Gold ball sensitization type special-hole micro-channel array biological reaction chip and application thereof

Abstract

The invention discloses a gold ball sensitization type special-hole micro-channel array biological reaction chip and application thereof. The biological reaction chip comprises a substrate, a micro-channel reaction layer and an interface layer, the bottom surface of the micro-channel reaction layer is provided with a plurality of irregular-hole micro-channels arranged in an array, and the irregular-hole micro-channels and the gold film surface of the substrate are enclosed to form a reaction chamber; sequentially injecting a to-be-detected sample-second probe mixed solution, a gold ball solution and a washing solution into the reaction chamber, obtaining a detection signal by using optical detection equipment, and inputting the detection signal into the standard curve to obtain the concentration of the target single-stranded DNA. On one hand, the problem of partial non-specific adsorption signals is solved by reducing the possibility of aggregation and sedimentation of the gold balls, and on the other hand, the adsorption efficiency of the target is improved by enhancing the combination effect of the target and the gold balls.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid detection, and in particular to a method for manufacturing a universal gold ball bioreaction chip with increased sensitivity based on a label-free optical biosensor. The chip can be used to detect nucleic acid molecules and perform related detection applications. Background Art

[0002] Label-free optical biosensing technology is a type of detection technology that uses the changes in optical signals such as absorption, scattering, interference, and diffraction of light by biomolecules to analyze the interactions between biomolecules. It does not require staining or labeling. Due to its many advantages such as strong specificity, high sensitivity, non-destructive detection, and fast analysis speed, label-free optical biosensing technology has been widely used in biochemical testing, medical diagnosis, environmental monitoring, and drug development. Common label-free optical biosensing technologies mainly include surface plasmon resonance (SPR) sensors, elliptical polarization optical sensors, optical waveguide spectroscopy sensors, and reflection interferometry sensors.

[0003] Single-stranded DNA (ssDNA) is a DNA molecule composed of one nucleotide chain. Unlike double-stranded DNA (dsDNA), ssDNA lacks another complementary chain. Usually, ssDNA exists in organisms less stably and tends to complement DNA and RNA. But in fact, ssDNA not only plays an important role in organisms, but is also one of the important tools in molecular biology. Studies have confirmed that ssDNA plays the role of a transport carrier in gene delivery and gene regulation because of its high negative charge, which allows it to quickly enter cells and not be degraded. In terms of immune regulation, ssDNA can activate the immune system and produce a strong immune response. ssDNA can also be used as a gene silencing tool to regulate gene expression by binding to specific miRNAs.

[0004] In the past five years, label-free optical biosensor technology has achieved a lot of applications. Compared with the conventional and commonly used immunochemiluminescence method and immunoprecipitation method (polymerase chain reaction, enzyme-linked immunosorbent assay), label-free optical biosensor technology has stronger anti-interference ability, simpler pre-detection treatment, and shorter readout time. However, when reading short-sequence ssDNA (20~100nt) fragments, the sensitivity is insufficient. The signal amplification strategy based on gold balls effectively solves this problem, but also brings new problems, that is, the aggregation and sedimentation of gold balls increase nonspecific adsorption, and nonspecific adsorption will bring false positive signals, which in turn affects the detection sensitivity.

[0005] Therefore, how to avoid the nonspecific signals caused by gold sphere aggregation and sedimentation is one of the most urgent problems to be solved in the current gold sphere-based signal amplification strategy. Summary of the invention

[0006] In view of the problem that the non-specific signal caused by the aggregation and sedimentation of gold balls in the prior art affects the detection sensitivity, the present invention provides a gold ball enhanced sensitivity type hetero-pore microfluidic array bioreactor chip and its application. The present invention is provided with a hetero-pore microfluidic array bioreactor generator, and a biochip formed by using the bioreactor generator to enhance the gold ball signal, and performs ssDNA related detection applications. The present invention strengthens the signal response degree of the target object and also improves the detection performance of the target object.

[0007] The technical solution adopted by the present invention is as follows: 1. A gold ball sensitized hetero-pore microfluidic array bioreactor chip The invention comprises at least one reaction chamber, wherein the reaction chamber is mainly composed of an injection chamber, a flow channel and an output chamber, wherein the injection chamber and the output chamber are arranged at intervals, a flow channel is arranged on a line connecting the centers of the injection chamber and the output chamber, and the injection chamber and the output chamber are connected through the flow channel. The diameter of the injection chamber is smaller than the diameter of the output chamber, and the width of the flow channel is the same as the diameter of the injection chamber.

[0008] Preferably, the sample inlet chamber and the sample outlet chamber are both columnar, and the flow channel is cubical.

[0009] Preferably, the depths of the sample inlet chamber, the flow channel and the sample outlet chamber are the same, and the diameter ratio of the sample inlet chamber to the sample outlet chamber is 1:2, and the volume ratio is 1:4.

[0010] Specifically, a first probe is fixed and sealed on the inner bottom surface of the reaction chamber, and the injection chamber and the output chamber are respectively connected to the outside. After the sample solution is injected into the injection chamber, it flows into the output chamber through the flow channel and then flows out of the output chamber.

[0011] Preferably, the sample solution includes a mixed solution of the sample to be detected and the second probe and a gold ball solution. The pH of the two sample solutions is 3-4.

[0012] Specifically, the sample to be detected contains the target to be detected (ie, the target single-stranded DNA). The detection method of the present invention mainly detects ssDNA with a base length ranging from 20 to 80 nt.

[0013] The concentration of the target in the mixed solution is preferably 10 ng / mL to 1 μg / mL.

[0014] The gold balls are preferably gold nanoparticles modified by nickel ions and nitrilotriacetic acid (NTA), with a concentration range of 1-10 nmol / L and a particle size range of 1.8-10 nm.

[0015] Preferably, the first probe is a ssDNA comprising a target complementary fragment and having a thiol group modified at the end.

[0016] Preferably, the second probe is a ssDNA with a histidine tag modified at the first end and a complementary base pairing with the first probe at the end.

