Nuclease mutant and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a nuclease mutant and application thereof. According to the invention, nuclease (the amino acid sequence is as shown in SEQ ID NO: 1) derived from Trichoderma reesei is subjected to S165W mutation. Compared with wild type nuclease, the nuclease mutant disclosed by the invention has improved storage stability, has higher enzyme activity at the temperature of 10-55 DEG C, and has improved enzyme activity under an alkaline condition. The invention provides novel nuclease, which can retain more than 75% of enzyme activity after being stored for one week, and is beneficial to being applied to washing products or disinfection products in the daily chemical industry.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to nuclease mutants and applications thereof. Background Art

[0002] Nuclease is a general term for a series of enzymes that degrade deoxyribonucleic acid or ribonucleic acid into mononucleotides and oligonucleotides. It can be mainly divided into specific nucleases and non-specific nucleases. In recent years, the application of nucleases in the daily chemical industry has gradually increased.

[0003] Some body dirt and pollutants can adhere to clothes and form biofilms on them. The formation of biofilms makes clothes sticky, so that more dirt will adhere to these sticky areas, making the clothes black and yellow. It is difficult to remove such dirt using commercial detergent compositions.

[0004] Research has found that bacterial deoxyribonucleases can be used to destroy and prevent biofilms. Currently, there is a lack of nucleases that can be used in the daily chemical industry. Therefore, it is urgent to develop nucleases that can be used in the daily chemical industry. Summary of the invention

[0005] The object of the present invention is to provide a nuclease mutant.

[0006] Another object of the present invention is to provide a nuclease gene.

[0007] Another object of the present invention is to provide the application of the above nuclease mutant. The nuclease mutant provided by the present invention has a highly efficient degradation effect on deoxyribonucleic acid or nucleic acid, and can be applied to the daily chemical industry.

[0008] The present invention is derived from Trichoderma reesei Trichoderma reesei The nuclease (amino acid sequence is shown in SEQ ID NO: 1) is subjected to S165W mutation, and the nucleotide sequence of the encoding gene of the parent nuclease is shown in SEQ ID NO.2.

[0009] SEQ ID NO: 1: APLPAPPGIPSEDTARTQLAGLTVAVVGSGTGYSRDLFPTWDAISGNCNAREYVLKRDGEGVQVNNACEAQSGSWISPYDNASFTNASSLDIDHMVPLKNAWISGASTWTTAQREALANDVSRPQLWAVSASSNRSKGDRSPDQWKPPLTSFYCTYAKSWIDVKSYYKLTITSAEKTALSSMLDTC.

[0010] SEQ ID NO:2: .

[0011] The amino acid sequence of the nuclease mutant according to the present invention is shown in SEQ ID NO:3.

[0012] SEQ ID NO:3: APLPAPPGIPSEDTARTQLAGLTVAVVGSGTGYSRDLFPTWDAISGNCNAREYVLKRDGEGVQVNNACEAQSGSWISPYDNASFTNASSLDIDHMVPLKNAWISGASTWTTAQREALANDVSRPQLWAVSASSNRSKGDRSPDQWKPPLTSFYCTYAKSWIDVKWYYKLTITSAEKTALSSMLDTC.

[0013] The present invention provides a method for improving the enzymatic activity and stability of a nuclease, the method comprising the step of performing S165W mutation on a nuclease with an amino acid sequence as shown in SEQ ID NO: 1.

[0014] The beneficial effects of the present invention are: Compared with the wild-type nuclease, the nuclease mutant of the present invention has improved storage stability, higher enzyme activity at a temperature of 10° C.-55° C., and improved enzyme activity under alkaline conditions.

[0015] The present invention provides a new nuclease, which can retain more than 75% of the enzyme activity after being stored for one week, and is conducive to application in cleaning products or disinfection products in the daily chemical industry. DETAILED DESCRIPTION

[0016] In order to make the technical scheme of the present invention more clearly understood by those skilled in the art, the following embodiments are listed for illustration. It should be pointed out that the following embodiments do not limit the protection scope of the present invention.

[0017] Unless otherwise specified, the biological materials, reagents or devices used in the following examples can be obtained from conventional commercial channels or by existing known methods. The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the book Molecular Cloning Laboratory Manual (3rd Edition) by J. Sambrook, or according to the kits and product instructions.

[0018] The nuclease mutant of the present invention is a polypeptide having nuclease activity and comprising a KNAW-evolutionary branch motif, which exhibits particularly good cleaning properties, for example, it can be particularly effective in removing or reducing components of organic matter, such as biofilm-associated DNA, from articles (such as textiles or hard surfaces); it performs well in removing attached odorous substances and can significantly reduce the odor on fabrics caused by microbial activity.

