A protein with alkaline phosphatase activity and its application

Abstract

The present disclosure relates to a protein having alkaline phosphatase activity and its application. Specifically, it relates to a protein having alkaline phosphatase activity, a gene encoding the protein, a recombinant vector into which the gene is inserted, a transformant into which the gene is inserted, a method for preparing alkaline phosphatase, and the application of alkaline phosphatase in the preparation of products with high temperature resistance and / or alkali resistance. The protein having alkaline phosphatase activity disclosed herein has high high temperature resistance and alkali resistance, laying the foundation for improving the application of alkaline phosphatase in the fields of food, feed, medicine, environmental management, and pesticide degradation.

Description

Technical Field

[0001] The present disclosure relates to the field of genetic engineering technology, and in particular, to a protein having alkaline phosphatase activity, a gene encoding the protein, a recombinant vector into which the gene is inserted, a transformant into which the gene is transformed, a method for preparing alkaline phosphatase, and the use of alkaline phosphatase in preparing products having high temperature resistance and / or alkali resistance. Background Art

[0002] Alkaline phosphatase is a nonspecific phosphomonoesterase widely present in animals, plants and microorganisms. It hydrolyzes phosphate compounds under alkaline conditions to produce inorganic phosphate. It also has the activity of catalyzing phosphate group transfer reactions.

[0003] Alkaline phosphatase is widely used in enzyme-linked immunosorbent assays, biosensors, non-isotopic probes, hybridization and sequencing, and the degradation of organophosphorus pesticides. Currently, commercial alkaline phosphatase suffers from poor thermal stability, and there is an urgent need to explore more efficient and stable alkaline phosphatase resources. Summary of the Invention

[0004] The present invention aims to provide a protein having alkaline phosphatase activity, a gene encoding the protein, a recombinant vector having the gene inserted therein, a transformant having the gene transformed therein, a method for preparing alkaline phosphatase, and the use of alkaline phosphatase in preparing products having high temperature resistance and / or alkali resistance.

[0005] In order to achieve the above-mentioned object, the present disclosure provides, in a first aspect, a protein having alkaline phosphatase activity, wherein the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0006] The second aspect of the present disclosure provides a gene encoding the protein described in the first aspect.

[0007] Optionally, the nucleotide sequence of the gene is the DNA molecule shown in SEQ ID NO.2.

[0008] The third aspect of the present disclosure provides a recombinant vector into which the gene described in the second aspect is inserted.

[0009] Optionally, the recombinant vector is a recombinant expression vector, and the nucleotide sequence of the recombinant expression vector is the DNA molecule shown in SEQ ID NO.3.

[0010] A fourth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium;

[0011] The transformant is introduced with the gene described in the second aspect, or the transformant is introduced with the recombinant vector described in the third aspect.

[0012] Optionally, the genetically engineered bacteria is at least one of Escherichia coli, Bacillus subtilis and Bacillus licheniformis.

[0013] A fifth aspect of the present disclosure provides a method for preparing alkaline phosphatase, comprising: culturing the transformant described in the fourth aspect to obtain a cultured material.

[0014] A sixth aspect of the present disclosure provides a use of alkaline phosphatase in preparing a product with high temperature resistance and / or alkali resistance, wherein the alkaline phosphatase is the protein described in the first aspect.

[0015] The seventh aspect of the present disclosure provides use of the recombinant vector described in the third aspect or the transformant described in the fourth aspect in preparing a product with high temperature resistance and / or alkali resistance.

[0016] Through the above technical solutions, the present disclosure provides a protein with alkaline phosphatase activity, a gene encoding the protein, a recombinant vector into which the gene is inserted, a transformant into which the gene is inserted, a method for preparing alkaline phosphatase, and the use of alkaline phosphatase in the preparation of products with high heat and / or alkali resistance. The disclosed protein with alkaline phosphatase activity has high heat and alkali resistance, laying the foundation for improving the application of alkaline phosphatase in fields such as food, feed, medicine, environmental remediation, and pesticide degradation.

[0017] Other features and advantages of the present disclosure will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following detailed description, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings:

[0019] Figure 1 This is the SDS-PAGE electrophoresis result of alkaline phosphatase BliAlpN.

[0020] Figure 2 This is the structural analysis result of alkaline phosphatase BliAlpN; A shows the simulated 3D structure of alkaline phosphatase BliAlpN, and B shows the metal ion binding amino acid residues of alkaline phosphatase BliAlpN.

