Recombinant yeast and application thereof in fermentation production of beta-elemene

Abstract

The invention relates to the technical field of microorganisms, and particularly discloses recombinant saccharomycetes and application thereof in fermentation production of beta-elemene. Compared with a starting yeast strain, the recombinant yeast provided by the invention expresses farnesyl diphosphate synthase ERG20, sesquiterpene synthase LsLTC2 from lettuce and difunctional farnesyl diphosphate synthase RrFPS from rose, and expresses IDI1, ERG13, ERG8, ERG10, ERG12, MVD1 and tHMGR in peroxisome. Preferably, the expression quantity of squalene synthase ERG9 in a cell matrix is further reduced, ERG10, ERG13 and IDI1 are overexpressed, and XFPK, PTA, POXB and ACS are expressed. The recombinant saccharomycetes disclosed by the invention can efficiently produce the beta-elemene, and a more effective method is provided for industrial production of the beta-elemene.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, in particular to a recombinant yeast and application thereof in fermentation production of beta-elemene. Background Art

[0002] β-elemene is one of the effective ingredients of the traditional Chinese medicine Curcuma longifolia, which has anti-inflammatory, antibacterial, and anti-tumor pharmacological activities. At present, β-elemene injection is widely used in the clinic to treat lung cancer, liver cancer, esophageal cancer, nasopharyngeal cancer and other malignant tumors. It has the characteristics of small toxic side effects, small impact on normal cells and surrounding white blood cells, and helps chemotherapy and radiotherapy drugs enter cancer tissues to exert their effects.

[0003] With the increasing market demand for β-elemene, the traditional extraction and separation method of β-elemene from the natural plant Curcuma australis can no longer meet the market demand, and the products obtained by extraction and separation have problems such as low yield and low purity, and the cost of secondary separation is high. The synthesis of β-elemene by chemical synthesis requires the use of highly toxic chemical reagents such as dichloromethane, sodium cyanide, and toluene, which is not conducive to environmental protection; the reaction conditions of chemical synthesis are difficult to achieve, and the product yield is also very low.

[0004] With the development of biotechnology, synthetic biology has received more and more attention. By recombining the biosynthetic pathway of natural compounds in microbial chassis cells, natural products and their intermediates can be obtained quickly and in large quantities, providing a new method for the development and application of natural active products of plants. Microorganisms have the advantages of fast growth, short fermentation cycle, and low fermentation cost. Compared with plants, their genetic background is clearer, which is conducive to genetic modification. Therefore, it is necessary to study how to construct recombinant bacteria that can efficiently ferment and produce β-elemene. Summary of the invention

[0005] One of the purposes of the present invention is to provide a new recombinant yeast and its application in the fermentation production of β-elemene.

[0006] The invention provides a recombinant yeast, which, compared with a starting yeast strain, expresses farnesyl diphosphate synthase ERG20, sesquiterpene synthase LsLTC2 derived from lettuce and bifunctional farnesyl diphosphate synthase RrFPS derived from rose, and expresses IDI1, ERG13, ERG8, ERG10, ERG12, MVD1 and tHMGR in peroxisomes.

[0007] The present invention specifically discovered that the fermentation yield of β-elemene can be significantly increased by expressing farnesyl diphosphate synthase ERG20, a specific exogenous sesquiterpene synthase LsLTC2 and a bifunctional farnesyl diphosphate synthase RrFPS in yeast, and expressing endogenous MVA pathway key gene encoding enzymes in peroxisomes.

[0008] Preferably, the expression of the target protein is increased by integrating multiple copies of the target gene into the yeast genome, for example, 8 copies of the ERG20 and LsLTC2 genes (2 copies of which are integrated into the rDNA site of the yeast chromosome and 6 copies of which are integrated into the delta site) and 6 copies of the RrFPS gene are integrated into the yeast genome.

[0009] Preferably, the recombinant yeast of the present invention, compared with the starting yeast strain, further comprises one or more of the following changes in the cell matrix: (1) The expression of squalene synthase ERG9 was downregulated; (2) Overexpression of ERG10 and ERG13; (3) Expression of XFPK and PTA; (4) Overexpression of IDI1; (5) Expression of POXB and ACS.