[0019] The term "biofilm" refers to a community of microorganisms embedded in an extracellular polymer matrix attached to a surface. The extracellular polymer matrix is ​​a polymer aggregate, usually composed of extracellular DNA, proteins and polysaccharides. A biofilm can have one or more microorganisms and include other trapped particles. These microorganisms can be Gram-positive or Gram-negative bacteria (aerobic or anaerobic); algae, protozoa, and / or yeast or filamentous fungi.

[0020] In some embodiments, the nuclease mutants of the present invention retain more than 75% of their enzymatic activity when stored at pH 7.0 for one week.

[0021] In some embodiments, the nuclease mutant of the present invention still has enzymatic activity at 10°C, 25°C, 35°C, 45°C, and 55°C in an alkaline environment of pH 9.0. In some embodiments, the nuclease mutant of the present invention still has more than 40% enzymatic activity at 10°C-55°C in an alkaline environment of pH 9.0. Preferably, the nuclease mutant of the present invention has an optimal reaction temperature of 35°C in an alkaline environment of pH 9.

[0022] In some embodiments, the nuclease mutants of the present invention still have more than 60% enzyme activity under alkaline conditions with a pH lower than 10.0, 9.0, or 8.0 at an optimal reaction temperature of 35°C.

[0023] Compared with the wild-type nuclease, the nuclease mutant of the present invention has improved storage stability, higher enzyme activity at a temperature of 10° C.-55° C., and improved enzyme activity under alkaline conditions.

[0024] The present invention also provides a recombinant vector comprising at least one polynucleotide, for example, a polynucleotide encoding a polypeptide having nuclease activity provided by the present invention. In some embodiments, the present invention also provides an expression vector or expression cassette comprising the polynucleotide, wherein the polynucleotide is operably linked to one or more promoters required for effective gene expression, and is also operably linked to a selection gene, which enables continuous culture of plasmid-infected host cells by growth in a culture medium containing antibiotics.

[0025] In certain embodiments, the present invention also provides a recombinant cell comprising the expression vector or expression cassette. In order to express and produce the target protein in the recombinant cell, at least one expression vector comprising at least one copy (and in some cases comprising multiple copies) of the polynucleotide encoding the nuclease mutant of the present invention is transformed into a host cell.

[0026] The nuclease mutants of the present invention can be produced in host cells of any suitable microorganisms (including bacteria and fungi). In one embodiment of the present invention, the host cell is Pichia pastoris Y135.

[0027] The vector containing the polynucleotide sequence encoding the nuclease is introduced into the recombinant cell, and the nuclease expressed by the recombinant cell is induced, which can be used in the fields of daily chemicals such as textiles and detergents.

[0028] In some embodiments of the present invention, the nuclease is secreted into the supernatant after induction culture, and the high-purity target protein is further separated from the supernatant or concentrated supernatant by existing protein purification methods. In a preferred embodiment of the present invention, the high-purity target protein is obtained by HPLC purification.

[0029] In one embodiment of the present invention, a method for preventing, reducing or removing biofilm is also provided, the method comprising contacting the biofilm with a cleaning composition comprising a nuclease mutant of the present invention. The biofilm is on a textile or a hard surface, such as a laundry machine surface, a tableware surface, or a dishwashing machine surface.

[0030] The present invention also provides a detergent composition comprising (i) the nuclease mutant of the present invention; and (ii) at least one other enzyme, wherein the at least one other enzyme is selected from the group consisting of the following enzymes: acyltransferase, α-amylase, β-amylase, α-galactosidase, arabinosidase, arylesterase, β-galactosidase, carrageenanase, catalase, cellobiohydrolase, cellulase, chondroitinase, cutinase, endo-β-1,4-glucanase, endo-β-mannanase, esterase, exo-mannanase, galactanase, glucosidase, esterase, exo-mannanase, esterase, exo-galactanase, esterase, exo-glucanase, esterase, exo-galact ... Amylases, hemicellulases, hyaluronidases, keratinases, laccases, lactases, ligninases, lipases, lipoxygenases, lysozymes, mannanases, metalloproteinases, nucleases, oxidases, oxidoreductases, pectate lyases, pectin acetylesterases, pectinases, pentosanases, peroxidases, phenoloxidases, phosphatases, phospholipases, polygalacturonases, polyesterases, proteases, pullulanases, reductases, rhamnogalacturonidases, beta-glucanases, tannases, transglutaminases, xylan acetylesterases, xylanases, xyloglucanases, and xylosidases.

