Application of Acinetobacter pekinensis LGC1-1 in the prevention and control of tobacco mosaic virus

By screening and applying Acinetobacterium pyridium LGC1-1 as an antagonistic strain, the prevention and treatment problems of tobacco mosaic virus were solved, and the effect of efficient inhibition of TMV and PMMoV was achieved, while reducing environmental pollution.

CN119875897BActive Publication Date: 2025-09-02PLANT PROTECTION & QUALITY & SAFETY OF AGRI PRODS INST ANHUI ACAD OF AGRI SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510018867.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-06
Publication Date
2025-09-02
Estimated Expiration
2045-01-06

AI Technical Summary

Technical Problem

The prior art lacks effective agents to thoroughly control the tobacco mosaic virus, especially TMV and PMMoV, and the use of chemical pesticides will pollute the environment, and natural microbial antagonists need to be developed for prevention and treatment.

Method used

Using Acinetobacter pilosula LGC1-1 as an antagonistic strain, through purification culture and screening, a Gram-negative strain is provided to inhibit the invasion of tobacco mosaic virus, specifically cultured on NA medium and applied to the prevention and treatment of tobacco and capsicum viruses.

Benefits of technology

The inhibitory rates of Acinetobacterium pyridium LGC1-1 on TMV and PMMoV reached 82.8% and 77.7%, respectively, which was significantly higher than the conventional drug Ningnanmycin, and it was not polluted to the environment and protected biodiversity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119875897B_ABST
    Figure CN119875897B_ABST
Patent Text Reader

Abstract

The present invention discloses an application of Acinetobacter piemannii LGC1-1 in preventing and treating tobacco mosaic virus. The Acinetobacter piemannii LGC1-1 (Acinetobacter sp.LGC1-1) has been deposited in the China Center for Type Culture Collection on November 13, 2024, with a deposit number of CCTCC NO: M 20242552. The Acinetobacter piemannii LGC1-1 is used as an antagonistic strain to inhibit infection by tobacco mosaic virus. The inhibition rates of the Acinetobacter pekinensis LGC1-1 on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV are 82.8% and 77.7% respectively, while the inhibition rates of the conventional agent Ningnanmycin on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV are 50.8% and 53.3% respectively, indicating that Acinetobacter pekinensis LGC1-1 has an outstanding passivation effect on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV, which is much higher than the prevention effect of the conventional agent Ningnanmycin. In addition, Acinetobacter pekinensis LGC1-1 is a natural virus-linked antibacterial that is screened out and has no pollution to the environment and will not destroy biodiversity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biological control, and in particular to an application of Acinetobacter pekinensis LGC1-1 in preventing and controlling tobacco mosaic virus. Background Art

[0002] The genus Tobamovirus comprises numerous members, with 37 species reported by ICTV (Genus: Tobamovirus | ICTV). Tobacco mosaic virus (TMV) and pepper mild mottle virus (PMMoV) are common viral pathogens that harm pepper and tobacco crops. TMV infects tobacco, causing mosaic symptoms on leaves and weak plant growth, which seriously affects tobacco quality. PMMoV infects pepper, severely affecting fruit color change and reducing its economic returns.

[0003] Viruses are obligate intracellular parasites. Once tobacco plants are infected, there is no effective drug to completely control them in production. Screening for natural microbial antagonists to control crop viral diseases meets the national green prevention and control development needs, and can also reduce the pollution of chemical pesticides to the soil and environment. At present, there have been many studies on the biological control of tobacco mosaic virus in China. For example, patent number CN201910790132.1 discloses an Acinetobacter beijerinckii strain, code-named S1, and discloses that the strain can be used to control tobacco mosaic virus (tobacco mosaic disease TMV), and has a good inhibitory effect on tobacco mosaic disease TMV. Therefore, it is of great practical significance to develop more biocontrol bacteria and apply them to the control of tobacco mosaic virus. Summary of the Invention

[0004] The present invention provides a use of Acinetobacter pirimi LGC1-1 in preventing and controlling tobacco mosaic virus (TMV) and pepper mild mottle virus (PMMoV) in order to screen natural microbial antagonists for preventing and controlling tobacco mosaic virus (TMV) and pepper mild mottle virus (PMMoV) and reduce the pollution of chemical pesticides to soil and the environment.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] The present invention provides an Acinetobacter pekinensis LGC1-1. The living pure culture of the Acinetobacter pekinensis LGC1-1 (Acinetobacter sp, named Acinetobacter pekinensis LGC1-1 / Acinetobacter sp.LGC1-1) has been registered and preserved in the China Center for Type Culture Collection, the preservation time is November 13, 2024, the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, on the campus of Wuhan University, and the preservation number is CCTCC NO: M 20242552.