[0010] Further down-regulating the expression of ERG9, or over-expressing ERG10 and ERG13, or expressing XFPK and PTA, or over-expressing IDI1, or expressing POXB and ACS in the cell matrix can further increase the fermentation yield of β-elemene.

[0011] More preferably, three copies of ERG20 and LsLTC2 genes, one copy of ERG10, ERG13, XFPK, PTA, POXB and ACS genes and two copies of IDI1 gene are integrated into the yeast genome to obtain a better fermentation yield of β-elemene.

[0012] In the recombinant yeast of the present invention, the GenBank accession number of the farnesyl diphosphate synthase ERG20 is NP_012368.1; the GenBank accession number of the gene encoding the sesquiterpene synthase LsLTC2 derived from lettuce is AF489964.1; the GenBank accession number of the gene encoding the bifunctional farnesyl diphosphate synthase RrFPS derived from rose is KP768082.1; The GenBank accession number of the IDI1 is NP_015208.1; the GenBank accession number of the ERG13 is NP_013580.1; the GenBank accession number of the ERG8 is NP_013947.1; the GenBank accession number of the ERG10 is NP_015297.1; the GenBank accession number of the ERG12 is NP_013935.1; the GenBank accession number of the MVD1 is NP_014441.1; the GenBank accession number of the tHMGR is JX648390.1; The GenBank accession number of the squalene synthase ERG9 is NP_012060.1; the GenBank accession number of the XFPK is CBL90649.1; the GenBank accession number of the PTA is QBJ74152.1; the GenBank accession number of the POXB is NP_418139.1; and the GenBank accession number of the coding gene of the ACS is AT5G36880.

[0013] The present invention also provides a method for constructing a recombinant yeast for producing β-elemene, comprising causing a starting yeast strain to express farnesyl diphosphate synthase ERG20, a sesquiterpene synthase LsLTC2 derived from lettuce, and a bifunctional farnesyl diphosphate synthase RrFPS derived from rose, and expressing IDI1, ERG13, ERG8, ERG10, ERG12, MVD1, and tHMGR in peroxisomes.

[0014] The method of the present invention further comprises the step of causing the starting yeast strain to contain one or more of the following changes in the cell matrix: (1) The expression of squalene synthase ERG9 was downregulated; (2) Overexpression of ERG10 and ERG13; (3) Expression of XFPK and PTA; (4) Overexpression of IDI1; (5) Expression of POXB and ACS.

[0015] The method of the present invention specifically comprises: (1) The genes encoding farnesyl diphosphate synthase ERG20 and lettuce-derived sesquiterpene synthase LsLTC2 were fused to construct the fusion gene ERG20~LcLTC2; (2) Integrating two copies of the fusion gene ERG20~LcLTC2 into the rDNA site of the starting yeast strain to obtain the yeast strain YB-1; (3) The C-termini of the key genes of the MVA pathway endogenous to Saccharomyces cerevisiae, IDI1, ERG13, ERG8, ERG10, ERG12, MVD1, and tHMGR, were respectively inserted into the ePTS1 localization signal peptide gene and integrated into the TY3 site of the chromosome of the yeast strain YB-1 to obtain the yeast strain YB-2; (4) Integrating 6 copies of the fusion gene ERG20~LcLTC2 into the delta site of the chromosome of the yeast strain YB-2 to obtain the yeast strain YB-3; (5) Six copies of the gene encoding the bifunctional farnesyl diphosphate synthase RrFPS from rose were integrated into the gal80 site of the chromosome of the yeast strain YB-3 to obtain the yeast strain YB-4.

[0016] Preferably, the method of the present invention further comprises: (6) inserting a ubiquitination tag UbiF into the N-terminus of the gene encoding squalene synthase ERG9 of the yeast strain YB-4, and replacing the ERG9 promoter with the HXT1 promoter to obtain the yeast strain YB-5, wherein the sequence of the ubiquitination tag UbiF is shown in SEQ ID No.88.