[0017] Preferably, the bioreactor chip is mainly composed of a substrate, a microfluidic reaction layer and an interface layer which are stacked in sequence from bottom to top; a gold film is provided on the top surface of the substrate, at least one hetero-pore microfluidic channel is provided on the bottom surface of the microfluidic reaction layer, each hetero-pore microfluidic channel and the substrate enclose a reaction chamber, and a plurality of stainless steel tubes are provided through the interface layer.

[0018] Preferably, the hetero-pore microfluidic channel is mainly composed of two columnar grooves and one cubic groove, the two columnar grooves are arranged at intervals and connected by the cubic groove, and each columnar groove is connected to the outside through a corresponding stainless steel tube; the diameters of the two columnar grooves are different, the first columnar groove with a smaller diameter is combined with the base to form an inlet chamber, the second columnar groove with a larger diameter is combined with the base to form an outlet chamber, and the cubic groove and the base are combined to form a flow channel; the cubic groove is arranged on the line between the centers of the two columnar grooves, and the width is the same as the diameter of the first columnar groove.

[0019] Optionally, the depth of the heteroporous microfluidic channel is less than the thickness of the microfluidic channel reaction layer.

[0020] 2. A method for detecting biological molecules using the above-mentioned gold ball sensitization type hetero-pore microfluidic array bioreaction chip The detection method comprises the following steps: S1) fixing and sealing the first probe on the surface of the substrate, and then assembling to obtain a gold ball enhanced sensitization type hetero-pore microfluidic array bioreaction chip. The step S1 comprises the following steps: S1.1) cleaning the substrate with the gold film on the surface to obtain a cleaned substrate; S1.2) dropping a reduced first probe solution having a concentration of 10 to 100 μmol / L onto the surface of the cleaned substrate and allowing to stand, then washing the surface of the substrate with deionized water for 1 to 3 times to obtain a substrate after the first probe is fixed; S1.3) immersing the substrate after the first probe is fixed in a 6-mercaptohexanol (6-Mercapto-1-hexanol, MCH) solution, incubating at room temperature with shaking in the dark, to obtain a substrate after the first probe is blocked; S1.4) The microfluidic reaction layer and the interface layer are coupled and connected by a commercial PDMS-glass bonding process; the gold film side surface of the substrate after the first probe is sealed is adhered to the groove side surface of the microfluidic reaction layer to obtain an assembled bioreactor chip.

[0021] S2) preparing a gold ball solution and a mixed solution of the sample to be detected and the second probe; the pH of the gold ball solution and the mixed solution are both 3-4.

[0022] The sample to be detected contains the target to be detected, and the concentration of the target in the mixed solution is 10 ng / mL to 1 μg / mL. The base length of the target ranges from 20 to 80 nt.

[0023] Preferably, the concentration of the gold ball solution is in the range of 1 to 10 nmol / L.

[0024] S3) controlling the mixed solution prepared in step S2 to pass through each hetero-pore microfluidic channel of the gold ball sensitization hetero-pore microfluidic channel array bioreactor chip, with a flow rate of 0.1-0.5 mL / min and a passing time of 10-20 min.

[0025] S4) controlling the gold ball solution to pass through each hetero-pore microfluidic channel of the gold ball sensitization hetero-pore microfluidic channel array bioreactor chip, with a flow rate of 0.2-0.5 mL / min and a passing time of 10-20 min.

[0026] S5) After standing for 10 to 20 minutes, the washing solution is controlled to pass through each hetero-pore microfluidic channel of the gold ball sensitization hetero-pore microfluidic channel array bioreactor chip.

[0027] In the steps S3 to S5, the process of controlling the solution to pass through the hetero-pore microfluidic channel of the gold ball enhanced hetero-pore microfluidic channel array bioreactor chip is specifically as follows: using a peristaltic pump to inject the solution from the stainless steel tube corresponding to the injection chamber into the hetero-pore microfluidic channel, and outputting the solution from the stainless steel tube corresponding to the output chamber.

[0028] S6) Using optical detection equipment to detect the gold ball sensitization type hetero-pore microfluidic array bioreactor chip to obtain a detection signal.

[0029] The step S6 also includes: inputting the detection signal into a pre-established standard curve to obtain the concentration of the target in the mixed solution.

[0030] Optionally, the process of establishing the standard curve is: preparing target-second probe mixed solutions containing different concentrations of targets, detecting detection signals corresponding to various target-second probe mixed solutions, fitting the target concentrations and corresponding detection signals to obtain a standard curve.

[0031] 3. Application of a gold ball sensitized hetero-pore microfluidic array bioreaction chip in detecting nucleic acid molecules.

[0032] Preferably, the detection method of the present invention can detect single-stranded DNA with a base length ranging from 20 to 80 nt.

[0033] Preferably, the detection concentration of the detection method of the present invention is 10 ng / mL to 1 μg / mL.

[0034] The beneficial effects of the present invention are as follows: 1. The bioreactor chip of the present invention achieves the result of reducing the aggregation and sedimentation of gold balls through the heteroporous microfluidic channel, and solves the problem of some nonspecific adsorption signals.

[0035] 2. The present invention further enhances the target signal based on gold ball amplification by adding a surface electrical modulation link during the production of the bioreactor chip and the detection of nucleic acid molecules, thus overcoming the defect of low target adsorption efficiency of traditional chips.

[0036] 3. The present invention is simple to operate and highly practical. It not only enhances the signal response degree of the target object, but also improves the detection performance of the target object. It has broad application prospects in label-free optical biosensor technology.

[0037] 4. The detection method of the present invention can achieve high-precision detection for ssDNA with a base length of 20 to 80 nt in a concentration range of 10 ng / mL to 1 μg / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is a schematic diagram of the combined structure of the microfluidic channel reaction layer and the interface layer in the bioreactor chip of the present invention; Figure 2 1 is a top view of a microfluidic reaction layer and an interface layer in a bioreactor chip of the present invention; wherein (a) is a top view of the microfluidic reaction layer, and (b) is a top view of the interface layer; Figure 3 A schematic top view showing the principle of gold ball precipitation in each hetero-pore microchannel of the bioreactor chip of the present invention; Figure 4 It is a signal diagram of different areas in the sample outlet chamber of each hetero-pore microfluidic channel of the bioreactor chip of the present invention; Figure 5 The figure is a schematic diagram of the manufacturing and detection process of the bioreactor chip of the present invention; Figure 6 It is a schematic diagram of the test results of Example 2 and Comparative Example 2 of the present invention; Figure 7 It is a schematic diagram of the detection results of Example 2 and Comparative Example 3 of the present invention. DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with specific embodiments and drawings.