[0021] Figure 3 These are the results of enzymatic property analysis of alkaline phosphatase BliAlpN; wherein A is the specific enzymatic activity of alkaline phosphatase BliAlpN at different temperatures; and B is the specific enzymatic activity of alkaline phosphatase BliAlpN at different pH values.

[0022] Figure 4 This is the stability test result of BliAlpN.

[0023] Figure 5 The effect of different metal ions on the enzyme activity of alkaline phosphatase BliAlpN. DETAILED DESCRIPTION

[0024] The following describes the specific embodiments of the present disclosure in detail with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present disclosure and are not intended to limit the present disclosure.

[0025] In the present disclosure, the terms "protein having alkaline phosphatase activity", "alkaline phosphatase" and "BliAlpN protein" are used interchangeably and all refer to the protein having the amino acid sequence shown in SEQ ID NO.1.

[0026] In the present disclosure, the terms "gene encoding the protein described in the first aspect" and " BliAlpN "Gene" can be used interchangeably to refer to a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.2.

[0027] In a first aspect, the present disclosure provides a protein having alkaline phosphatase activity, wherein the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0028] In the present disclosure, the protein having alkaline phosphatase activity is preferably a naturally derived protein, for example, derived from Bacillus licheniformis. The inventors of the present disclosure surprisingly discovered that the protein having alkaline phosphatase activity disclosed herein has high heat and alkali resistance, laying the foundation for improving the application of alkaline phosphatase in fields such as food, feed, medicine, environmental management, and pesticide degradation.

[0029] The second aspect of the present disclosure provides a gene encoding the protein described in the first aspect.

[0030] Wherein, the nucleotide sequence of the gene is the DNA molecule shown in SEQ ID NO.2.

[0031] In the present disclosure, the full-length sequence of the gene is 1743 bp, which encodes a protein of 580 amino acids. The inventors of the present disclosure used Swiss-Model (https: / / swissmodel.expasy.org / ) to perform structural analysis on the BliAlpN protein, as shown in FIG. Figure 2 As shown, the protein has an amino acid similarity of 81.93% with the reported Bacillus licheniformis alkaline phosphatase protein (AAU39240.1), and the protein structure contains conserved amino acid residues that may interact with metal ions, indicating that the protein is a new protein with alkaline phosphatase activity.

[0032] The third aspect of the present disclosure provides a recombinant vector into which the gene described in the second aspect is inserted.

[0033] Wherein, the recombinant vector is a recombinant expression vector, and the nucleotide sequence of the recombinant expression vector is the DNA molecule shown in SEQ ID NO.3.

[0034] A fourth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium;

[0035] The transformant is introduced with the gene described in the second aspect, or the transformant is introduced with the recombinant vector described in the third aspect.

[0036] In one embodiment of the present disclosure, the genetically engineered bacteria is at least one of Escherichia coli, Bacillus subtilis, and Bacillus licheniformis. For example, when the recombinant vector is pET28a, the host of the transformant is Escherichia coli.

[0037] A fifth aspect of the present disclosure provides a method for preparing alkaline phosphatase, comprising: culturing the transformant described in the fourth aspect to obtain a cultured material.

[0038] A sixth aspect of the present disclosure provides a use of alkaline phosphatase in preparing a product with high temperature resistance and / or alkali resistance, wherein the alkaline phosphatase is the protein described in the first aspect.

[0039] The seventh aspect of the present disclosure provides use of the recombinant vector described in the third aspect or the transformant described in the fourth aspect in preparing a product with high temperature resistance and / or alkali resistance.

[0040] The present disclosure is further described in detail below through examples, but the present disclosure is not limited thereto.

[0041] The raw materials used in the following examples can be obtained through commercial channels;

[0042] Escherichia coli BL21 (DE3) strain was purchased from Nanjing Novozymes Biotechnology Co., Ltd.

[0043] Experimental reagents:

[0044] C115-01 recombinant enzyme and E112-01 protein detection solution were purchased from Nanjing Novozymes Biotechnology Co., Ltd.;

[0045] The pET28a vector was purchased from Merck, Germany, and the NTA series buffer (catalog number: C600304-0500) was purchased from Sangon Biotech (Shanghai) Co., Ltd.;

[0046] The M5 HiPer Bacteria Genomic DNA Kit was purchased from Beijing Juhemei Biotechnology Co., Ltd.