[0017] More preferably, the method of the present invention further comprises one or more of the following steps: (7) integrating three copies of the fusion gene ERG20~LcLTC2 into the X2 site of the yeast strain YB-5 to obtain the yeast strain YB-6; (8) integrating ERG10 and ERG13 genes into the X3 site of the yeast strain YB-6 to obtain the yeast strain YB-7; (9) integrating XFPK and PTA genes into the LPP1 site of the yeast strain YB-7 to obtain the yeast strain YB-8; (10) integrating two copies of the IDI1 gene into the DPP1 locus of the yeast strain YB-8 to obtain the yeast strain YB-9; (11) Integrate POXB and ACS genes into the ROX1 locus of the yeast strain YB-9 to obtain the yeast strain YB-10.

[0018] The present invention also provides the use of the above recombinant yeast or the recombinant yeast constructed by the above method in fermentation production of β-elemene or in genetic breeding of microorganisms for producing β-elemene.

[0019] The present invention also provides a method for producing β-elemene by fermentation, which comprises the step of culturing the above recombinant yeast or the recombinant yeast constructed by the above method.

[0020] The beneficial effects of the present invention are at least: The present invention provides a new recombinant yeast for the fermentation production of β-elemene, which can efficiently produce β-elemene and provides a more effective method for the industrial production of β-elemene. DETAILED DESCRIPTION

[0021] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0022] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources or prepared according to conventional methods in the art. The genes mentioned in the examples, unless otherwise specified, are the complete coding frame regions of the genes. All can be obtained from NCBI, and the promoter and terminator sequences mentioned can also be downloaded from NCBI, and the specific sequence starting position can be learned from the primers in the primer table.

[0023] The fermentation conditions in the present invention are pH=5 unless otherwise specified, the composition of the culture medium is glucose: 50 g / L, tryptone: 10 g / L, yeast extract: 20 g / L, uracil: 0.2 g / L, the culture temperature is 30°C, n-dodecane is added according to 10% of the volume of the culture medium 12 hours after inoculation, and after shake flask fermentation for 7 days, the upper organic phase is taken to detect the product.

[0024] The samples and detection and processing methods of β-elemene and branched metabolites produced by yeast cells in the present invention are as follows: β-elemene product extraction and analysis: The fermented bacterial liquid was transferred to a 50 mL clean centrifuge tube and centrifuged at 12000 r / min. -1 Centrifuge for 10 minutes, extract the upper organic phase, and filter through a 0.22μm filter membrane for β-elemene product detection (can be diluted with n-hexane). The chromatographic conditions for β-elemene are Agilent HP-5 capillary column (0.25mm×30m, 0.25μm), helium as carrier gas, and a flow rate of 1.5mL·min -1 , injection port temperature 280℃, splitless injection, injection volume 1μL, programmed temperature (starting temperature 80℃ for 1min; 20℃·min -1 The temperature was raised to 180℃ at a speed of 20℃·min and maintained for 3min. -1The temperature was raised to 280°C at a speed of 100 °C and maintained for 6 min); the mass spectrometry conditions were electron impact ion source (EI), electron energy 70 eV, ion source temperature 230°C, quadrupole temperature 150°C, acceleration voltage 5 kV, multiple reaction monitoring (MRM) mode scanning (m / z 161.1-93.1), solvent delay 3 min, and mass spectrometry scanning range of m / z 40-450.

[0025] Squalene and ergosterol product extraction and analysis: After the fermentation in the shake flask is completed, 1 mL is taken and stirred at 12000 r·min. -1 Centrifuge for 1 min, remove the supernatant, add 0.5 g glass beads and 300 μL ethyl acetate, vortex mix, grind at 70 Hz for 960 s (stop for 10 s every 120 s), add 700 μL ethyl acetate after grinding, and extract by ultrasonic for 30 min at 12000 r·min -1 Centrifuge for 15 minutes, filter through a 0.22 μm filter membrane, take 50 μL of the supernatant and evaporate to dryness, add 50 μL of the derivatization reagent, place in a metal bath at 80°C for 30 minutes, and use GC-MS to detect the contents of squalene and ergosterol.

