Schizosaccharomyces pombe genetic engineering strain capable of improving acetic acid tolerance as well as construction method and application of schizosaccharomyces pombe genetic engineering strain

Abstract

The invention belongs to the technical field of biology, and discloses a schizosaccharomyces pombe genetic engineering strain capable of improving acetic acid tolerance as well as a construction method and application of the schizosaccharomyces pombe genetic engineering strain, the engineering strain is obtained by knocking out a gene SPAC922.07c in an original strain schizosaccharomyces pombe, and the purpose of improving the acetic acid tolerance of the schizosaccharomyces pombe is achieved. Experimental results of the engineering strain and a YPD100 fermentation medium show that under the stress of 15g / L acetic acid, the engineering strain SPAC922.07 c delta consumes up glucose within 106h, which is 24 hours earlier than that of an original strain Sujiu.065, and the glucose consumption rate is increased by 22.08%; the engineering strain reaches the maximum yield of ethanol within 106h, which is 44.57 g / L, which is 24h earlier than that of an original strain Sujiu.065, and the ethanol production rate is increased by 26.44%.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular to a Schizosaccharomyces pombe genetic engineering strain with improved acetic acid tolerance, a construction method and application thereof. Background Art

[0002] High-acid microenvironment is a characteristic attribute of liquor brewing. The increase of acidity in the mash will affect the growth and metabolism of brewing microorganisms, especially the yeast flora. The normal growth and metabolic activity of the yeast flora is the determining factor for the normal production of liquor. Therefore, breeding yeast strains with excellent fermentation traits under high-acid conditions is of great significance for the efficient and stable production of liquor. At the same time, it also provides a new strategy for the construction of high-performance cell factories in the biomanufacturing industry.

[0003] In recent years, although the acid resistance mechanism of Saccharomyces cerevisiae has been deeply analyzed, the relatively weak tolerance of Saccharomyces cerevisiae to organic acids has limited the development of industrial strains with higher tolerance to a certain extent. Some non-Saccharomyces cerevisiae, such as Zygosaccharomyces bailii and Schizosaccharomyces pombe, have begun to attract the attention of researchers because of their better stress resistance. These non-Saccharomyces cerevisiae strains with outstanding stress resistance not only enrich the industrial microbial strain library, but also provide important resources for the comprehensive analysis of the microbial stress resistance mechanism.

[0004] Non-brewer's yeasts have similarities with brewer's yeast in responding to organic acid stress, such as thicker cell walls and more rigid cell membranes, which give strains such as Bayer's yeast a stronger resistance to acetic acid. In addition to the common mode of action for resisting environmental stress with brewer's yeast, some non-brewer's yeasts also have unique response mechanisms when dealing with organic acid stress. For example, Stratford M et al. found that Bayer's yeast exhibits population heterogeneity under acetic acid stress, that is, asymmetric mitosis ensures that some strains have relatively less intracellular acetic acid accumulation, thereby reducing the cell stress caused by acetic acid accumulation. Guerreiro JF et al. found that some Bayer's yeasts can break the glucose repression effect and have the ability to use glucose and acetic acid as available carbon sources at the same time, thereby reducing the cell stress caused by acetic acid accumulation. Zhang Cuiying's team at Tianjin University of Science and Technology first reported that eisosomes are the key elements of yeast resistance to acetic acid stress. The destruction of eisosomes leads to changes in multiple lipids and imbalance of lipid homeostasis, destroying the integrity of the cell membrane, thereby causing a decrease in acetic acid tolerance.

[0005] The present invention uses non-brewer's yeast as the starting strain, and for the first time proposes that knocking out the SPAC922.07c gene significantly improves the tolerance of Schizosaccharomyces pombe to acetic acid, and significantly improves the fermentation efficiency under acetic acid stress. The SPAC922.07c gene encodes aldehyde dehydrogenase, and its homologous genes in Saccharomyces cerevisiae are ALD2, ALD3, ALD4, ALD5 and ALD6, and the gene with the highest homology is ALD2 (homology is 52.6%). There is currently no research on the correlation between aldehyde dehydrogenase and acetic acid tolerance. Therefore, the present invention provides new materials and ideas for the construction of chassis cells with high acetic acid tolerance. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a genetically engineered strain of Schizosaccharomyces pombe with improved acetic acid tolerance, a construction method and an application thereof.

[0007] The technical solution adopted by the present invention to solve the technical problem is:

[0008] A genetically engineered strain of Schizosaccharomyces pombe with improved acetic acid tolerance is obtained by knocking out the SPAC922.07c gene in the original strain Schizosaccharomyces pombe, so as to achieve the purpose of improving the tolerance of Schizosaccharomyces pombe to acetic acid.