[0047] Experimental instruments:

[0048] Nickel columns of type 70666-3 were purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.

[0049] Example 1

[0050] This example is used to illustrate the construction of a recombinant Escherichia coli engineering strain expressing the BliAlpN gene.

[0051] 1. Amplified based on the genome sequence of the Bacillus licheniformis strain isolated from the Tara planting base in Yimen County, Yuxi City, Yunnan Province BliAlpN Gene, PCR specific primers are:

[0052] BliAlpN-F:

[0053] 5'GAAGGAGATATACCATGGGCGCACCGAGGTTCTCCGAAT3'SEQ ID NO.4;

[0054] BliAlpN-R:

[0055] 5'TGGTGGTGGTGGGTGCTCGAGCTTTTTCTCCTTTTGCTTC3' SEQ ID NO.5.

[0056] 2. Amplify the target gene by PCR BliAlpN Gene sequence. The PCR amplification system was prepared in 20 μL, including 10 μL 2× Phanta Max Master Mix, 1 μL DNA template, 1 μL upstream primer with an initial concentration of 10 μmol / L, 1 μL downstream primer with an initial concentration of 10 μmol / L, and 7 μL ddH2O. The PCR amplification program was 95°C denaturation for 3 min → (95°C denaturation for 30 s → 60°C annealing for 30 s → 72°C extension for 1 min) × 35 cycles → 72°C extension for 5 min → storage at 4°C. BliAlpN Gene.

[0057] 3. After the PCR product is recovered by gel, it is converted into BliAlpN Genes connected to Nco I / Xho The E. coli expression vector pET28a- BliAlpNThe expression vector was transformed into Escherichia coli BL21 (DE3), and the inserted sequence was verified to be correct by PCR, enzyme digestion, and sequencing. The strain was named BL21- BliAlpN .

[0058] 4. Protein structure analysis: The Swiss-Model (https: / / swissmodel.expasy.org / ) was used to analyze the structure of BliAlpN protein. The results are as follows: Figure 2 shown.

[0059] The experimental results of this embodiment are as follows: BliAlpN The full length of the gene is 1743bp (sequence see SEQ ID NO.2), which encodes a protein of 580 amino acids (sequence see SEQ ID NO.1), of which amino acids 1-56 are signal peptide segments. Homology comparison analysis showed that the BliAlpN protein in Bacillus licheniformis found in Yunnan has an amino acid similarity of 81.93% with the reported Bacillus licheniformis alkaline phosphatase protein (AAU39240.1) and an amino acid similarity of 74.60% with the Bacillus subtilis alkaline phosphatase protein (WP_009969242.1). The BliAlpN protein structure contains conserved amino acid residues that may interact with metal ions, indicating that the BliAlpN protein is a newly discovered phosphatase protein. Through gene sequencing identification, the present invention successfully cloned BliAlpN The gene does not contain a signal peptide sequence and is successfully expressed BliAlpN Recombinant Escherichia coli engineered strains.

[0060] Example 2

[0061] This example is about the induced expression and purification of BliAlpN protein.

[0062] The experimental materials of this embodiment include:

[0063] Recombinant engineering strain: The strain obtained in Example 1 contains BliAlpN Recombinant gene expression strains;

[0064] The experimental method of this embodiment includes:

[0065] 1. Induced expression and purification of recombinant protein:

[0066] (1) Add 5 mL of engineered strain BL21- BliAlpN Seed solution (OD 600 =5) Inoculate 1% of the bacterial strain into 500 mL of LB liquid medium supplemented with kanamycin (50 μg / mL) and incubate at 37°C until the bacterial concentration reaches 0.6-0.8.

[0067] (2) IPTG (final concentration 0.3 mmol / L) was added to induce protein expression at 16°C for 20 h. IPTG is an inducer for the recombinant strain to express the BliAlpN protein, not a substrate for the catalytic reaction.

[0068] 2. Purification of recombinant protein by affinity chromatography:

[0069] (1) Collect the cells by centrifugation at 5000 rpm for 10 min, resuspend in NTA-0 buffer, and then ultrasonically disrupt for 10 min;

[0070] (2) Set the ultrasonic power to 400W, and perform ultrasonication for 3 seconds followed by a 5-second pause. After the ultrasonication, centrifuge at 5000 rpm for 30 minutes to collect the supernatant and obtain the crude enzyme solution.