[0026] The chromatographic conditions for squalene and ergosterol were an Agilent HP-5 capillary column (0.25 mm × 30 m, 0.25 μm), helium as carrier gas, flow rate of 1.5 mL / min, injection port temperature of 300 °C, splitless injection, injection volume of 1 μL, programmed temperature (starting temperature 80 °C, hold for 1 min; temperature increased to 280 °C at a rate of 20 °C / min, hold for 15 min; temperature increased to 300 °C at a rate of 20 °C / min, hold for 5 min), mass spectrometry conditions were electron impact ion source (EI), electron energy 70 eV, ion source temperature 230 °C, quadrupole temperature 150 °C, acceleration voltage 8 kV, MRM mode scanning (squalene m / z 136.9~95.1, ergosterol m / z 336.8~69.1), solvent delay 5 min, and mass spectrometry scanning range of m / z 40~450.

[0027] Example 1 β - Genes required for elemene synthesis and acquisition of yeast's own genetic elements in modular regulation Fresh lettuce was used as material, RNA was extracted by a method known in the art, and cDNA was obtained by reverse transcription. According to conventional methods in the art, primers of LsLTC2 gene (GenBank accession number AF489964.1) were designed to amplify the above-mentioned fragment; the genome of Saccharomyces cerevisiae CEN.PK2-1D was used as a template, primers of ERG20 (GenBank accession number NP_012368.1) gene fragment were designed to amplify the above-mentioned gene fragment in yeast.

[0028] Example 2 β - Genes required for elemene synthesis and acquisition of expression clusters composed of yeast's own gene elements in modular regulation Specifically, the expression cluster refers to promoter + gene fragment sequence + terminator. The construction of the further expression cluster is divided into two steps: first, the gene fragment with the vector homology arm is amplified, the pEASY-Blunt-Pgal2-tHMGR-Tfbaxt1 vector (recorded in Zhang Xiaoli, Chao Erkun, Sun Mengchu, et al. Comparative study on the metabolic flux of MVA in Saccharomyces cerevisiae from tHMGR from three different plant sources [J]. Chinese Journal of Traditional Chinese Medicine, 2022, 47(10): 2614-2622.) is reversely amplified, the gene fragment is seamlessly connected to the vector, and the plasmid (containing the expression cluster) is constructed. The primers used are shown in Table 1.

[0029] The gene fragments amplified in Example 1 were connected to the promoter and terminator by seamless connection to construct expression clusters of the corresponding genes, specifically, Pgal1-ERG20~LsLTC2-Tcyc1; Pgal10-ERG20~LsLTC2-Tadh1; Pgal2-ERG20~LsLtc2-Tfbaxt1.

[0030] In each expression cluster, ERG20 and elemene synthase LsLTC2 were fused with a short peptide chain GGGGS (SEQ ID No. 133, nucleic acid sequence GGCGGCGGCGGCAGC (SEQ ID No. 1)) as a connecting peptide, and the ERG20 terminator TAA was removed during the fusion.

[0031] Table 1 (SEQ ID No.2-10)

[0032] Example 3 Creation of a synthetic pathway for β-elemene in yeast The Pgal1-ERG20~LsLTC2-Tcyc1 gene expression cluster prepared in Example 2 was integrated into the rDNA site of the yeast chromosome in the form of homologous recombination.

[0033] Specifically, the vector carrying the expression cluster obtained in Example 2 was used as a template, and the Pgal1-ERG20~LsLTC2-Tcyc1 gene expression cluster carrying the homologous arms was amplified using the primers in Table 2. Then, two copies of the farnesyl diphosphate synthase ERG20 and sesquiterpene synthase genes were integrated into the rDNA site of the Saccharomyces cerevisiae CEN.PK2-1D genome by homologous recombination. Positive clones were detected by PCR, and the ability of the positive clone strains to produce β-elemene by fermentation was detected. The resulting yeast strain was named YB-1.

[0034] Table 2 (SEQ ID No.11-20)