[0009] Furthermore, the nucleotide sequence of the SPAC922.07c gene is shown as SEQ ID No.1, and the amino acid sequence of the SPAC922.07c gene is shown as SEQ ID No.2.

[0010] Furthermore, the starting strain Schizosaccharomyces pombe is Schizosaccharomyces pombe Sujiu.065, selected from Chinese Patent Publication No. CN113215007A, Application No. 202110280090.4, a highly acid-resistant Schizosaccharomyces pombe and its application in the brewing of sauce-flavored liquor.

[0011] Furthermore, homologous recombination was used to knock out the target gene, and G418 resistance was used as a screening marker to screen positive clones.

[0012] Furthermore, when the strain was cultured in YPD100 fermentation medium with an initial sugar concentration of 100 g / L and 15 g / L acetic acid, it consumed all glucose in 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate was increased by 22.08%; the engineered strain reached the maximum ethanol production of 44.57 g / L in 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate was increased by 26.44%.

[0013] The method for constructing the Schizosaccharomyces pombe genetic engineering strain as described above comprises the following steps:

[0014] (1) Using the genome of the starting strain Schizosaccharomyces pombe as a template, PCR amplification was performed to obtain the upper homology arm Up and the lower homology arm Low, and plasmid PUG6 was used as a template to PCR amplify the selection marker KanMX;

[0015] (2) The upper homology arm Up, the lower homology arm Low, and the selection marker KanMX fragment were fused together by fusion PCR to serve as the gene SPAC922.07c knockout expression cassette;

[0016] (3) The gene SPAC922.07c knockout expression cassette was transformed into the starting strain, Schizosaccharomyces pombe strain Sujiu.065, using the lithium acetate transformation method to obtain a recombinant strain.

[0017] Use of the above-mentioned Schizosaccharomyces pombe genetically engineered strain in improving glucose consumption rate and ethanol production rate under acetic acid stress.

[0018] The advantages and positive effects achieved by the present invention are:

[0019] 1. Compared with the starting strain, the recombinant Schizosaccharomyces pombe SPAC922.07cΔ provided by the present invention has significantly improved tolerance to acetic acid, shortened the growth lag phase, and improved the fermentation efficiency of the strain under acetic acid stress conditions, which can effectively improve the strain's tolerance to acetic acid and increase the glucose consumption rate and ethanol production rate of the strain under acetic acid stress.

[0020] 2. The present invention uses the pombe Schizosaccharomyces pombe Sujiu.065 with excellent acetic acid resistance as the starting strain, and further improves the strain's tolerance to acetic acid by knocking out the gene SPAC922.07c. The results of the YPD100 fermentation medium experiment showed that under 15 g / L acetic acid stress, the engineered strain SPAC922.07cΔ consumed glucose in 106 h, 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate increased by 22.08%; the engineered strain reached the maximum ethanol production of 44.57 g / L in 106 h, 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate increased by 26.44%.

[0021] 3. The present invention transforms Schizosaccharomyces pombe by genetic engineering means, constructs an engineered strain SPAC922.07cΔ with the SPAC922.07c gene knocked out, and evaluates the tolerance of SPAC922.07cΔ to acetic acid through semi-quantitative spot experiments, growth curve determination and fermentation experiments. The present invention proposes for the first time that knocking out the SPAC922.07c gene significantly shortens the growth lag phase of Schizosaccharomyces pombe, improves the tolerance to acetic acid, and effectively increases the glucose consumption rate and ethanol production rate of Schizosaccharomyces pombe under acetic acid stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram of the construction process of the knockout strain SPAC922.07cΔ in the present invention;

[0023] Figure 2 It is a PCR verification diagram of the positive transformant in the present invention. Among them, M, 1-4 are Marker, the amplified band (1268 bp) using SPAC922.07cΔ genome as template and T1-F / T1-R as primers, the amplified band (1648 bp) using SPAC922.07cΔ genome as template and T2-F / T2-R as primers, the starting strain Sujiu.065 genome as template, T1-F / T1-R as primers did not amplify the band, and the starting strain Sujiu.065 genome as template, T2-F / T2-R as primers did not amplify the band;

[0024] Figure 3 This is a growth curve diagram of the starting strain Sujiu.065 of the present invention under different acetic acid stresses;