[0040] Below, the meanings of some terms used in the present invention are explained as follows: In the present invention, "gold ball sensitization" means that in addition to the signal enhancement brought by the gold ball itself, the specific signal of the gold ball when binding to the target is also enhanced, so that the sensitivity of the label-free optical biosensor is enhanced twice when detecting the target.

[0041] In the present invention, "gold ball sedimentation" refers to the behavior of the gold ball adhering to the chip surface under the combined action of fluid force and gravity in the flow channel.

[0042] In the present invention, the "first end" and "end" of a nucleic acid refer to the 5' end and 3' end of the nucleic acid, respectively.

[0043] Combine the following Figure 3~Figure 5 The principle of the present invention is further explained.

[0044] The principle of the present invention is specifically as follows: In the first aspect, the present invention achieves the result of reducing the gold ball sedimentation through the heteroporous microfluidic channel, thereby solving some non-specific adsorption signal problems. Figure 4 As shown, compared with general microarray units, the present invention seizes the characteristics of gradual change of molecular size in the mobile phase transport process, and adopts a design of small volume hole (injection chamber) for sample injection and large volume hole (output chamber) for sample discharge, so that the gold ball precipitation is distributed as much as possible in the surrounding area of ​​the large volume hole (output chamber), and enough target and gold ball specific binding area is cleverly reserved in the middle of the large volume hole (output chamber), thereby improving the specific binding situation.

[0045] In the second aspect, the present invention further enhances the target signal based on gold ball amplification by adding a surface electrical modulation link during the preparation of the bioreactor chip and the detection and application of nucleic acid molecules. The present invention changes the pH of the buffer solution so that the gold ball and the target have attractive charges, thereby strengthening the binding force between the gold ball and the target and improving the target signal intensity. Taking the pH of the mixed solution and the gold ball solution as 3.5 as an example, the electrical properties of the target ssDNA and gold particles in a buffer solution with a pH of 3.5 are shown in Table 1. The detection method provided by the present invention is simple to operate and has strong practicality. It not only enhances the signal response degree of the target object, but also improves the specificity of the target object signal. It has broad application prospects in the field of label-free optical biosensor technology.

[0046] Table 1 Target ssDNA Gold particles Isoelectric point 4-4.5 - Buffer 3.5 3.5 Electrical Positive Negative The first aspect of the present invention provides a gold ball sensitization type hetero-pore microfluidic array bioreaction chip.

[0047] The bioreactor chip includes at least one reaction chamber, which is mainly composed of an injection chamber, a flow channel and an outlet chamber. The injection chamber and the outlet chamber are arranged at intervals, and a flow channel is arranged on the line connecting the centers of the injection chamber and the outlet chamber. The injection chamber and the outlet chamber are connected through the flow channel. The diameter of the injection chamber is smaller than the diameter of the outlet chamber, and the width of the flow channel is the same as the diameter of the injection chamber.

[0048] Preferably, the sample inlet chamber and the sample outlet chamber are both columnar, and the flow channel is in a cubic shape.

[0049] Preferably, the depths of the sample inlet chamber, the flow channel and the sample outlet chamber are the same, and the diameter ratio of the sample inlet chamber to the sample outlet chamber is 1:2, and the volume ratio is 1:4.

[0050] Alternatively, if Figure 1 As shown, the bioreactor chip of the present invention is mainly composed of a substrate, a microfluidic reaction layer and an interface layer which are stacked from bottom to top. A gold film is arranged on the top surface of the substrate, a plurality of array-arranged hetero-pore microfluidics are arranged on the bottom surface of the microfluidic reaction layer, and a plurality of stainless steel tubes are arranged through the interface layer; each hetero-pore microfluidic channel and the substrate enclose a reaction chamber, and each reaction chamber is mainly composed of an injection chamber, a flow channel and a sample outlet chamber, the injection chamber and the sample outlet chamber are arranged at intervals and connected through the flow channel, the injection chamber and the sample outlet chamber are respectively connected to the outside through a corresponding stainless steel tube, the stainless steel tube corresponding to the injection chamber is used to inject the sample solution, and the stainless steel tube corresponding to the sample outlet chamber is used to output the post-reaction solution; the diameter of the injection chamber is smaller than the diameter of the sample outlet chamber. Among them, the top surface of the substrate refers to the side surface of the substrate in contact with the microfluidic reaction layer. The bottom surface of the microfluidic reaction layer refers to the side surface of the microfluidic reaction layer in contact with the substrate.

[0051] Specifically, the sample inlet chamber and the sample outlet chamber are connected to the outside through a corresponding stainless steel tube respectively, which means that the sample inlet chamber is connected to one end of the corresponding stainless steel tube, and the other end of the stainless steel tube is used to receive the sample solution from the sample pool. The sample outlet chamber is connected to one end of the corresponding stainless steel tube, and the other end of the stainless steel tube is used to output the post-reaction solution to the waste liquid pool.

[0052] As an optional embodiment of the present invention, the substrate is glass, and a layer of gold is attached to the glass surface, and the attachment process is achieved by commercial physical vapor deposition (PVD). The microfluidic reaction layer is made of polydimethylsiloxane (PDMS) material. The interface layer is made of polymethyl methacrylate (PMMA) material. The gold film layer of the substrate is extruded and connected with the microfluidic reaction layer through an external chip placement module. The coupling of the microfluidic reaction layer and the interface layer (i.e., PMMA and PDMS) is achieved by a commercial PDMS-glass bonding process.

[0053] As an optional embodiment of the present invention, the interface layer is penetrated by multiple stainless steel tubes in the following manner: the interface layer is provided with multiple through holes, each of which is opened in the vertical direction, and a stainless steel tube is embedded in each through hole, and the bottom end of each stainless steel tube is connected to the corresponding cylindrical groove, and the top end is connected to the peristaltic pump through a hose.