[0031] The following is a more specific example.

[0032] The experimental materials, reagents, and nuclease assay methods used in the following examples are as follows: 1. Strains and vectors: Strains containing nuclease TRnuc gene and expression plasmid, Escherichia coli strain Top10, Pichia pastoris Y135, vector pPICZαA, antibiotic Zeocin.

[0033] 2. Enzymes and kits: Primer start 2×Master Mix PCR polymerase, restriction endonuclease, plasmid extraction kit, purification kit.

[0034] 3. Culture medium The culture medium for E. coli was LB medium (1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0; The E. coli screening medium was LB+Amp medium (LB medium was supplemented with ampicillin at a final concentration of 100 μg / mL) and LB+Zeo medium (LB medium was supplemented with Zeocin at a final concentration of 25 μg / mL); The yeast culture medium was YPD medium (1% yeast extract, 2% peptone, and 2% glucose); The yeast screening medium was YPD+Zeo medium (YPD+Zeo medium was YPD medium with Zeocin added to a final concentration of 100 μg / mL); yeast induction medium BMGY (1% yeast extract, 2% peptone, 1.34% YNB, 0.00004% Biotin, 1% glycerol (v / v)) and BMMY (the rest of the ingredients are the same as BMGY except that 0.5% methanol is used instead of glycerol); Basic salt medium for recombinant yeast fermentation: 5% diammonium hydrogen phosphate, 0.5% potassium dihydrogen phosphate, 1.5% magnesium sulfate heptahydrate, 1.95% potassium sulfate, 0.1% calcium sulfate, 0.03% defoamer. After high pressure, add 4.35mL PTM1 per liter, including PTM1 (trace salt solution): 0.6% copper sulfate, 0.018% potassium iodide. 0.3% manganese sulfate monohydrate, 0.02% sodium molybdate dihydrate, 0.002% boric acid, 0.05% cobalt chloride hexahydrate, 2% zinc chloride, 6.5% ferric sulfate heptahydrate, 0.5% concentrated sulfuric acid, and 0.02% biotin.

[0035] 4. Nuclease activity assay Nuclease can hydrolyze the phosphodiester bonds in single-stranded or double-stranded deoxyribonucleic acid to produce mononucleotides or oligonucleotides of 8-12 bases. The content of deoxyribonucleic acid is proportional to the absorbance, and the degradation of deoxyribonucleic acid by nuclease causes an increase in absorbance. Therefore, the difference in absorbance of the reaction solution is measured by spectrophotometry to determine the activity of the nuclease. According to experimental requirements, different temperatures and pH can be adjusted to detect enzyme activity.

[0036] Using calf thymus DNA as substrate, at 25°C and pH 5.0, a change of 0.001 absorbance per ml per minute at 260 nm is one enzyme activity unit (Kunitz unit).

[0037] Optimal reaction temperature and pH determination and storage stability test.

[0038] Under the condition of pH 9.0, the enzyme activity of the nuclease was measured at 10°C, 25°C, 35°C, 45°C, 55°C and 65°C, respectively. The enzyme activity measured at 35°C was used as a control, and the relative enzyme activity of the nuclease under different temperature conditions was calculated.

[0039] The optimal pH enzyme activity was determined at 35°C, and the enzyme activity of the nuclease was determined at pH 7.0, pH 8.0, pH 9.0, and pH 10.0. Example 1 Synthesis of nuclease TRnuc gene and vector construction

[0040] Trichoderma reesei Trichoderma reesei) the amino acid sequence of the nuclease TRnuc is as shown in SEQ ID NO:1, and the nucleotide sequence is as shown in SEQ ID NO:2; EcoRI and XbaI restriction sites are introduced into the 5' and 3' ends of the nuclease gene TRnuc, and connected to the pUC57-amp vector, pUC57-TRnuc and pUC57-NUC2 are inoculated into LBA medium, cultured for 24 hours, the plasmid is extracted, digested with EcoRI and XbaI, the target gene fragment is recovered by gel cutting, the product is purified and recovered, and connected to the expression vector pPICzαA to obtain the expression vector pPICzαA-TRnuc. Example 2 Nuclease site-directed mutagenesis

[0041] Using the above pPICzαA-TRnuc as template, PCR amplification was performed with the following primers: S165W-F: aagtcgtggattgacgtcaagtggtattacaagttgactattacg (SEQ ID NO: 4), S165W-R: cgtaatagtcaacttgtaataccacttgacgtcaatccacgactt (SEQ ID NO: 5).