[0035] Example 4 Obtaining β-elemene-producing Saccharomyces cerevisiae strain YB-2 Using Saccharomyces cerevisiae YB-1 as the starting strain, PCR amplification was performed to obtain the key genes of the endogenous MVA pathway IDI1 (the protein encoded by the GenBank accession number is NP_015208.1), ERG13 (the protein encoded by the GenBank accession number is NP_013580.1), ERG8 (the protein encoded by the GenBank accession number is NP_013947.1), ERG10 (the protein encoded by the GenBank accession number is NP_015297.1), ERG12 (the protein encoded by the GenBank accession number is NP_013935.1), MVD1 (the protein encoded by the GenBank accession number is NP_014441.1), and tHMGR (the protein encoded by the GenBank accession number is JX648390.1), and they were ligated into the GAL1 promoter and CYC1 promoter of the pESC-his vector, respectively. terminator (BamHI-SacⅡ position), construct a plasmid, and then insert the ePTS1 localization signal peptide gene fragment (TTGGGAAGAGGTAGAAGATCCAAATTGTAG, SEQ ID No.21) into the C-terminus of each gene. The construction method refers to Example 2. Further referring to the method of Example 3, the plasmid was amplified with the primers in Table 3 to obtain a gene cluster carrying homologous arms, and expression cassettes Pgal1-IDI1-Tcyc1, Pgal2-ERG13-Tfbaxt1, Pgal1-ERG8-Tcyc1, Pgal10-ERG10-Tadh1, Pgal2-ERG12-Tfbaxt1, Ptef1-MVD1-Tpgk1, and Ppgk1-tHMGR-Tadh1 were constructed, and then they (containing 7 gene fragments) were integrated into the TY3 site of Saccharomyces cerevisiae YB-1 by homologous recombination to obtain strain YB-2, whose β-elemene production was 55.74 mg / L.

[0036] Table 3 (SEQ ID No.22-55)

[0037] Example 5 Obtaining β-elemene-producing Saccharomyces cerevisiae strain YB-3 Referring to the method of Example 3, the plasmid containing the Pgal1-ERG20~LsLtc2-Tcyc1, Pgal10-ERG20~LsLtc2-Tadh1, and Pgal2-ERG20~LsLtc2-Tfbaxt1 expression clusters constructed in Example 2 was amplified with the primers in Table 4 to obtain a gene cluster carrying homologous arms, and these fragments were respectively integrated into the delta site of Saccharomyces cerevisiae YB-2 in the form of two copies by homologous recombination to obtain strain YB-3, whose β-elemene production was 91.88 mg / L.

[0038] Table 4 (SEQ ID No.56-73)

[0039] Example 6 Obtaining β-elemene-producing Saccharomyces cerevisiae strain YB-4 Using Saccharomyces cerevisiae YB-1 as the starting strain, PCR amplification was performed to obtain the ERG20 gene encoding the phosphate synthase. The literature was consulted to sort out the ERG20 isozymes from different plant sources. Specifically, bifunctional farnesyl diphosphate synthases that can catalyze IPP and DMAPP to produce FPP were cloned from seven plant species, namely Arabidopsis thaliana, rose, Artemisia annua, Centella asiatica, hops, alfalfa and ginseng. They are AtFPS (GenBank accession number At4g17190), RrFPS (GenBank accession number KP768082.1), AaFPS (GenBank accession number AF112881.1), CaFPS (GenBank accession number AY787627.1), HiFPS (GenBank accession number AB053487.1), MsFPS (GenBank accession number gU361537.1) and PgFPS (GenBank accession number PG361537.1). Accession number DQ087959.1), respectively connected them to the vector pESC-his, between the GAL1 promoter and the CYC1 terminator (BamHI-SacⅡ position), to construct plasmids, and then transformed into the YB-1 strain to obtain the strains. YB -1 -At、YB -1 -Rr、 YB- 1 -Aa、YB- 1 -Ca、YB- 1 -Hi、YB- 1 -Ms and YB- 1 -Pg , and their yields were fermented and verified. The results are shown in Table 5.

[0040] Table 5 7 types FPS Import YB-1 strain positive bacteria fermentation production of β-elemene, squalene, ergosterol and OD 600 Value Result

[0041] The best isozyme screened out was RrFPS, and then the corresponding gene clusters Pgal1-RrFPS-Tcyc1 and Pgal10-RrFPS-Tadh1 were constructed in the pESC-his vector (the construction method refers to Example 2). Further referring to the method in Example 3, the gene clusters carrying homologous arms were amplified using the primers in Table 6, and integrated into the gal80 site on the yeast chromosome of YB-3 in the form of 3 copies to obtain strain YB-4. After shake flask fermentation, the yield reached 246.2 mg / L.