[0054] As an optional embodiment of the present invention, the coupling between the interface layer and the stainless steel tube is achieved by irradiating UV glue with a UV curing machine. The coupling between the hose and the stainless steel tube is achieved by manually inserting the end of the top of the stainless steel tube into one end of the hose.

[0055] Specifically, the horizontal cross-section of each heteroporous microfluidic channel is an asymmetric dumbbell shape (see Figure 2 and Figure 3 ). The hetero-pore microfluidic channel is mainly composed of two columnar grooves and one cubic groove. The two columnar grooves are arranged at intervals and connected through the cubic groove. Each columnar groove is connected to the outside through a corresponding stainless steel tube. The two columnar grooves have different diameters and the same depth. The first columnar groove with a smaller diameter is surrounded by the base to form an injection chamber, and the second columnar groove with a larger diameter is surrounded by the base to form an outlet chamber. The cubic groove and the base are surrounded to form a flow channel.

[0056] Preferably, the cubic groove is arranged on the line between the axes of the two columnar grooves, and its width is the same as the diameter of the first columnar groove with a smaller diameter, that is, on the horizontal cross-section of the cubic groove and the first columnar groove, the long side of the cubic groove is tangent to the first columnar groove. So that the flow channel is arranged on the line between the axes of the injection chamber and the output chamber, and its width is the same as the diameter of the injection chamber.

[0057] Specifically, the depths of the two columnar grooves and the cubic groove are the same.

[0058] Preferably, the diameter ratio of the first columnar groove to the second columnar groove is 1:2. So that in each heteroporous microfluidic channel, the relationship between the volume / diameter of the inlet chamber and the volume / diameter of the outlet chamber is: V 进样室 :V 出样室 =1:4, R 进样室 : R 出样室 =1:2.

[0059] Optionally, the depth of the heteroporous microfluidic channel is less than the thickness of the microfluidic channel reaction layer.

[0060] Preferably, the center of each columnar groove is aligned with the center of the corresponding stainless steel tube in the vertical direction.

[0061] Preferably, each hetero-pore microfluidic channel is evenly arranged along a rectangular array on the bottom surface of the microfluidic channel reaction layer. For example, in a specific embodiment of the present invention, 12 hetero-pore microfluidic channels are arranged evenly along a 3×4 rectangular array (see Figure 1 and Figure 2 ).

[0062] Specifically, a first probe is fixed and sealed on the inner bottom surface of the reaction chamber, the injection chamber and the output chamber are respectively connected to the outside, and after the sample solution is injected into the injection chamber, it flows into the output chamber through the flow channel and then flows out from the output chamber.

[0063] Preferably, the sample solution includes a mixed solution of the sample to be detected and the second probe and a gold ball solution. The sample to be detected contains the target to be detected (ie, the target single-stranded DNA).

[0064] Preferably, the base length of the target is in the range of 20 to 80 nt, that is, the detection method of the present invention can detect single-stranded DNA with a base length in the range of 20 to 80 nt.

[0065] Preferably, the concentration range of the target in the mixed solution of the sample to be detected and the second probe is 10 ng / mL to 1 μg / mL, and the concentration range of the second probe is 50 to 200 μmol / L. That is, the detectable concentration range of the present invention is 10 ng / mL to 1 μg / mL.

[0066] Preferably, the pH of the mixed solution of the sample to be detected and the second probe and the gold ball solution are both 3-4. By changing the pH of the buffer solution, the gold ball and the target are charged with attractive charges (see Table 1), which strengthens the binding force between the gold ball and the target and improves the target signal intensity. In a specific implementation, a buffer solution with a pH of 3-4 can be used to prepare the two sample solutions. Preferably, DEPC water with a volume concentration of 0.1% is used as the buffer solution, and hydrochloric acid is used to adjust the pH.

[0067] Preferably, the gold spheres are gold nanoparticles with a particle size range of 1.8 to 10 nm. Further, the gold spheres are nickel ion-nitrilotriacetic acid modified gold nanoparticles.

[0068] Preferably, in the gold ball solution, the concentration of gold balls is in the range of 1-10 nmol / L.

[0069] Preferably, the first probe is a ssDNA comprising a target complementary fragment and having a thiol group modified at the end.

[0070] Preferably, the second probe is a ssDNA with a histidine tag modified at the first end and a complementary base pairing with the first probe at the end.

[0071] Preferably, the sequence lengths of the first probe and the second probe are both less than 100 nt.

[0072] The second aspect of the present invention provides a detection method using the above-mentioned gold ball sensitization type hetero-pore microfluidic channel array bioreaction chip.

[0073] The detection method of the present invention comprises the following steps: S1) fixing and sealing the first probe on the surface of the substrate, and then assembling to obtain a gold ball enhanced sensitization type hetero-pore microfluidic array bioreaction chip; Step S1 includes the following steps: S1.1) Cleaning the substrate with the gold film to obtain a cleaned substrate.

[0074] S1.2) Mix the tris(2-carboxyethyl)phosphine hydrochloride (TCEP) solution and the first probe solution, and let it stand for 1.5 to 2 hours to obtain the reduced first probe solution; drop the reduced first probe solution with a concentration of 10 to 100 μmol / L onto the surface of the cleaned substrate and let it stand for 1 to 2 hours, then wash the surface of the substrate with deionized water 1 to 3 times to obtain the substrate after the first probe is fixed. In this step, the surface of the substrate refers to the side surface provided with the gold film.

[0075] Preferably, the TCEP solution and the first probe solution are mixed at a molar ratio of 1:1000.

[0076] In specific implementation, the ratio of the volume of the first probe solution after reduction to the surface area of ​​the cleaned substrate can be selected according to actual conditions to ensure that the first probe solution after reduction can completely cover the substrate.

[0077] S1.3) Immerse the substrate after the first probe is fixed in a 6-mercaptohexanol (6-Mercapto-1-hexanol, MCH) solution, incubate at room temperature with shaking for 2 to 3 hours in the dark, and obtain the substrate after the first probe is blocked; in a specific implementation, the concentration of the MCH solution is at least 50mmol / L.