[0007] The Acinetobacter pekinensis LGC1-1 produces milky white, round colonies with neat edges, a smooth surface, and opaque protrusions. Gram staining confirmed that the bacterium is a Gram-negative bacterium. During purification, the culture was performed using a spread plate method on NA medium (3.0 g / L beef extract, 10.0 g / L sucrose, 5.0 g / L peptone, 1.0 g / L yeast extract, 15.0 g / L agar, pH = 7.1) and cultured at 28°C for 24 hours.

[0008] The present invention also provides an application of Acinetobacter pekinensis LGC1-1 in preventing and treating tobacco mosaic virus. The Acinetobacter pekinensis LGC1-1 is used as an antagonistic strain to inhibit infection of tobacco mosaic virus.

[0009] The tobacco mosaic virus is tobacco mosaic virus TMV and / or pepper mild mottle virus PMMoV.

[0010] The 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 is shown in SEQ ID NO.1.

[0011] The amplification primers for the 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 are:

[0012] SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG;

[0013] SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.

[0014] The beneficial effect of the present invention is that the inhibition rates of the Acinetobacter pekinensis LGC1-1 on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV are 82.8% and 77.7% respectively, while the inhibition rates of the conventional agent Ningnanmycin on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV are 50.8% and 53.3% respectively, indicating that the passivation effect of Acinetobacter pekinensis LGC1-1 on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV is outstanding and much higher than the prevention effect of the conventional agent Ningnanmycin, and Acinetobacter pekinensis LGC1-1 is a natural virus-linked antibacterial selected from the screening, which is environmentally friendly and does not damage biodiversity. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a colony morphology diagram of Acinetobacter pilosellae LGC1-1 of the present invention;

[0016] Figure 2 This is a comparison of the inactivation effects of the Acinetobacter pilosellae LGC1-1 of the present invention and the conventional antiviral agent Ningnanmycin on tobacco mosaic virus TMV (tobacco leaves);

[0017] Figure 3 This is a comparison chart (tobacco leaves) of the inactivation effects of the Acinetobacter pilosellae LGC1-1 of the present invention and the conventional antiviral agent Ningnanmycin on pepper mild mottle virus PMMoV. DETAILED DESCRIPTION

[0018] The present application will be described in further detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0019] 1. Materials

[0020] 1. Acinetobacter piemannii LGC1-1 (Acinetobacter sp, named Acinetobacter piemannii LGC1-1 / Acinetoba cter sp.LGC1-1). The live pure culture of Acinetobacter piemannii LGC1-1 has been registered and preserved in the China Center for Type Culture Collection on November 13, 2024. The preservation address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the preservation number is CCTCC NO: M 20242552.

[0021] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.

[0022] 2. Methods

[0023] 2.1 Preparation of Acinetobacter pekinensis LGC1-1:

[0024] 1. Sampling: In tobacco fields where mosaic disease has occurred, select healthy tobacco plants and collect rhizosphere soil at a depth of 20 cm from the roots of the tobacco plants for later use;

[0025] 2. Grinding: Place 10g of the reserved soil in a sterilized Erlenmeyer flask, add 20ml of sterile water, shake until the liquid becomes turbid, let it stand at room temperature for 10 minutes, and set aside;

[0026] 3. Purification: 200 μL of the supernatant liquid after standing was sucked up with a sterile pipette tip, and the plate method was used on NA medium (3.0 g / L beef extract, 10.0 g / L sucrose, 5.0 g / L peptone, 1.0 g / L yeast extract, 15.0 g / L agar, pH = 7.1). The culture was carried out at 28°C for 24 h. After the colonies grew on the separation plate, the isolated single colonies were picked out one by one with an inoculating loop according to the characteristics of the microbial colonies such as morphology, size, surface structure, edge structure, texture, gloss, transparency, color and soluble pigment produced. The single colonies with different morphologies were picked out and streaked on the corresponding blank NA medium plates for purification. The plates were then incubated upside down in a constant temperature incubator at 28°C for 24 h to obtain the purified strains for later use.

[0027] like Figure 1 As shown, Acinetobacter pekinensis LGC1-1 has milky white circular colonies with neat edges, smooth surface, and opaque convexities. Gram staining confirmed that the bacterium is a Gram-negative bacterium. Pathogenic bacterial DNA was extracted using the Wizard genomic DNA purification kit (Promega, Madison, WI).