[0025] Figure 4 This is a growth state diagram of the knockout strain SPAC922.07cA and the starting strain Sujiu.065 in the present invention in a non-stress liquid culture medium (fully automatic microbial growth curve analyzer);

[0026] Figure 5 This is a growth state diagram of the knockout strain SPAC922.07cA and the starting strain Sujiu.065 in the present invention in a liquid culture medium (fully automatic microbial growth curve analyzer) supplemented with 15 g / L acetic acid:

[0027] Figure 6 This is a growth state diagram of the knockout strain SPAC922.07cΔ and the starting strain Sujiu.065 in the present invention in a liquid medium without stress (100 mL shake flask scale);

[0028] Figure 7This is a growth state diagram of the knockout strain SPAC922.07cΔ and the starting strain Sujiu.065 in the present invention in a liquid culture medium supplemented with 15 g / L acetic acid (100 mL shake flask scale);

[0029] Figure 8 The diagrams are the growth states of the knockout strain SPAC922.07cΔ and the starting strain Sujiu.065 in the solid culture medium of the present invention; wherein (a) is the growth state diagram of the knockout strain SPAC922.07cΔ and the starting strain Sujiu.065 in the solid culture medium without stress, and (b) is the growth state diagram of the knockout strain SPAC922.07cΔ and the starting strain Sujiu.065 in the solid culture medium supplemented with 15 g / L acetic acid;

[0030] Fig. 9 This is a graph showing the glucose consumption and ethanol production of the knockout strain SPAC922.07cΔ and the starting strain Sujiu.065 in the present invention under no stress;

[0031] Fig.10 This is a graph showing the glucose consumption and ethanol production of the knockout strain SPAC922.07cΔ and the starting strain Sujiu.065 in the present invention when 15 g / L acetic acid is added. DETAILED DESCRIPTION

[0032] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0033] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0034] A genetically engineered strain of Schizosaccharomyces pombe with improved acetic acid tolerance is disclosed. The engineered strain is obtained by knocking out the gene SPAC922.07c in the original strain Schizosaccharomyces pombe, so as to achieve the purpose of improving the tolerance of Schizosaccharomyces pombe to acetic acid.

[0035] Preferably, the nucleotide sequence of the SPAC922.07c gene is shown as SEQ ID No.1, and the amino acid sequence of the SPAC922.07c gene is shown as SEQ ID No.2.

[0036] Preferably, the starting strain Schizosaccharomyces pombe is Schizosaccharomyces pombe Sujiu.065, selected from Chinese patent CN113215007A, a highly acid-resistant Schizosaccharomyces pombe strain and its application in the brewing of Maotai-flavor liquor.

[0037] Preferably, homologous recombination is used to knock out the target gene, and G418 resistance is used as a screening marker to screen positive clones.

[0038] Preferably, when the strain was cultured in YPD100 fermentation medium with an initial sugar concentration of 100 g / L and 15 g / L acetic acid, it consumed all glucose within 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate was increased by 22.08%; the engineered strain reached the maximum ethanol production of 44.57 g / L at 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate was increased by 26.44%.

[0039] The method for constructing the Schizosaccharomyces pombe genetic engineering strain as described above comprises the following steps:

[0040] (1) Using the genome of the starting strain Schizosaccharomyces pombe as a template, PCR amplification was performed to obtain the upper homology arm Up and the lower homology arm Low, and plasmid PUG6 was used as a template to PCR amplify the selection marker KanMX;

[0041] (2) The upper homology arm Up, the lower homology arm Low, and the selection marker KanMX fragment were fused together by fusion PCR to serve as the gene SPAC922.07c knockout expression cassette;

[0042] (3) The gene SPAC922.07c knockout expression cassette was transformed into the starting strain, Schizosaccharomyces pombe strain Sujiu.065, using the lithium acetate transformation method to obtain a recombinant strain.

[0043] Use of the above-mentioned Schizosaccharomyces pombe genetically engineered strain in improving glucose consumption rate and ethanol production rate under acetic acid stress.