[0078] S1.4) The microfluidic reaction layer and the interface layer are coupled and connected by a commercial PDMS-glass bonding process; the gold film side surface of the substrate after the first probe is sealed is adhered to the groove side surface of the microfluidic reaction layer to obtain an assembled bioreactor chip.

[0079] S2) preparing a gold ball solution and a mixed solution of the sample to be detected and the second probe; Preferably, the pH of the gold ball solution and the mixed solution are both 3-4; Preferably, the sample to be detected contains a target (ie, a target single-stranded DNA), and the base length of the target ranges from 20 to 80 nt.

[0080] Preferably, the concentration of gold spheres is in the range of 1-10 nmol / L.

[0081] S3) controlling the mixed solution to pass through each hetero-pore microfluidic channel of the gold ball enhanced hetero-pore microfluidic channel array bioreactor chip at a flow rate of 0.1-0.5 mL / min and a passing time of 10-20 min; The implementation method of controlling the mixed solution to pass through the hetero-pore microfluidic channel may be: using a peristaltic pump to inject the mixed solution from the stainless steel tube corresponding to the injection chamber into the hetero-pore microfluidic channel, and output it from the stainless steel tube corresponding to the output chamber.

[0082] S4) controlling the gold ball solution to pass through each hetero-pore microfluidic channel of the gold ball enhanced hetero-pore microfluidic channel array bioreactor chip at a flow rate of 0.2-0.5 mL / min and a passing time of 10-20 min; The implementation method of controlling the gold ball solution to pass through the hetero-pore microfluidic channel may be: using a peristaltic pump to inject the gold ball solution from the stainless steel tube corresponding to the injection chamber into the hetero-pore microfluidic channel, and output it from the stainless steel tube corresponding to the output chamber.

[0083] S5) after standing for 10 to 20 minutes, the washing liquid is controlled to pass through each hetero-pore microfluidic channel of the gold ball enhanced hetero-pore microfluidic channel array bioreactor chip; the flow rate is 0.1 to 0.3 mL / min, and the passing time is 5 to 20 minutes; S6) Using a label-free optical detection device to detect the gold ball sensitization type hetero-pore microfluidic array bioreactor chip to obtain a detection signal.

[0084] Step S6 specifically includes: placing the hetero-pore microfluidic array bioreactor chip into a label-free optical detection device, such as a surface plasmon resonance (SPR) or an ellipsometric imaging biosensor detection device, recording the biosensor signal on the gold film surface according to the operating specifications of the label-free optical detection device, and obtaining the detection result based on the biosensor signal.

[0085] Step S6 also includes: inputting the detection signal into a pre-established standard curve to obtain the concentration of the target in the mixed solution.

[0086] Optionally, the process of establishing the standard curve is: using a standard solution of the target, preparing a target-second probe mixed solution containing different concentrations of the target, detecting according to the process of step S3 to step S6 to obtain the detection signals corresponding to various target-second probe mixed solutions, fitting the target concentration and the corresponding detection signal to obtain a standard curve.

[0087] The third aspect of the present invention provides an application of the above-mentioned gold ball sensitization type hetero-pore microfluidic array bioreaction chip in detecting nucleic acid molecules.

[0088] Preferably, the detection method of the present invention can detect single-stranded DNA with a base length ranging from 20 to 80 nt. The concentration range detectable by the method of the present invention is 10 ng / mL to 1 μg / mL.

[0089] The specific embodiments of the present invention are as follows: Example 1

[0090] This embodiment is a bioreactor chip with 12 different-hole microfluidic channels, and its structure is as follows: Figure 2 As shown, the details are as follows: The bioreactor chip of this embodiment includes a substrate, a microfluidic reaction layer and an interface layer. If the substrate is taken as the bottom layer, the substrate, the microfluidic reaction layer and the interface layer are arranged from bottom to top, and the size of the horizontal cross section is 20 mm × 20 mm. The substrate layer is made of glass with a layer of gold attached to the surface. The attachment process is achieved by commercial physical vapor deposition (PVD). The glass thickness is 3 mm and the gold film thickness is 50 ± 5 nm. The microfluidic reaction layer uses PDMS with a thickness of 2 mm, and the interface layer uses PMMA with a thickness of 3 mm. The coupling of the microfluidic reaction layer and the interface layer is achieved by a commercial PDMS-glass bonding process. The specific process steps include the following: making a chip mask, making a chip positive template, using PDMS to make a microfluidic reaction layer, using PMMA to make an interface layer, and bonding the microfluidic reaction layer and the interface layer.

[0091] like Figure 2 As shown in (a), in the bioreactor chip of this embodiment, the bottom surface of the microfluidic reaction layer is provided with a hetero-pore microfluidic array formed by 12 hetero-pore microfluidic channels arranged along a 3 (row) × 4 (column) matrix. The horizontal cross-section of each hetero-pore microfluidic channel is an asymmetric dumbbell shape, that is, a keyhole-like shape. The hetero-pore microfluidic channel is mainly composed of two columnar grooves and one cubic groove. In each hetero-pore microfluidic channel, the first columnar groove with a smaller diameter has a diameter of 1mm and a depth of 1mm; the second columnar groove with a larger diameter has a diameter of 2mm and a depth of 1mm. The length of the cubic groove is 2mm, the width is 1mm, and the depth is 1mm. Among them, the line connecting the centers of the two columnar grooves is parallel to the column direction (y direction). The length of the cubic groove refers to its size in the direction of the line connecting the centers of the two columnar grooves (i.e., the y direction). For two hetero-pore microfluidic channels adjacent in the x direction, the center distance between the second columnar grooves of the two hetero-pore microfluidic channels is 5mm. For two adjacent hetero-pore microfluidic channels in the y direction, the center distance between the adjacent first columnar groove and the second columnar groove is 3 mm.

[0092] In addition, in order to facilitate the insertion of the stainless steel tube, 24 through holes are opened on the bottom surface of the microfluidic reaction layer. Each columnar groove corresponds to a through hole, and each columnar groove is coaxially arranged with the corresponding through hole, that is, aligned in the vertical direction.