[0028] The primers for amplification of 16S rDNA sequences are:

[0029] SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG;

[0030] SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.

[0031] PCR amplification was performed using the above primers. The PCR amplification reaction system was 50 μL (10× PCR buffer 5 μL, dNTP 1 μL, P0 2 μL, P6 2 μL, Tag enzyme 1 μL, template DNA 2 μL, dd H2O 37 μL).

[0032] PCR amplification conditions were: 94°C for 5 minutes, 30 cycles of 94°C for 30 seconds, 55°C for 1 minute, and 72°C for 90 seconds, followed by 72°C for 1 minute and 10°C for 20 minutes. The 16S rDNA gene sequencing results of the strain were compared with BLAST software on the NCBI website, and the biocontrol bacterium was preliminarily identified as Acinetobacter sp.

[0033] 4. Screening: Select a single bacterial colony and place it in a sterilized 100 ml conical flask containing 20 ml of culture medium. Culture it with shaking (28°C, 200 r / min) for 24 hours to ensure that the bacterial liquid content is large enough to be used as a fermentation strain.

[0034] 2.2 Infection inhibition test of tobacco mosaic virus TMV and pepper mild mottle virus PMMoV:

[0035] Nicotiana tabacum var. samsun NN exhibits a hypersensitive necrotizing reaction to tobacco mosaic virus (TMV) and pepper mild mottle virus (PMMoV). The half-leaf assay was used to determine the inhibitory effect of Acinetobacter pelecanii LGC1-1 on infection with TMV and PMMoV. Specifically, young, fully infected leaves of TMV or PMMoV inoculated with distilled water were ground and filtered at a ratio of 1:10 (mass to volume) to serve as the virus test sample. The virus test sample was mixed with equal volumes of liquid NA medium and, after 30 minutes, inoculated onto the left half of a Nicotiana tabacum leaf (viewed from the front of the leaf, the same below) as a control. The LGC1-1 to be tested was mixed with equal volumes of the virus sample and, after 30 minutes, inoculated onto the right half of a Nicotiana tabacum leaf as a treatment. Ningnanmycin (purchased from Chengdu Jiaye Biotechnology Co., Ltd.) was also used as a treatment and control.

[0036] After necrotic spots appeared, the number of necrotic spots on the left and right halves of the leaf was recorded. This was repeated three times, with three leaves per tobacco plant inoculated. The number of necrotic spots on the left and right halves of the leaf and the inhibition rate are shown in Table 1-2 below:

[0037] Table 1 Statistics of the inhibition test data on tobacco mosaic virus TMV

[0038]

[0039] Table 2 Statistical data of the inhibition test on pepper mild mottle virus PMMoV

[0040]

[0041]

[0042] The inhibition rate was calculated as follows: inhibition rate (%) = [(number of control necrosis spots - number of treated necrosis spots) / number of control necrosis spots] × 100%, and the average inhibition rate was used for evaluation.

[0043] From the data in Table 1-2, it can be seen that the antagonistic effect of Acinetobacter pseudostellariae LGC1-1 on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV is significantly better. The results of three repeated tests showed that the inhibition rates of conventional agent Ningnanmycin on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV were 50.8% and 53.3%, respectively, but the inhibition rates of LGC1-1 fermentation liquid on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV were as high as 82.8% and 77.7%, respectively. The specific control effect is shown in Figure 2-3 .

[0044] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A strain of Acinetobacter pilosicoli ( Acinetobacter pittii ) The use of LGC1-1 in preventing and controlling tobacco mosaic virus, characterized in that, The living pure culture of the Acinetobacter pekinensis LGC1-1 has been deposited in the China Center for Type Culture Collection on November 13, 2024, with the deposit number CCTCC NO: M 20242552; the Acinetobacter pekinensis LGC1-1 is used as an antagonistic strain to inhibit infection by tobacco mosaic virus; the tobacco mosaic virus is tobacco mosaic virus TMV and / or pepper mild mottle virus PMMoV .

Citation Information

Patent Citations

  • Tobacco mosaic virus biocontrol bacterium and application thereof

    CN110628666A

  • Acinetobacter pittii YY-7S and application thereof

    CN113881609A

  • Acinetobacter sp. KTB3 and Method for Production ofanti-viral material, Acivirin, thereof

    KR1020010069131A