[0071] (3) The crude enzyme solution was used to wash the 70666-3 nickel column twice at a flow rate of 1 mL / min. Then, NTA-10 buffer, NTA-20 buffer, NTA-40 buffer, NTA-60 buffer, NTA-580 buffer, and NTA-100 buffer were used for gradient elution at a flow rate of 1 mL / min. At the same time, E112-01 protein detection solution was used for detection and the elution peak was collected. After ultrafiltration and centrifugation to remove imidazole, the purified BliAlpN enzyme solution was obtained. The BliAlpN enzyme solution was subjected to SDS-PAGE electrophoresis. The results are as follows: Figure 1 As shown, lane M is a protein marker, lane 1 is a BL21-BliAlpN bacterial solution without IPTG induction, lane 2 is a total protein of the engineered strain BL21-BliAlpN induced by IPTG, lane 3 is a crude enzyme solution of alkaline phosphatase BliAlpN, lane 4 is a column flow-through of the crude enzyme solution of alkaline phosphatase BliAlpN, lane 5 is a 0 mmol / L imidazole NTA-0 elution flow-through, lane 6 is Lane 7 is the elution flow-through of 10 mmol / L imidazole NTA-10, lane 7 is the elution flow-through of 20 mmol / L imidazole NTA-20; lane 8 is the elution flow-through of 40 mmol / L imidazole NTA-40; lane 9 is the elution flow-through of 60 mmol / L imidazole NTA-60; lane 10 is the elution flow-through of 80 mmol / L imidazole NTA-80; lane 11 is the elution flow-through of 100 mmol / L imidazole NTA-100.

[0072] The experimental results show that BliAlpNThe gene was expressed in large quantities and in a soluble form in Escherichia coli. Elution with 60mM, 80mM, and 100mM imidazole eluents revealed a single protein band at approximately 59kDa, close to the predicted size of the His-Tag fusion protein, indicating that BliAlpN was eluted in buffers containing 60-100mM imidazole. The SDS-PAGE electrophoresis of the purified BliAlpN protein showed a clear background, indicating high protein purity and high expression levels. The purified protein was subsequently used for enzymatic characterization studies.

[0073] Example 3

[0074] This example is an analysis of the enzymatic properties of alkaline phosphatase BliAlpN.

[0075] The experimental materials of this example include: the BliAlpN protein obtained in Example 2.

[0076] The experimental method of this embodiment includes:

[0077] 1. Enzyme activity determination:

[0078] Purified BliAlpN protein was diluted to 500 mg / L. 100 μL of this diluted protein solution was added to 50 μL of p-NPP substrate (1 mg / mL) at different pH values ​​(3, 4, 5, 6, 7, 8, 9, 10, 11, and 12). The reaction was incubated at different temperatures (20, 30, 40, 50, 60, 70, 80, 90, and 100°C) for 20 min. The reaction was terminated by adding 50 μL of 0.5 mol / L NaOH. The absorbance was measured at 405 nm, and the enzyme activity was calculated. One unit (U) of enzyme activity was defined as the amount of enzyme required to catalyze the hydrolysis of the substrate to produce 1 μmol of p-nitrophenol (pNP) in 1 min.

[0079] 2. Enzyme characteristics analysis:

[0080] (1) Determination of the optimal reaction temperature: The reaction system was placed in a 0.2 mol / L glycine-sodium hydroxide buffer solution (pH 10) and reacted at 20, 30, 40, 50, 60, 70, 80, 90, and 100°C for 20 min.

[0081] The maximum enzyme activity was taken as 100%, and the relative enzyme activity at different temperatures (the percentage of enzyme activity at various temperatures relative to the maximum enzyme activity) was calculated.

[0082] (2) Determination of the optimal reaction pH: According to the enzyme activity determination method, the enzyme activity of the recombinant protein was measured when the reaction system temperature was set at 80°C in 0.1 mol / L citric acid-sodium citrate buffer solution with pH values ​​of 3.0, 4.0, 5.0, and 6.0, 0.2 mol / L disodium hydrogen phosphate-sodium dihydrogen phosphate buffer solution with pH values ​​of 7.0 and 8.0, and 0.2 mol / L glycine-sodium hydroxide buffer solution with pH values ​​of 9.0, 10.0, 11.0, and 12.0.

[0083] The maximum enzyme activity was taken as 100%, and the relative enzyme activity at different pH values ​​(the percentage of enzyme activity at various pH values ​​relative to the maximum enzyme activity) was calculated.

