check valve is located on the raw material pumping channel downstream of the raw material chamber, the check valve includes a temporary storage chamber and a microball; the temporary storage chamber is opened on one side of the raw material pumping channel along the fluid movement direction; the size of the microball is configured to be able to move from the raw material pumping channel into the temporary storage chamber to open the raw material pumping channel after the pressure of a set magnitude is applied in the pressing chamber, and to move from the temporary storage chamber into the raw material pumping channel under the action of gravity to close the raw material pumping channel after the pressure in the pressing chamber is removed.

2. The microfluidic chip according to claim 1, characterized in that: The temporary storage chamber is cylindrical, and the diameter of the microsphere is within 0.2 mm larger than the diameter of the temporary storage chamber.

3. The microfluidic chip according to claim 2, characterized in that: The diameters of the temporary storage chamber and the raw material pumping channel are 1.4-1.6 mm, the diameter of the microspheres is 1.5-1.7 mm, and the diameter of the microspheres is 0.05-0.15 mm larger than the diameters of the temporary storage chamber and the raw material pumping channel.

4. The microfluidic chip according to claim 1, characterized in that: The microfluidic chip further comprises a reaction mechanism connected to the raw material pumping mechanism, wherein the reaction mechanism comprises: an incubation channel, wherein the incubation channel is connected to the raw material pumping channel; A magnetic field generating component is located on one side of the incubation channel, and includes a plurality of magnets arranged in parallel, wherein the magnetic poles of adjacent magnets are in opposite directions and are separated by a spacer, and a serrated structure is provided on the side of the spacer facing the incubation channel.

5. The microfluidic chip according to claim 4, characterized in that: The number of the magnets is 3 to 10.

6. The microfluidic chip according to claim 4, characterized in that: The microfluidic chip also includes a detection mechanism, which includes a detection chamber and a detection pipeline, one end of the detection pipeline is connected to the incubation channel, and the other end of the detection pipeline is connected to the detection chamber.

7. The microfluidic chip according to claim 6, characterized in that: The microfluidic chip also includes a waste liquid chamber. The inspection pipeline is provided with a rotary valve, and the rotary valve is used to regulate the fluid in the inspection pipeline to enter the waste liquid chamber or the detection chamber.

8. The microfluidic chip according to claim 1, characterized in that: The microfluidic chip comprises three raw material pumping mechanisms, and the raw material chambers in the three raw material pumping mechanisms are respectively used to store lysate, washing solution and eluent.

9. Use of the microfluidic chip according to any one of claims 1 to 8 in the preparation of microbial detection products.

10. A method for detecting microorganisms for non-disease diagnosis purposes, characterized in that: The detection method comprises using the microfluidic chip according to any one of claims 1 to 8.

Images