[0093] like Figure 2 As shown in (b), in the bioreactor chip of this embodiment, the interface layer is provided with 24 through holes, all of which are arranged in a 6 (row) × 4 (column) matrix and are opened in the vertical direction. Each through hole has a diameter of 1 mm and a depth of 3 mm. The center spacing between two adjacent through holes in the x direction is 5 mm, and the center spacing between two adjacent through holes in the y direction is 3 mm.

[0094] In the bioreactor chip of this embodiment, the stainless steel tube is made of 304 stainless steel, with an outer diameter of 1 mm and an inner diameter of 0.8 mm. The coupling between the stainless steel tube and the interface layer is achieved by irradiating ultraviolet UV glue with an ultraviolet curing machine. The outer diameter of the transparent rubber tube is 1.2 mm and the inner diameter is 1 mm. The coupling between the transparent rubber tube and the stainless steel tube is achieved by manual insertion.

[0095] Example 2

[0096] In this example, the bioreactor chip in Example 1 and the method of the present invention were used to detect ssDNA standards of different concentrations. In this example, the ssDNA standard ssDNA-21 was used as the target, and the nucleotide sequence was as shown in SEQ ID NO.5, which was: 5'-TAGCTTATCAGACTGATGTTGA. The concentrations of the target were 1000ng / mL, 500ng / mL, 100ng / mL, 50ng / mL, and 10ng / mL, respectively.

[0097] like Figure 5 As shown, the specific process of this embodiment is as follows: S1) fixing and sealing the first probe on the surface of the substrate, and then assembling to obtain a gold ball enhanced sensitization type hetero-pore microfluidic array bioreaction chip; S1.1) Cleaning the substrate: The substrate with the gold film on the surface is cleaned in a piranha solution (H2SO4:H2O2=3:1, v / v) for 30 minutes, and then cleaned alternately with deionized water and ethanol (99%) for 3 times to obtain a cleaned substrate.

[0098] S1.2) Prepare the first probe and the second probe: prepare a ssDNA with a thiol (-SH) end and a target complementary sequence as the first probe, and the second probe is complementary to the first probe 10 nt from the thiol end, and is modified with a histidine (His) tag at the end; The nucleotide sequence of the first probe Probe ssDNA-21 is shown in SEQ ID NO.2: 5'-TCAACATCAGTCTGATAAGCTA-3'SH; The nucleotide sequence of the second probe Probe ssDNA-21-2 is shown in SEQ ID NO.8: 5'His-AGCATGGCATCTTAGCTTATCAGACTGATGTTGA; Reducing the first probe: adding 0.01 mL of 100 mmol / L TCEP solution to 0.5 mL of 100 μmol / L first probe solution and letting it stand for 2 hours to obtain a reduced first probe solution; Fix the first probe: dilute the reduced first probe solution to make the concentration of the reduced first probe 10 μmol / L, use a pipette to draw 200 μL of the diluted reduced first probe solution, and add it dropwise to the gold film surface of the cleaned substrate. After standing for 2 hours, wash it 3 times with deionized water to obtain the substrate after the first probe is fixed.

[0099] S1.3) Sealing the gold film chip: Prepare 3 mL of 50 mmol / L MCH solution, completely immerse the substrate after the first probe is fixed in the MCH solution, and incubate at room temperature for 2 hours under complete darkness to obtain the substrate after the first probe is sealed; S1.4) The microfluidic reaction layer and the interface layer are coupled and connected by a commercial PDMS-glass bonding process; the gold film side surface of the substrate after the first probe is sealed is naturally adhered to the groove side surface of the microfluidic reaction layer to obtain an assembled bioreactor chip.

[0100] The assembled bioreactor chip was loaded into the imaging SPR detector, the latex tube part of the heteroporous microfluidic channel was connected to the peristaltic pump, the stainless steel tube corresponding to the injection chamber was connected to the sample pool through the latex tube, and the stainless steel tube corresponding to the output chamber was connected to the waste liquid pool through the latex tube.

[0101] S2) Mix the target and the second probe and prepare the gold ball solution: Use a 0.1mmol / L hydrochloric acid solution and a 0.1% volume concentration of DEPC water to prepare a pH 3.5 buffer solution, use the buffer solution to prepare a 200μmol / L second probe solution, mix 2mL of the second probe solution with 1mL of the prepared target solution and incubate for 1 hour to obtain a target-second probe mixed solution. Use a pH 3.5 buffer solution to mix the Ni 2+ The gold spheres of NTA were diluted to 2 nmol / L to obtain a gold sphere solution.

[0102] S3) Capturing the second probe: Using a peristaltic pump, the target-second probe mixed solution was passed through each hetero-pore microfluidic channel on the assembled bioreactor chip at a flow rate of 0.1 mL / min for 10 minutes.

[0103] S4) Fixing the gold balls: Use a peristaltic pump to pass the gold ball solution through each hetero-pore microfluidic channel of the assembled bioreactor chip at a flow rate of 0.2 mL / min for 10 minutes; S5) After stopping the flow rate of the gold ball solution, the solution was allowed to stand for 20 minutes, and then the washing solution was controlled to flow through each hetero-pore microfluidic channel of the gold ball enhanced hetero-pore microfluidic channel array bioreactor chip at a flow rate of 0.3 mL / min for 10 minutes to wash away the gold balls that were not specifically bound to the surface; S6) Using an imaging SPR detector to perform real-time detection on the gold ball sensitization type hetero-pore microfluidic array bioreactor chip during the process from step S3 to step S5 to obtain a detection signal.

[0104] Example 3

[0105] In this example, a bioreactor chip was prepared according to the same steps as in Example 1, and ssDNA extracted from cells was detected according to the same steps as in Example 2.

[0106] The difference between this embodiment and embodiment 1 and embodiment 2 is that: in this embodiment, ssDNA extracted from Hela cells is used as the sample to be detected. The sample to be detected includes target 126. The nucleotide sequences of the first probe Probe ssDNA 126, the second probe Probe ssDNA 126-2, and the target 126 are shown in SEQ ID NO.1, SEQ ID NO.7, and SEQ ID NO.4, respectively.