[0044] Specifically, the relevant preparation and detection are as follows:

[0045] An engineered strain (SPAC922.07cΔ) with improved acetic acid tolerance is obtained by the following method. The acetic acid-tolerant Schizosaccharomyces pombe Sujiu.065 selected from a high-acid environment in the early stage is used as the starting strain, and the gene SPAC922.07c knockout expression cassette is introduced by lithium acetate chemical transformation method to complete the construction of the knockout strain. The nucleotide sequence of the SPAC922.07c is shown in SEQ ID No. 1. The amino acid sequence encoded by the nucleotide sequence is shown in SEQ ID No. 2. The construction method of the gene SPAC922.07c knockout expression cassette is to design primers using the genome of the Schizosaccharomyces pombe model strain 927h- as a template, PCR amplify the upper homology arm Up and the lower homology arm Low, and use the plasmid PUG6 as a template to PCR amplify the screening marker KanMX; the upper homology arm Up, the lower homology arm Low, and the screening marker KanMX fragments are fused together by fusion PCR to serve as the gene SPAC922.07c knockout expression cassette. The integration knockout expression cassette is based on the principle of homologous recombination, with KanMX as the screening marker, and the fusion fragment is introduced into the starting strain Sujiu.065 through lithium acetate chemical transformation method.

[0046] Example 1: Construction of strain SPAC922.07cΔ

[0047] The starting strain of Saccharomyces pombe used in this embodiment is Saccharomyces pombe Sujiu.065, selected from Chinese patent CN113215007A, a strain of highly acid-resistant Saccharomyces pombe and its application in brewing Maotai-flavor liquor. The YPD medium is a universal complete medium, and the solid medium contains 2% imported agar powder by mass.

[0048] The following primers were designed based on the S. pombe model strain 927h-genomic data and integration plasmid sequence in Genebank.

[0049] Table 1 Primers used in this example

[0050] Primers were designed using the genome of the model strain of Schizosaccharomyces pombe 927h- as a template, and Up-F / Up-R and Low-F / Low-R were used as primers, respectively. KOD OneTM PCR Master Mix enzyme was used to amplify the upper homology arm and the lower homology arm. PCR reaction conditions: 95℃ 3 min; 98℃ 10 s, 55℃ 5 s, 68℃ 10 s, 30 cycles; 68℃ 3 min.

[0051] The commercial plasmid PUG6 was used as a template and KanMX-F / KanMX-R as primers. KOD OneTM PCR Master Mix (Beijing Bailingke Biotechnology Co., Ltd., catalog number: KMM-201S) was used to amplify the screening marker KanMX. The PCR reaction conditions were: 95℃ for 3 min; 98℃ for 10 s, 55℃ for 5 s, 68℃ for 10 s, 30 cycles, and 68℃ for 3 min.

[0052] After mixing the upper and lower homology arms and the screening marker KanMX fragment, Up-F and Low-R were used as PCR primers and KOD OneTM PCR Master Mix was used to fuse the three fragments together. The fusion PCR reaction conditions were: 95℃ 3 min; 98℃ 10 s, 55℃ 5 s, 68℃ 20 s, 30 cycles, 68℃ 3 min.

[0053] Table 2 KOD OneTM PCR Master Mix PCR amplification system used in this example

[0054]

[0055] Based on the principle of homologous recombination, the fusion fragment was introduced into the starting strain using lithium acetate chemical transformation ( Figure 1 ).

[0056] The specific method is as follows: (1) After the starting strain is cultured in a shaking incubator at 30°C and 250 r / min for 24 h, it is transferred to fresh YPD medium at a 10% inoculation ratio the next day and continued to be cultured at 30°C and 250 r / min until the mid-logarithmic phase; (2) Take 10 mL of the bacterial solution and centrifuge it at 5000 r / min and 4°C for 2 min, remove the culture medium and collect the bacteria; (3) Wash the bacteria twice with pre-cooled sterile double distilled water; (4) Wash once with 1×TE / LiAc working solution and collect the bacteria; (5) Add an appropriate amount of 1×TE / LiAc working solution (prepare 10×TE solution, 10×LiAc solution and sterile distilled water in a volume ratio of 1:1:8) to resuspend the bacteria and incubate in a shaking incubator at 100 r / min and 30°C for 1 h; (6) After the incubation, centrifuge it again at 5000 r / min and 4°C for 2 min, collect the bacteria, and add 100 μL After resuspending the bacteria in 1×TE / LiAc working solution, add 5 μL of salmon sperm single-stranded ssDNA (Beijing Ruierxinde Technology Co., Ltd., product number: D1626, concentration: 100 mg / mL) pre-denatured by high temperature (95℃-100℃) and 34 μL of DNA fragments for transformation. After mixing by pipetting, incubate in a water bath at 30°C for 30 min; (7) Add 700 μL 1×TE / LiAc-PEG working solution (prepare 10×TE solution, 10×LiAc solution and 50% PEG3350 solution in a volume ratio of 1:1:8), use a pipette to mix, and continue incubating in a water bath at 30°C for 1 h; (8) After the incubation at 30°C, transfer to a 42°C water bath and heat shock for 15 min; (9) Cool naturally to room temperature, centrifuge at 5000 r / min and 4°C for 2 min, remove the supernatant, add 1 mL of fresh YPD medium, and repair and culture at 100 r / min and 30°C for 3 h; (10) Collect the bacteria by centrifugation, wash with sterile double distilled water, take an appropriate amount of bacterial solution and spread it on YPD medium containing 150 μg / L Kanamycin, and culture at 30°C for 72 min. h; (11) Transformants were picked, and the genome was extracted after transfer culture. Fixed-point PCR verification was performed using verification primers. Positive transformants were obtained using T1-F / T1-R and T2-F / T2-R as verification primers. The lengths of PCR products were 1268 bp and 1648 bp, respectively. Figure 2 , lanes 1-2), the starting strain has no corresponding band ( Figure 2 , lanes 3-4), and the correct strain was named SPAC922.07cΔ.