[0042] Table 6 (SEQ ID No.74-87)

[0043] Example 7 Obtaining β-elemene-producing yeast strain YB-5 According to the yeast's own metabolism, the more the β-elemene precursor FPP accumulates, the more flow it has to this pathway. Therefore, the present invention reduces the consumption of FPP by downregulating the expression of the competitive pathway ERG9 (ERG9 converts FPP into squalene for the synthesis of sterols). Specifically, the ubiquitination tag UbiF (SEQ ID No. 88) is inserted into the N-terminus of the ERG9 (GenBank accession number NP_012060.1) gene of the strain YB-4, and the ERG9 promoter is replaced with the HXT1 promoter (described in Tangh, Wu Y, Deng J, et al. Promoter Architecture and Promoter Engineering insaccharomycescerevisiae.metabolites. 2020;10(8):320. Published 2020 Aug 6.). The tag UbiF can recruit ubiquitinase to reduce the expression of the ERG9 gene, and the yeast strain YB-5 is obtained. After shake flask fermentation, the yield reaches 442.59 mg / L.

[0044] Example 8 Obtaining β-elemene-producing yeast strain YB-6 The sesquiterpene synthase gene LsLTC2 described in Example 1 was enhanced in the YB-5 strain. Specifically, the corresponding gene clusters Pgal10-E20~LsLTC2-Tadh1 and Pgal1-E20~LsLTC2-Tcyc1 were constructed in the pESC-his vector (the construction method refers to Example 2). Referring to the method in Example 3, the gene clusters carrying homologous arms were amplified using the primers in Table 7, and the two Pgal1-E20~LsLTC2-Tcyc1 and one Pgal10-E20~LsLTC2-Tadh1 gene clusters carrying homologous arms were integrated into the genome of the strain YB-5 by homologous recombination, so that three copies of the farnesyl diphosphate synthase ERG20 and the sesquiterpene synthase gene were integrated into the X2 site of the genome of the strain YB-5, to obtain the strain YB-6, and the final yield of β-elemene in shake flask fermentation reached 825.46 mg / L.

[0045] Table 7 (SEQ ID No.89-100)

[0046] Example 9 Obtaining β-elemene-producing yeast strain YB-7 ERG10 (GenBank accession number NP_015297.1) and ERG13 (GenBank accession number NP_013580.1) genes were integrated into the X3 site of the YB-6 strain. The specific method is as follows: ERG10 gene and ERG13 gene were constructed on the pESC-his empty vector, specifically, ERG10 gene was constructed after the gal1 promoter, and ERG13 gene was constructed after the gal10 promoter, and then the vector constructed with ERG10 gene and ERG13 gene was used as a template, and the primers in Table 8 were used for amplification to obtain a large fragment containing ERG10 gene and ERG13 gene, and then the large fragment was integrated into the X3 site on the YB-6 genome of Saccharomyces cerevisiae by homologous recombination. Finally, the yeast strain YB-7 was obtained, and the yield reached 900.3 mg / L after shake flask fermentation.

[0047] Table 8 (SEQ ID No.101-108)

[0048] Example 10 Obtaining β-elemene-producing yeast strain YB-8 The non-oxidative phosphorylation gene XFPK (GenBank accession number CBL90649.1) and PTA (GenBank accession number QBJ74152.1) genes were integrated into the LPP1 site of the YB-7 strain. The specific method is as follows: XFPK gene and PTA gene were constructed on the pESC-his empty vector, specifically one XFPK gene was constructed after the gal1 promoter, and another PTA gene was constructed after the gal10 promoter, and the primers in Table 9 were used for amplification to obtain a large fragment containing XFPK and PTA genes, and then the large fragment was integrated into the LPP1 site on the YB-7 genome of Saccharomyces cerevisiae by homologous recombination, and finally the yeast strain YB-8 was obtained, and the yield reached 1039.5 mg / L after shake flask fermentation.

[0049] Table 9 (SEQ ID No.109-116)

[0050] Example 11 Obtaining β-elemene-producing yeast strain YB-9 Two copies of the IDI1 (GenBank accession number NP_015208.1) gene were integrated into the DPP1 site of the YB-8 strain. The specific method is as follows: two IDI1 genes were constructed on the pESC-his empty vector, specifically one IDI1 gene was constructed after the gal1 promoter, and the other IDI1 gene was constructed after the gal10 promoter. Then, the vector constructed with two IDI1 genes was used as a template, and the primers in Table 10 were used for amplification to obtain a large fragment containing two IDI1 genes, and then the large fragment was integrated into the DPP1 site on the YB-8 genome of Saccharomyces cerevisiae by homologous recombination. Finally, the yeast strain YB-9 was obtained, and the yield reached 1145.59 mg / L after shake flask fermentation.