[0042] The PCR amplification results were detected by agarose electrophoresis, and the PCR products were purified and recovered. The original plasmid was decomposed with the restriction endonuclease DpnI, and the decomposed product was transferred into Escherichia coli Top10 by heat shock method. The recombinant transformant was verified by bacterial liquid PCR, and the plasmid of the verified correct transformant was extracted for sequencing to determine the corresponding mutant. The mutant expression vector pPICzαA-TRnuc-S165W was obtained, and the plasmid of the verified correct transformant was taken. The mutant plasmid was linearized with PmeI endonuclease, the linearized plasmid fragment was purified, and it was transferred into Pichia pastoris Y135 competent cells by electrotransformation method, and the yeast recombinant transformant was obtained by screening with YPD+Zeo medium. Example 3 Storage stability of nuclease mutants

[0043] Use a toothpick to pick the yeast recombinant transformants obtained in Example 2 one by one to a 24-well plate, add 1 mL of BMGY medium to each well, culture at 30°C, 220rpm for about 24 hours, and centrifuge to remove the supernatant. Then add 1.6 mL of BMMY medium for induction culture. After 24 hours of culture, centrifuge to take the supernatant, take out 200 μL of the above supernatant to a 96-well plate, and assay the nuclease activity. Yeast recombinant transformants with high enzyme activity were obtained by high-throughput screening. The highest enzyme activity yeast recombinant mutants of the vectors pPICzαA-TRnuc and pPICzαA-TRnuc-S165W were named PP-TRnuc and PP-MUT1, respectively.

[0044] Storage stability test: According to the formula (enzyme solution 69%, glycerol 30%, potassium sorbate 0.4%, sodium methyl sulphate 0.1%, kasone 0.5%), the enzyme activity of the nuclease parent and its mutants after storage at pH 7.0 for one week was measured.

[0045] Table 1 Nuclease mutant stability determination Bacteria Storage enzyme activity retention rate PP-TRnuc 47.6% PP-MUT1 75.5% .

[0046] As can be seen from Table 1, the stability of the nuclease mutant PP-MUT1 obtained by mutation based on TRnuc in the present invention is significantly improved, and the enzyme activity retention rate is increased to 75.5%. Example 4 Optimal temperature and optimal reaction pH of the parent nuclease and its mutants

[0047] Under the condition of pH 9.0, the enzyme activity of the nuclease was measured at 10°C, 25°C, 35°C, 45°C, 55°C and 65°C, respectively. The enzyme activity measured at 35°C was used as a control, and the relative enzyme activity of the nuclease under different temperature conditions was calculated.

[0048] Table 2 Relative enzyme activities of nuclease PP-TRnuc and mutants at different temperatures Temperature ℃ PP-TRnuc PP-MUT1 10 88.5% 81.4% 25 97.3% 96.5% 35 100% 100% 45 84.1% 91.3% 55 40.7% 46.5% 65 21.2% 32.4% .

[0049] The results are shown in Table 2. The optimal reaction temperature range of the nuclease provided by the present invention is 35°C, and its relative enzyme activity at low temperatures (10-25°C) is higher than that at high temperatures (55-65°C), and it can maintain good enzyme activity in a low temperature environment.

[0050] Table 3 Relative enzyme activities of nuclease TRnuc and mutants at different pH pH TRnuc PP-MUT1 7.0 33.9% 33.1% 8.0 58.6% 60.9% 9.0 100% 100% 10.0 81.4% 84.3% .

[0051] Subsequently, the optimal pH enzyme activity was determined. At 35°C, the enzyme activity of the nuclease was measured at pH 7.0, pH 8.0, pH 9.0, and pH 10.0. The relative enzyme activity of the nuclease under different pH conditions was calculated using the enzyme activity of the nuclease measured at pH 9.0 as a control. The results are shown in Table 3. The optimal pH of the nuclease TRnuc and the mutant were 9.0, respectively. Example 5 Application Test

[0052] The nuclease PP-TRnuc and its mutant PP-MUT1 were used in the laundry detergent formulation to compare their performance in removing odor from fabrics.

[0053] Nuclease PP-TRnuc and PP-MUT1 were added to common commercial laundry detergent (without fragrance) at a ratio of 0.5% to prepare a laundry detergent sample containing nuclease. The formula of the common commercial laundry detergent is shown in Table 4.