[0084] (3) Temperature stability test: The BliAlpN enzyme solution was diluted to 500 mg / L, and then treated at 80°C, 90°C and 100°C for 0, 30, 60 and 90 min, respectively. 0.2 mol / L glycine-sodium hydroxide buffer solution was added to adjust the pH of the reaction system to 10. The specific enzyme activity was determined according to the above method. The enzyme activity measured at 0 min treatment under each temperature condition was taken as 100%. The calculation formula is: Relative enzyme activity (%) = U1 / U0×100%, where U0 is the highest enzyme activity at 0 min treatment, and U1 is the enzyme activity at 80, 90 and 100°C for 30, 60 and 90 min treatment, respectively.

[0085] (4) Effects of different metal ions on enzyme activity: 0.2 mol / L glycine-sodium hydroxide buffer solution (pH 10) was used to prepare 10 mM K + , Ca 2+ Mg 2+ 、Cu 2+ 、Mn 2+ 、Ni 2+ 、Zn 2+ 、Co 2+ 、Fe 2+ The enzyme activity was determined using the enzyme activity assay method for 9 metal ion solutions. The relative enzyme activity under different metal ion conditions was calculated using the reaction system without metal ion addition as the control (CK) at 100%. The calculation formula was: Relative enzyme activity (%) = U2 / U3 × 100%, where U3 is the highest enzyme activity of the control (CK) and U2 is the enzyme activity in solutions containing different metal ions.

[0086] The experimental results of this embodiment are as follows:

[0087] The results of the enzymatic property analysis of BliAlpN are as follows Figure 3-5 As shown by Figure 3A It can be seen that the alkaline phosphatase BliAlpN cloned from the Bacillus licheniformis isolated from the Yunnan Tara cultivation base disclosed in the present invention has the highest relative enzyme activity in the in vitro catalytic reaction at 80°C. Under the reaction conditions of 60-90°C, BliAlpN can exert good enzyme activity, and the enzyme activity is retained by more than 80%. Figure 3 B It can be seen that the optimal pH value for the in vitro catalytic reaction of BliAlpN is 10, and the relative enzyme activity is highest at pH 7-11, and more than 80% of the enzyme activity can be retained.

[0088] Depend on Figure 4 BliAlpN retained over 80% of its activity after treatment at pH 10 and 80°C for 90 minutes, demonstrating its excellent stability. The results indicate that BliAlpN is a thermostable and alkaline-resistant phosphatase, with a specific activity of 8326 ± 16.32 U / mg at its optimal temperature of 80°C and pH 10.

[0089] according to Figure 5 The results show that Ca 2+ and Mn 2+ It has a significant promoting effect on the activity of alkaline phosphatase BliAlpN. 2+ 、Zn 2+ and Mg 2+ It has an inhibitory effect on the activity of alkaline phosphatase BliAlpN. 2+ It can increase the activity of alkaline phosphatase BliAlpN by 1.81 times.

[0090] The preferred embodiments of the present disclosure are described in detail above in conjunction with the accompanying drawings. However, the present disclosure is not limited to the specific details of the above embodiments. Within the technical concept of the present disclosure, various simple modifications can be made to the technical solutions of the present disclosure, and these simple modifications all fall within the scope of protection of the present disclosure.

[0091] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0092] In addition, the various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure.

Claims

1. A protein having alkaline phosphatase activity, characterized in that The amino acid sequence of the protein is shown in positions 57 to 580 of SEQ ID NO.

1.

2. A gene encoding the protein according to claim 1.

3. The gene according to claim 2, wherein The nucleotide sequence of the gene is shown in SEQ ID NO. 2, positions 169 to 1740.

4. A recombinant vector, characterized in that The recombinant vector is inserted with the gene according to claim 2 or 3.

5. The recombinant vector according to claim 4, wherein The recombinant vector is a recombinant expression vector, and the nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO.

3.

6. A transformant, characterized in that The transformant is a genetically engineered bacterium; The transformant is introduced with the gene according to claim 2 or 3, or the transformant is introduced with the recombinant vector according to claim 4 or 5.

7. The transformant according to claim 6, wherein The genetically engineered bacteria is at least one of Escherichia coli, Bacillus subtilis and Bacillus licheniformis.

8. A method for preparing alkaline phosphatase, characterized in that: The method comprises: culturing the transformant according to claim 6 or 7 to obtain a cultured material.

Images