[0051] Table 10 (SEQ ID No.117-124)

[0052] Example 12 Obtaining β-elemene-producing yeast strain YB-10 The POXB (GenBank accession number NP_418139.1) and ACS (GenBank accession number AT5G36880) genes were integrated into the ROX1 site of the YB-9 strain. The specific method is as follows: the POXB gene and the ACS gene were constructed on the pESC-his empty vector, respectively, and the POXB gene was constructed after the gal1 promoter, and the ACS gene was constructed after the gal10 promoter. Then, the vector constructed with the POXB gene and the ACS gene was used as a template, and the primers in Table 11 were used for amplification to obtain a large fragment containing the POXB gene and the ACS gene, and then the large fragment was integrated into the ROX1 site on the Yeast Saccharomyces cerevisiae YB-9 genome by homologous recombination. Finally, the yeast strain YB-10 was obtained, and the yield reached 1336.45 mg / L after shake flask fermentation.

[0053] Table 11 (SEQ ID No.125-132)

[0054] Embodiment 13 Fermentation tank optimization: 1. Online monitoring and dynamic regulation: The online monitoring system monitors key parameters in the fermentation process (such as pH value, dissolved oxygen concentration, temperature, etc.) in real time, and makes dynamic adjustments based on the data.

[0055] 2. Optimize the feeding strategy: Accurately add nutrients according to the bacterial growth stage and metabolic needs. For example, during the fermentation process, the feeding rate is adjusted to keep the ethanol content below 0.5g / L to avoid ethanol accumulation and inhibition of bacterial growth.

[0056] 3. Fermentation parameter adjustment: Optimize the ventilation volume and stirring speed of the fermentation tank to meet the needs of different fermentation stages. For example, during the fermentation process, the dissolved oxygen can be controlled above 30% by adjusting the stirring speed and ventilation volume.

[0057] 4. In a 3 L fermenter, by optimizing the fermentation conditions (pH 5.0-6.5, dissolved oxygen 30%-50%, temperature 28-30°C), 300 mL of bacterial solution was inoculated into Delft medium (conventional commercial product, containing 2.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L mgSO4·7H2O, 20 g / L glucose, trace elements and vitamins, etc.), and the initial OD 600When the concentration of ethanol was 0.4, it was inoculated into the fermentation medium. After 12 hours of fermentation, 600g / L galactose mother solution was added to make the galactose concentration in the tank reach 20g / L. After 24 hours, ethanol was added to maintain the ethanol concentration at 3-5g / L, and 10% n-dodecane was added for two-phase fermentation. After 7 days of fermentation, the β-elemene production of YB-10 strain reached 20.545g / L.

[0058] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A recombinant yeast, characterized in that: Compared with the starting yeast strain, it expressed farnesyl diphosphate synthase ERG20, sesquiterpene synthase LsLTC2 from lettuce and bifunctional farnesyl diphosphate synthase RrFPS from rose, and expressed IDI1, ERG13, ERG8, ERG10, ERG12, MVD1 and tHMGR in peroxisomes.

2. The recombinant yeast according to claim 1, characterized in that Compared to the starting yeast strain, the cell matrix also includes one or more of the following changes: (1) The expression of squalene synthase ERG9 was downregulated; (2) Overexpression of ERG10 and ERG13; (3) Expression of XFPK and PTA; (4) Overexpression of IDI1; (5) Expression of POXB and ACS.