[0054] Table 4 Laundry detergent formula Raw material name Addition amount (%) Liquid caustic soda (32%) 1.2 Sulfonic acid 3 AES 12 AEO-9 2 Sodium Cocoate 4 APG 1 Sodium Citrate 0.5 Sodium polyacrylate 1 Casson 0.1 Industrial salt 1.5 Softened water 73.7 .

[0055] Collect adult tops of any material after exercise or physical labor and leave them for 1-2 days. Cut each piece of clothing vertically into four pieces. Three screened volunteers independently score the odor of each piece of clothing, scoring 0, 1, 2, 3, 4 and 5 points in order of no odor, barely perceptible odor, slight odor, moderate odor, obvious odor and strong odor. The lower the score, the less odor.

[0056] Weigh 20 grams of laundry detergent without added nuclease as the blank group, and weigh 20 grams of laundry detergent samples containing PP-TRnuc and PP-MUT1, respectively, and add them to four washing machines of the same model. Add the clothes that have been evaluated for odor to the four washing machines and record them, and choose the same cotton fabric program for washing. After washing, put the clothes to be tested into a ziplock bag with holes and hang them at 25℃ for 48 hours.

[0057] After 48 hours of hanging, three volunteers were selected again to independently rate the odor of each piece of clothing and record the odor score. The test results are shown in Table 5.

[0058] Table 5 Performance of PP-TRnuc and PP-MUT1 in removing odor from clothing .

[0059] As can be seen from Table 5, the use of laundry detergent (blank group) can only partially remove the odor on the surface of clothing. Comparing the laundry detergent groups with nuclease TRnuc and PP-MUT1 added, it can be found that the addition of the nuclease mutant of the present invention can effectively improve the odor removal ability of the laundry detergent, and the removal performance of the odor of clothing is more significant. This example shows that the nuclease mutant performs well in disintegrating microbial biofilms and removing attached odorous substances, and can significantly reduce the odor on fabrics caused by microbial activities.

[0060] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A nuclease mutant, characterized in that: The amino acid sequence of the nuclease mutant is shown in SEQ ID NO:

3.

2. A nuclease gene, characterized in that: Encoding the nuclease mutant according to claim 1.

3. The nuclease gene according to claim 2, characterized in that The nucleotide sequence of the nuclease gene is shown in SEQ ID NO:

4.

4. Use of the nuclease mutant according to claim 1 for removing or reducing biofilm formed by microbial communities embedded in or attached to an object, wherein: The microorganism is a prokaryotic organism or a eukaryotic organism.

5. The use according to claim 4, characterized in that The nuclease mutant of claim 1 is contacted with the biofilm at a temperature of 10°C to 55°C under alkaline conditions.

6. The use according to claim 4, characterized in that: The nuclease mutant according to claim 1 is contacted with the biofilm at a temperature of 35° C. and a pH of 8.0-10.

0.

7. A detergent composition, characterized in that The detergent composition comprises (i) the nuclease mutant of claim 1; and (ii) at least one enzyme selected from the group consisting of acyltransferase, α-amylase, β-amylase, α-galactosidase, arabinosidase, arylesterase, β-galactosidase, carrageenanase, catalase, cellobiohydrolase, cellulase, chondroitinase, cutinase, endo-β-1,4-glucanase, endo-β-mannanase, esterase, exo-mannanase, galactanase, glucoamylase, hemicellulose. Enzymes, hyaluronidase, keratinase, laccase, lactase, ligninase, lipase, lipoxygenase, lysozyme, mannanase, metalloproteinase, nuclease, oxidase, oxidoreductase, pectate lyase, pectin acetylesterase, pectinase, pentosanase, peroxidase, phenoloxidase, phosphatase, phospholipase, polygalacturonase, polyesterase, protease, pullulanase, reductase, rhamnogalacturonase, beta-glucanase, tannase, transglutaminase, xylan acetylesterase, xylanase, xyloglucanase and xylosidase.

8. A method for improving the enzymatic activity and stability of a nuclease, characterized in that: The method comprises the step of performing S165W mutation on the nuclease having the amino acid sequence as shown in SEQ ID NO:

1.

9. A method for preparing a nuclease, characterized in that: The method comprises the steps of expressing a gene encoding the nuclease mutant of claim 1 in a host cell and purifying the expressed nuclease.

10. The method for preparing nuclease according to claim 9, characterized in that: The method further comprises the steps of constructing a recombinant expression vector comprising the gene encoding the nuclease mutant according to claim 1, and introducing the recombinant expression vector into the host cell.