[0057] Example 2: Evaluation of Acetic Acid Tolerance of Knockout Strains - Growth in Liquid Medium (Microplate Scale)

[0058] When selecting the acetic acid stress concentration, a preliminary experiment was conducted with the starting strain Sujiu.065. After the starting strain Sujiu.065 was cultured in a shaking incubator at 30°C and 250 r / min for 24 h, it was inoculated into YPD liquid medium containing 0 g / L, 5 g / L, 10 g / L, 15 g / L, and 20 g / L acetic acid at a 5% inoculation ratio. The initial OD values ​​of each strain and under different treatments were adjusted. 600 The difference between them was no more than 0.05. The growth status of each strain was monitored by a fully automatic microbial growth curve analyzer, the culture conditions were 30℃, 800 r / min, and the data were recorded every 2 hours.

[0059] like Figure 3 As shown in the figure, it can be seen that 5 g / L and 10 g / L acetic acid pose almost no stress to the strain, while 20 g / L acetic acid poses too much stress to the strain, resulting in a long lag period and affecting the progress of the experiment. Taking all factors into consideration, 15 g / L acetic acid is the best choice for the evaluation experiment.

[0060] After the strain SPAC922.07cΔ and the starting strain Sujiu.065 were cultured in a shaking incubator at 30°C and 250 r / min for 24 h, they were inoculated into YPD liquid medium containing 15 g / L acetic acid and no acid at a 5% inoculation ratio. The initial OD values ​​of each strain and different treatments were adjusted. 600 The difference between them was no more than 0.05. The growth status of each strain was monitored by a fully automatic microbial growth curve analyzer, the culture conditions were 30℃, 800 r / min, and the data were recorded every 2 hours.

[0061] like Figure 4 and Figure 5 As shown in the figure, the growth of the two strains under non-stress conditions was almost the same. The starting strain Sujiu.065 was slightly better than the engineered strain SPAC922.07cΔ, and both entered the stable phase at 36 h, indicating that knocking out the SPAC922.07c gene would not affect the growth of the strain under non-stress conditions. Under 15 g / L acetic acid stress, the engineered strain SPAC922.07cΔ entered the logarithmic phase at 48 h, and the starting strain Sujiu.065 entered the logarithmic phase at 62 h. Compared with the starting strain, the lag phase of the engineered strain was shortened by 14 h, further proving that the knockout of the gene SPAC922.07c can significantly improve the tolerance of Schizosaccharomyces pombe to acetic acid, which is beneficial to the growth of Schizosaccharomyces pombe under high concentration acetic acid conditions, thereby also helping to prevent the growth of other bacteria.

[0062] Example 3: Evaluation of Acetic Acid Tolerance of Knockout Strains - Growth in Liquid Medium (100 mL Shake Flask Scale)

[0063] After the strain SPAC922.07cΔ and the starting strain Sujiu.065 were cultured in a shaking incubator at 30°C and 250 r / min for 24 h, they were inoculated into YPD liquid medium containing 15 g / L acetic acid and no acid at a 5% inoculation ratio, and the difference between the initial OD600 of each strain and different treatments was adjusted to be no greater than 0.05. The culture was continued in a shaking incubator at 30°C and 250 r / min, and the OD was measured using a UV-visible spectrophotometer. 600 , monitor the growth status of each strain.