[0107] Example 4

[0108] In this example, a bioreactor chip was prepared according to the same steps as in Example 1, and ssDNA extracted from plasma was detected according to the same steps as in Example 2.

[0109] The difference between this embodiment and embodiment 1 and embodiment 2 is that: in this embodiment, ssDNA extracted from plasma is used as the sample to be detected. The sample to be detected includes target 106. The nucleotide sequences of the first probe Probe ssDNA 106, the second probe Probe ssDNA 106-2, and the target 106 are shown in SEQ ID NO.3, SEQ ID NO.9, and SEQ ID NO.6, respectively.

[0110] Comparative Example 1 This comparative example is a bioreactor chip with 12 same-hole microfluidic channels. In the bioreactor chip of this comparative example, the coupling mode between the structures is the same as that of the different-hole microfluidic channels. The only difference is the size of the groove on the side where the microfluidic channel reaction layer is attached to the substrate. In the same-hole microfluidic channel, 12 grooves are provided on the side where the microfluidic channel reaction layer is attached to the chip. Each groove is rod-shaped, 4 mm long, 1 mm wide, and 1 mm deep. Among them, the length of the groove refers to its size in the column direction.

[0111] In this comparative example, the nucleotide sequences of the first probe and the second probe are the same as those in Example 1.

[0112] Comparative Example 2 In this comparative example, ssDNA standards of different concentrations were detected using the bioreaction chip prepared in comparative example 1. The detection method and target nucleotide sequence in this comparative example were the same as those in Example 2.

[0113] Comparative Example 3 In this comparative example, the bioreactor chip prepared in Example 1 was used to detect ssDNA standards of different concentrations (the target sequence was the same as that in Example 2).

[0114] The difference between the detection method adopted in this comparative example and that in Example 2 is that in step S2, a buffer solution with a pH of 7.8 is used to prepare the mixed solution and the gold ball solution, that is, in this comparative example, ordinary gold balls are used instead of the sensitized gold balls.

[0115] The effects of the present invention are further described below in conjunction with the results of Examples 1 to 4 and Comparative Examples 1 to 3: 1. Comparison of specific signals for detecting ssDNA standard solution in the same-well and different-well microarray reaction systems Comparing the detection results of the same-well microfluidic array reaction generator (Comparative Example 2) and the different-well microfluidic array reaction generator (Example 2), when the concentration of the target is 1 μg / mL, the signal intensity of the reaction process of steps S3 to S5 in Example 2 and Comparative Example 2 is recorded using an SPR detector. The results are as follows: Figure 6 shown.

[0116] It can be seen that the mismatch signal in the same-well microarray (Comparative Example 2) accounts for 18% of the normal pairing signal (2200 / (14300-2200)), while the mismatch signal in the different-well microarray (Example 2) is only 8% (800 / (10803-800)), indicating that the different-well design of the microfluidic array reduces the mismatch signal, that is, reduces the nonspecific adsorption signal.

[0117] 2. Signal comparison of ssDNA standard solutions with different concentrations in hetero-well microarrays with and without enhanced gold balls Comparing the detection results using the enhanced gold ball (Example 2) and the ordinary gold ball (Comparative Example 3), when the ssDNA standard solution was diluted to 1000, 500, 100, 50, and 10 ng / mL respectively using the chip prepared in Example 1, the chip was loaded on the SPR detector and the signal intensity of the reaction process of step S4 to step S5 was recorded. The results are as follows: Figure 7 shown.

[0118] It can be seen that at the same concentration, compared with the ordinary gold sphere (Comparative Example 3), the sensitized gold sphere (Example 2) brings a larger signal response and higher sensitivity, indicating that the sensitized gold sphere improves the adsorption efficiency of the target.

[0119] 3. Signals in different areas of the sample chamber of each hetero-pore microfluidic channel Figure 4 The detection results of Example 2 are shown, in which the signal intensity of different areas in the sample outlet chamber of one heteropore microfluidic channel is shown. It can be seen that the gold spheres aggregate and settle as much as possible in the area around the large pore, leaving enough target and gold sphere specific binding areas in the middle of the large pore, thereby improving the specific binding.

[0120] 4. Detection of ssDNA concentration in cells and plasma When detecting ssDNA extracted from cells and plasma (Examples 3 and 4), the target signal was significantly different from the non-target signal.

[0121] In summary, the bioreactor chip provided by the present invention can detect single-stranded DNA with a base length of 20 to 80 nt and a concentration of 10 ng / mL to 1 μg / mL. A single-stranded DNA detection method using the bioreactor chip is provided. The method of the present invention not only reduces the possibility of gold ball aggregation and sedimentation, solves the problem of some nonspecific adsorption signals, but also enhances the binding effect between the target and the gold ball, and improves the adsorption efficiency of the target.

[0122] The above specific implementation modes are used to explain the present invention rather than to limit the present invention. Any modification and change made to the present invention within the spirit of the present invention and the protection scope of the claims shall fall within the protection scope of the present invention.

[0123] The above description is only a preferred embodiment of the present invention, so all equivalent changes or modifications made according to the structure, characteristics and principles described in the scope of the patent application of the present invention are included in the scope of the patent application of the present invention.

[0124] The nucleotide sequences involved in the present invention are as follows: SEQ ID NO.1: Name: Probe ssDNA 126 nucleotide sequence DNA type: DNA (other DNA) Organism source: synthetic construct Sequence: CGCATTATTACTCACGGTACGA-SH SEQ ID NO.2: Name: Probe ssDNA-21 nucleotide sequence DNA type: DNA (other DNA) Organism source: synthetic construct Sequence: TCAACATCAGTCTGATAAGCTA-SH SEQ ID NO.3: Name: Probe ssDNA 106 nucleotide sequence DNA type: DNA (other DNA) Organism source: synthetic construct Sequence: AGACGTGACAGTCGTGAAAT-SH SEQ ID NO.4: Name: Nucleotide sequence of target 126 DNA type: DNA (other DNA) Organism source: synthetic construct Sequence: TCGTACCGTGAGTAATAATGCG SEQ ID NO.5: Name: Nucleotide sequence of target 21 DNA type: DNA (other DNA) Organism source: synthetic construct Sequence: TAGCTTATCAGACTGATGTTGA SEQ ID NO.6: Name: Nucleotide sequence of target 106 DNA type: DNA (other DNA) Organism source: synthetic construct Sequence: ATTTCACGACTGTCACGTCT SEQ ID NO.7: Name: Probe ssDNA 126-2 nucleotide sequence DNA type: DNA (other DNA) Organism source: synthetic construct Sequence: His-ATCGAATAGTCTTCGTACCGTGAGTAATAATGCG SEQ ID NO.8: Name: Probe ssDNA-21-2 nucleotide sequence DNA type: DNA (other DNA) Organism source: synthetic construct Sequence: His-AGCATGGCATCTTAGCTTATCAGACTGATGTTGA SEQ ID NO.9: Name: Nucleotide sequence of Probe ssDNA 106-2 DNA type: DNA (other DNA) Organism source: synthetic construct Sequence: His-ATTTCACGACTGATTTCACGACTGTCACGTCT.