3. The recombinant yeast according to claim 2, characterized in that The GenBank accession number of the farnesyl diphosphate synthase ERG20 is NP_012368.1; the GenBank accession number of the gene encoding the sesquiterpene synthase LsLTC2 from lettuce is AF489964.1; the GenBank accession number of the gene encoding the bifunctional farnesyl diphosphate synthase RrFPS from rose is KP768082.1; The GenBank accession number of the IDI1 is NP_015208.1; the GenBank accession number of the ERG13 is NP_013580.1; the GenBank accession number of the ERG8 is NP_013947.1; the GenBank accession number of the ERG10 is NP_015297.1; the GenBank accession number of the ERG12 is NP_013935.1; the GenBank accession number of the MVD1 is NP_014441.1; the GenBank accession number of the tHMGR is JX648390.1; The GenBank accession number of the squalene synthase ERG9 is NP_012060.1; the GenBank accession number of the XFPK is CBL90649.1; the GenBank accession number of the PTA is QBJ74152.1; the GenBank accession number of the POXB is NP_418139.1; and the GenBank accession number of the coding gene of the ACS is AT5G36880.

4. A method for constructing a recombinant yeast for producing β-elemene, characterized in that: The method comprises making the starting yeast strain express farnesyl diphosphate synthase ERG20, sesquiterpene synthase LsLTC2 derived from lettuce and bifunctional farnesyl diphosphate synthase RrFPS derived from rose, and expressing IDI1, ERG13, ERG8, ERG10, ERG12, MVD1 and tHMGR in peroxisomes.

5. The method according to claim 4, characterized in that The method further comprises the step of causing the starting yeast strain to contain one or more of the following changes in the cell matrix: (1) The expression of squalene synthase ERG9 was downregulated; (2) Overexpression of ERG10 and ERG13; (3) Expression of XFPK and PTA; (4) Overexpression of IDI1; (5) Expression of POXB and ACS.

6. The method according to claim 4 or 5, characterized in that: include: (1) The genes encoding farnesyl diphosphate synthase ERG20 and lettuce-derived sesquiterpene synthase LsLTC2 were fused to construct the fusion gene ERG20~LcLTC2; (2) Integrating two copies of the fusion gene ERG20~LcLTC2 into the rDNA site of the starting yeast strain to obtain the yeast strain YB-1; (3) The C-termini of the key genes of the MVA pathway endogenous to Saccharomyces cerevisiae, IDI1, ERG13, ERG8, ERG10, ERG12, MVD1, and tHMGR, were respectively inserted into the ePTS1 localization signal peptide gene and integrated into the TY3 site of the chromosome of the yeast strain YB-1 to obtain the yeast strain YB-2; (4) Integrating 6 copies of the fusion gene ERG20~LcLTC2 into the delta site of the chromosome of the yeast strain YB-2 to obtain the yeast strain YB-3; (5) Six copies of the gene encoding the bifunctional farnesyl diphosphate synthase RrFPS from rose were integrated into the gal80 site of the chromosome of the yeast strain YB-3 to obtain the yeast strain YB-4.

7. The method according to claim 6, characterized in that Also includes: (6) Inserting a ubiquitination tag UbiF into the N-terminus of the gene encoding squalene synthase ERG9 of the yeast strain YB-4, and replacing the ERG9 promoter with the HXT1 promoter, to obtain the yeast strain YB-5. The sequence of the ubiquitination tag UbiF is shown in SEQ ID No.

88.

8. The method according to claim 7, characterized in that Also includes one or more of the following steps: (7) integrating three copies of the fusion gene ERG20~LcLTC2 into the X2 site of the yeast strain YB-5 to obtain the yeast strain YB-6; (8) integrating ERG10 and ERG13 genes into the X3 site of the yeast strain YB-6 to obtain the yeast strain YB-7; (9) integrating XFPK and PTA genes into the LPP1 site of the yeast strain YB-7 to obtain the yeast strain YB-8; (10) integrating two copies of the IDI1 gene into the DPP1 locus of the yeast strain YB-8 to obtain the yeast strain YB-9; (11) Integrate POXB and ACS genes into the ROX1 locus of the yeast strain YB-9 to obtain the yeast strain YB-10.

9. Use of the recombinant yeast according to any one of claims 1 to 3 or the recombinant yeast constructed by the method according to any one of claims 4 to 8 in fermentation production of β-elemene or in genetic breeding of microorganisms producing β-elemene.

10. A method for producing β-elemene by fermentation, characterized in that: The method comprises the step of culturing the recombinant yeast according to any one of claims 1 to 3 or the recombinant yeast constructed by the method according to any one of claims 4 to 8.

Images