[0064] like Figure 6 and Figure 7 As shown in the figure, there is no difference in the growth of the two strains under non-stress conditions, and both enter the stable phase at 42 h, indicating that knocking out the SPAC922.07c gene has no effect on the basic growth performance of the strain. Under 15 g / L acetic acid stress, the engineered strain SPAC922.07cΔ entered the logarithmic phase at 55 h, and the starting strain Sujiu.065 entered the logarithmic phase at 70 h. Compared with the starting strain, the lag phase of the engineered strain was shortened by 15 h. It further proves that the knockout of the gene SPAC922.07c can significantly improve the tolerance of Schizosaccharomyces pombe to acetic acid, which is beneficial to the growth of Schizosaccharomyces pombe under high concentration acetic acid conditions, thereby also helping to prevent the growth of other bacteria.

[0065] Example 4: Evaluation of acetic acid resistance of knockout strains - semi-quantitative spot plate experiment

[0066] The tolerance of strain SPAC922.07cΔ to acetic acid was evaluated by a semi-quantitative spot plate experiment, and the starting strain Sujiu.065 was used as a control strain. After strain SPAC922.07cΔ and the starting strain were cultured in a shaking incubator at 30°C and 250 r / min for 24 h, they were transferred to fresh YPD liquid culture medium at a 10% inoculation ratio and continued to be cultured in a shaking incubator at 30°C and 250 r / min. After culturing to the mid-logarithmic phase, the bacteria were collected by centrifugation and washed twice with sterile double distilled water. Sterile double distilled water was added to resuspend the bacteria, and the OD value of the bacterial suspension was measured according to the results of the UV-Vis spectrophotometer. 600 Adjust to 1. Use gradient dilution method to dilute the bacterial suspension to 10 -1 , 10 -2 , 10 -3 , 3 μL of each gradient sample was inoculated on YPD solid medium with 15 g / L acetic acid concentration and no acid added. Cultured in a 30°C constant temperature incubator for 2-3 days, and the growth of the strain was observed and photographed.

[0067] like Figure 8As shown in the figure, under the culture condition without adding acid, the growth state of SPAC922.07cΔ was consistent with that of the starting strain Sujiu.065, indicating that the knockout of the gene SPAC922.07c had no effect on the basic growth performance of the strain. Under the stress of 15g / L acetic acid, the strain SPAC922.07cΔ showed a significant growth advantage, which indicated that the knockout of the gene SPAC922.07c could significantly improve the tolerance of S. pombe to acetic acid.

[0068] Example 5: Analysis of fermentation performance of knockout strains

[0069] YPD medium was used as seed culture medium, containing 10 g / L yeast extract powder, 20 g / L peptone, and 20 g / L glucose.

[0070] YPD100 medium was used as fermentation medium, containing 4 g / L yeast extract, 3 g / L peptone, and 100 g / L glucose. At the same time, acetic acid with a final concentration of 15 g / L was added as acid stress medium.

[0071] Fermentation method:

[0072] After the strain SPAC922.07cΔ and the starting strain Sujiu.065 were cultured in a shaking incubator at 30°C and 250 r / min for 24 h, they were transferred to fresh YPD liquid medium at a 10% inoculation ratio and continued to be cultured in a shaking incubator at 30°C and 250 r / min. After culturing to the mid-logarithmic phase, the bacteria were collected by centrifugation and washed twice with sterile double distilled water. Sterile double distilled water was added to resuspend the bacteria, and the OD value of the bacterial suspension was measured by UV-Vis spectrophotometer. 600 Adjust to 0.5; add to the fermentation medium without stress and containing 15g / L acetic acid, and take samples at regular intervals to determine the remaining glucose and ethanol production in the fermentation liquid. Detection of glucose and ethanol content:

[0073] High performance liquid chromatography was used to detect the residual glucose and ethanol production. The detector was a differential detector and the chromatographic column was Rezex TM RFQ-Fast ACID H + (8%), LC Column 100×7.8 mm, mobile phase was 5 mmol / L sulfuric acid at a flow rate of 0.6 mL / min, column temperature was 55°C, and detector temperature was 35°C.

[0074] like Fig. 9 and Fig.10As shown in the figure, under no stress conditions, the fermentation rate and ethanol production of the two strains were the same, and both finished fermentation at 37h, with an ethanol production of 40.86 g / L, which again showed that knocking out the SPAC922.07c gene had no effect on the fermentation performance of the strain; under 15 g / L acetic acid stress, the engineered strain SPAC922.07cΔ consumed glucose in 106 h, 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate increased by 22.08%; the engineered strain reached the maximum ethanol production of 44.57 g / L at 106 h, 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate increased by 26.44%. This showed that knocking out the SPAC922.07c gene was beneficial to improving the glucose consumption rate and ethanol production rate of the strain, further proving that the knockout of the gene SPAC922.07c could significantly improve the tolerance of S. pombe to acetic acid.