Claims

1. A gold ball sensitized hetero-pore microfluidic array bioreactor chip, characterized in that: The invention comprises at least one reaction chamber, wherein the reaction chamber is mainly composed of an injection chamber, a flow channel and an outlet chamber, wherein the injection chamber and the outlet chamber are arranged at intervals, a flow channel is arranged on a center line connecting the injection chamber and the outlet chamber, and the injection chamber is connected with the outlet chamber through the flow channel; the diameter of the injection chamber is smaller than the diameter of the outlet chamber, and the width of the flow channel is the same as the diameter of the injection chamber.

2. The gold ball sensitized hetero-pore microfluidic array bioreactor chip according to claim 1, characterized in that: The depths of the sample inlet chamber, the flow channel and the sample outlet chamber are the same, and the diameter ratio of the sample inlet chamber to the sample outlet chamber is 1:

2.

3. The gold ball sensitized hetero-pore microfluidic array bioreactor chip according to claim 1, characterized in that: The inner bottom surface of the reaction chamber is fixed with a first probe and sealed. The injection chamber and the output chamber are respectively connected to the outside. After the sample solution is injected into the injection chamber, it flows into the output chamber through the flow channel and then flows out of the output chamber. The pH of the sample solution is 3-4. The sample solution includes a mixed solution of the sample to be detected, the second probe and a gold ball solution.

4. The gold ball sensitization type hetero-pore microfluidic array bioreaction chip according to claim 3, characterized in that: The sample to be detected contains a target, which is a single-stranded DNA with a base length of 20 to 80 nt, and a concentration of the target in a mixed solution of 10 ng / mL to 1 μg / mL; the gold ball is a gold nanoparticle modified with nickel ions and nitrilotriacetic acid, with a concentration range of 1 to 10 nmol / L and a particle size range of 1.8 to 10 nm.

5. The gold ball sensitized hetero-pore microfluidic array bioreactor chip according to claim 1, characterized in that: The bioreactor chip is mainly composed of a substrate, a microfluidic reaction layer and an interface layer stacked in sequence from bottom to top; a gold film is arranged on the top surface of the substrate, at least one hetero-pore microfluidic channel is arranged on the bottom surface of the microfluidic reaction layer, each hetero-pore microfluidic channel and the substrate enclose a reaction chamber, and a plurality of stainless steel tubes are arranged through the interface layer; The hetero-pore microfluidic channel is mainly composed of two columnar grooves and one cubic groove. The two columnar grooves are arranged at intervals and connected by the cubic groove. Each columnar groove is connected to the outside through a corresponding stainless steel tube. The diameters of the two columnar grooves are different. The first columnar groove with a smaller diameter is combined with the base to form an injection chamber, and the second columnar groove with a larger diameter is combined with the base to form an output chamber. The cubic groove and the base are combined to form a flow channel. The cubic groove is arranged on the line connecting the centers of the two columnar grooves, and its width is the same as the diameter of the first columnar groove.

6. A detection method using the gold ball sensitization type hetero-pore microfluidic array bioreaction chip as claimed in any one of claims 1 to 4, characterized in that: The detection method comprises the following steps: S1) fixing and sealing the first probe on the surface of the substrate, and then assembling to obtain a gold ball enhanced sensitization type hetero-pore microfluidic array bioreaction chip; S2) preparing a gold ball solution and a mixed solution of a sample to be detected and a second probe, wherein the sample to be detected contains a target; The pH of the gold ball solution and the mixed solution are both 3-4; S3) controlling the mixed solution to pass through each hetero-pore microfluidic channel of the gold ball enhanced hetero-pore microfluidic channel array bioreactor chip; S4) controlling the gold ball solution to pass through each hetero-pore microfluidic channel of the gold ball sensitization hetero-pore microfluidic channel array bioreactor chip; S5) after standing still, controlling the washing liquid to pass through each hetero-pore microfluidic channel of the gold ball enhanced hetero-pore microfluidic channel array bioreactor chip; S6) Using optical detection equipment to detect the gold ball sensitization type hetero-pore microfluidic array bioreactor chip to obtain a detection signal.

7. The detection method according to claim 6, characterized in that: In the step S3, the flow rate is 0.1-0.5 mL / min, and the passing time is 10-20 min; in the step S4, the flow rate is 0.2-0.5 mL / min, and the passing time is 10-20 min; in the step S5, the mixture is allowed to stand for 10-20 min.

8. The detection method according to claim 6, characterized in that: The concentration of the target in the mixed solution is 10 ng / mL to 1 μg / mL; the target is single-stranded DNA, and the base length of the target is 20 to 80 nt.

9. The detection method according to claim 6, characterized in that: The first probe is a single-stranded DNA containing a target complementary fragment and having a thiol group modified at the end; the second probe is a single-stranded DNA having a histidine tag modified at the first end and having a complementary base pairing with the first probe at the end.

10. An application of the gold ball enhanced sensitization type hetero-pore microfluidic array bioreaction chip as claimed in any one of claims 1 to 4 in detecting nucleic acid molecules, characterized in that: The nucleic acid molecule is a single-stranded DNA, and the base length of the single-stranded DNA is 20-80 nt.

Images