[0075] The present invention uses non-brewery yeast as the starting strain and proposes for the first time that knocking out the SPAC922.07c gene significantly improves the tolerance of Schizosaccharomyces pombe to acetic acid. Compared with the starting strain Sujiu.065, the engineered strain SPAC922.07cΔ shortens the lag phase by 14-15 h under 15 g / L acetic acid conditions and significantly increases the biomass, which is conducive to the growth of Schizosaccharomyces pombe under high concentration acetic acid conditions and prevents the production of other bacteria; and the glucose consumption rate is increased by 22.08%, and the ethanol production rate is increased by 26.44%, which indicates that the fermentation efficiency of Schizosaccharomyces pombe under acetic acid stress is significantly improved.

[0076] 1. Nucleotide sequence of SPAC922.07c gene (Unknown)

[0077]

[0078] 2. Amino acid sequence of SPAC922.07c gene

[0079] Met Ser Glu Asp Leu Phe Val Ser Ile Asn Phe Pro Asn Gly Arg Ser ValLys Gln Pro Ile Gly Leu Tyr Ile Asn Gly Glu Trp His Lys Ser Ala Glu Thr TrpGlu Thr Val Asp Pro Ser Thr Glu Glu Val Ile Ala Lys Val Tyr Leu Ala Gly GluLys Glu Ile Asp Tyr Ala Val Lys Ser Ala Lys Glu Ala Phe Lys Thr Trp Lys LysVal Pro Gly Ser Glu Lys Gly Glu Leu Leu Met Lys Leu Ala Glu Leu Thr Glu LysHis Ala Asp Thr Leu Ala Ala Ile Glu Ala Met Asp Ser Gly Lys Pro Leu Val SerAsn Ala Arg Gly Asp Val Asp Gly Thr Ile Ala Leu Leu Arg Tyr Cys Ala Gly TrpAla Asp Lys Ile Tyr Gly Gln Val Ile Pro Thr Gly Pro Glu Lys Leu Ala Tyr AlaLys Arg Thr Pro Ile Gly Val Cys Gly Gln Ile Val Pro Trp Asn Tyr Pro Leu AsnMet Ala Gly Trp Lys Ile Ala Pro Ala Leu Ala Ala Gly Asn Cys Ile Ile Ile LysSer Ala Glu Thr Thr Pro Leu Ser Leu Leu Tyr Phe Ala Thr Leu Val Glu Glu AlaGly Phe Pro Lys Gly Val Val Asn Ile Ile Ser Gly Leu Gly Thr Val Ala Gly SerTyr Met Ala Lys His Pro Gly Ile Asp Lys Ile Ala Phe Thr Gly Ser Thr Lys ValGly Val Ile Val Gln Gln Leu AlaAla Ser Asn Leu Lys Ala Val Thr Leu Glu CysGly Gly Lys Ser Pro Phe Leu Val Phe Glu Asp Ala Asp Leu Asp Gln Ala Val LysTrp Ala Ala Leu Gly Ile Met Tyr Asn Ser Gly Gln Ile Cys Thr Ser Asn Ser ArgIle Tyr Val Gln Asp Ser Val Tyr Asp Lys Phe Ile Glu Leu Phe Lys Lys His ValIle Gln Asp Tyr Ile Val Gly Met Pro Phe Asp Asp Asn Thr Val Val Gly Pro ValVal Asn Lys Thr Gln Tyr Asn Arg Ile Lys Asn Tyr Ile Glu Gln Gly Lys Lys GluGly Ala Lys Leu Val Leu Gly Asp Glu Pro Leu Pro Leu Lys Gln Gly Tyr Phe IleSer Pro Thr Ile Phe Ala Asp Cys Ser Glu Asn Met Thr Ile Val Lys Glu Glu IlePhe Gly Pro Val Val Ala Ile Ser Lys Phe Lys Thr Glu Asp Glu Ala Ile Glu LysAla Asn Asn Thr Thr Tyr Gly Leu Ala Ala Met Cys Phe Thr Lys Asp Leu Glu ArgAla His Arg Val Ser Asp Glu Leu Glu Ala Gly Met Val Phe Ile Asn Ser Thr GluAsn Ser Asp Ile Gln Ala Pro Phe Gly Gly Ile Lys Met Ser Gly Ile Gly Asn GluLeu Gly Ser Asn Gly Ile Glu Met Tyr Thr Gln Ile Lys Ala Val His Ile Asn PheAsn Asn Lys Leu *

[0080] 3. The nucleotide sequence of the upper homologous arm

[0081] gaagcgaacatcgtaagcacaagtttatttttaagtttgaatacctctctatttcgaattatagtagtgcccataaccaatgtttaaactcgaatctaataatggtttacattcactcttgcaactttacacaaacgttacaagtataattttaatcaagtttgggataattgttattttaaaacaattctaaagaattagtaataataaagtaacattttctttgaatttcttatctggttactaggacagttaatatgtcgtgtaacttgatcatgatgatatactcgtgagcagctataagatttttatcgtatgtccgtgcaatttcgccaataacacttcgctagcttagatggtttaaaaattagctcaaagatagataataataagtacatatttattaagtagatggttgttaagttttcttctcaatattcccaaattgtcaatctttcagaataagtttagaatttcagcccaatgtcagaagatttatttgtctccattaatttccctaacggaagatctgtcaaacaac

[0082] 4. The nucleotide sequence of the lower homologous arm

[0083] gggctccaacggtattgagatgtatacacaaattaaagctgttcatattaattttaataacaaactttgaaagggctcctttctgaaatttttccttggctgctattaaattttttatttaattaagagtgttactcattaccttgtgcgctcattgtcttcatactcaaagttggtagctgtttgggcagtaaaaaatttgcagaataaacaagaacgtgaactgtcttacctggctagcaaatggattactgtaaaacaatagtccatgatccgttccgccgttttaccagtgtacctcaagtcagattgaagtttatctataattatcgctccgtttatgaaaaatataataattgtaattttataaatattcaattatctaattataaatgacaatgccacgatttccaccaatttaatattgaagcatacatataaaccaagtttattaatttaatacttaagttttatcgagaaagtgcttatacaatattattgaattaaatttaagagattatattttccatatagttcaatagtaggctcagctacagtatatttaaaaaagtactcttgaaaagtatatttatcgccttaaatccatgaattgatgtctatgccatcg

[0084] 5. Nucleotide sequence of PUG6 plasmid

[0085]

[0086] 6. Nucleotide sequence of KanMX fragment

[0087]

[0088] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered strain of Schizosaccharomyces pombe with improved acetic acid tolerance, characterized in that: The engineered strain is obtained by knocking out the SPAC922.07c gene in the starting strain, Schizosaccharomyces pombe, so as to achieve the purpose of improving the tolerance of Schizosaccharomyces pombe to acetic acid.

2. The Schizosaccharomyces pombe genetically engineered strain according to claim 1, characterized in that: The nucleotide sequence of the SPAC922.07c gene is shown in SEQ ID No.1, and the amino acid sequence of the SPAC922.07c gene is shown in SEQ ID No.

2.

3. The genetically engineered strain of Schizosaccharomyces pombe according to claim 1, characterized in that: The starting strain Schizosaccharomyces pombe is Schizosaccharomyces pombe Sujiu.

065.

4. The Schizosaccharomyces pombe genetically engineered strain according to claim 1, characterized in that: Homologous recombination was used to knock out the target gene, and G418 resistance was used as a screening marker to screen positive clones.

5. The genetically engineered strain of Schizosaccharomyces pombe according to any one of claims 1 to 4, characterized in that: When cultured in YPD100 fermentation medium with an initial sugar concentration of 100 g / L and 15 g / L acetic acid, the strain consumed all glucose in 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate increased by 22.08%. The engineered strain reached the maximum ethanol production of 44.57 g / L in 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate increased by 26.44%.

6. The method for constructing a genetically engineered strain of Schizosaccharomyces pombe according to any one of claims 1 to 5, characterized in that: The steps include: (1) Using the genome of the starting strain Schizosaccharomyces pombe as a template, PCR amplification was performed to obtain the upper homology arm Up and the lower homology arm Low, and plasmid PUG6 was used as a template to PCR amplify the selection marker KanMX; (2) The upper homology arm Up, the lower homology arm Low, and the selection marker KanMX fragment were fused together by fusion PCR to serve as the gene SPAC922.07c knockout expression cassette; (3) The gene SPAC922.07c knockout expression cassette was transformed into the starting strain, Schizosaccharomyces pombe strain Sujiu.065, using the lithium acetate transformation method to obtain a recombinant strain.

7. Use of the genetically engineered strain of Schizosaccharomyces pombe according to any one of claims 1 to 5 in improving glucose consumption rate and ethanol production rate under acetic acid stress.

Images