Glutamate decarboxylase mutant, gene and amino acid sequence thereof and application of glutamate decarboxylase mutant in efficient production of gamma-aminobutyric acid

Abstract

The invention discloses a glutamate decarboxylase mutant, a gene and an amino acid sequence thereof, and an application of the glutamate decarboxylase mutant in efficient production of gamma-aminobutyric acid, and belongs to the field of protein engineering. According to the invention, a glutamate decarboxylase mutant M17 is obtained through a gene engineering method; the mutant not only has excellent catalytic activity and relatively high thermal stability, but also shows good acid resistance, the optimum pH of the mutant is reduced to 3.5 from the original 5.0, the production intensity is 1.4 times that of original bacteria under the condition that the pH is 3.5, salt ions are not introduced into a reaction system, and desalination refining is not needed, so that the product loss is reduced, and the production cost is reduced. And a foundation is laid for reducing production and equipment loss cost in industrial application of GABA production.

Description

Technical Field

[0001] The invention belongs to the technical field of protein engineering, and specifically relates to a mutant of glutamate decarboxylase, a recombinant bacterial cell thereof, and an application of the mutant in realizing efficient production of gamma-aminobutyric acid. Background Art

[0002] γ-aminobutyric acid (GABA) is a non-protein amino acid and an important inhibitory neurotransmitter in the central nervous system of mammals. It has the functions of calming, anti-anxiety, anti-epileptic, promoting sleep, improving menopausal or senile mental disorders, enhancing liver and kidney function, lowering blood pressure, effectively reducing weight, and promoting alcohol metabolism. It was approved as a new resource food by the Ministry of Health in 2009 and is widely used in medicine, health care, planting, feed, chemical industry, food and other industries. Most of the GABA in the body is produced by glutamate decarboxylation catalyzed by glutamate decarboxylase (GAD), and its coenzyme is 5-pyridoxal phosphate. The preparation methods of GABA as a principle of medicine or health care products mainly include chemical synthesis, separation and extraction, and biosynthesis. Since its biosynthesis method has the advantages of mild reaction conditions, simple processing procedures, high product yield and selectivity, and energy saving and environmental protection, the use of this method for the biological preparation of GABA has important industrial production application value.

[0003] GAD is a key enzyme in the biosynthesis of GABA. It uses 5'-pyridoxal phosphate (PLP) as a coenzyme and can specifically and irreversibly catalyze the decarboxylation of glutamate to synthesize GABA and CO2. Its activity directly affects the ability of microorganisms to synthesize GABA. GAD from microbial sources mainly includes Lactobacillus brevis, Lactobacillus plantarum, Escherichia coli, Streptomyces, Bacillus megaterium, etc. However, GAD from these sources has the disadvantages of poor thermal stability, narrow pH stability range, and low affinity with substrates, which makes it difficult to meet the needs of industrial applications. In 2019, Fang Hui's team introduced proline into the GAD of L.brevis CGMCC No.1306, which enhanced the hydrophobic interaction around the 364 site and greatly improved the thermal stability of G364P. In 2020, Zhang Qingfei's research group significantly improved the thermal stability of GAD1407 by introducing a disulfide bond. The efficient expression and high enzyme activity of glutamate decarboxylase are the key to the whole-cell catalytic production of GABA. In 2019, Yang Yuan'e and others constructed a recombinant Escherichia coli glutamate decarboxylase expression strain. By optimizing the induction conditions, the expression of soluble protein was improved, and the GAD enzyme activity reached 41.2U / mL, an increase of 11.1%. In 2020, Qiu Ling and others introduced GAD from Escherichia coli for expression in Bacillus subtilis. After optimizing the optimal temperature and pH, they introduced pyridoxal oxidase (PdxH), and the recombinant bacterial enzyme activity reached a maximum of 31.86U / mL. In 2023, Rao Zhiming's team selected 9 sites for site-directed mutagenesis and combined mutagenesis based on the surface charge modification of enzyme protein, which broadened the enzyme activity at a neutral pH of 6.0. At 40°C, PLP concentration of 0.1mM, and bacterial cell volume OD 600 Under the condition of 20, the engineered bacteria C.glutamicum E01 / pXMJ19-LpgadS24R / D88R / Y309K was initially added with 100g / L conversion liquid in a 5L tank amplification conversion system, and 1000g glutamic acid was fed in batches within 14h to efficiently synthesize γ-aminobutyric acid, with a yield of up to 402.8g / L, but the molar conversion rate was only 52.3%. The Li Haixing team of Nanchang University established a sodium-free GABA fermentation process for Lactobacillus brevis CD817 through culture medium optimization, but after the fermentation of this process, GABA existed in the fermentation medium of Lactobacillus brevis, and complex separation methods were still required to obtain the final product.

[0004] Although the existing research on glutamate decarboxylase (GAD) has made some progress, including improving the thermal stability and enzyme activity of the enzyme through genetic engineering, there are still some shortcomings. For example, although most of the GAD mutants reported so far have improved the properties of the enzyme to a certain extent, they still face problems such as insufficient thermal stability, limited pH adaptation range, and the need for specific buffered salt solutions in industrial applications. These problems limit the application efficiency and cost-effectiveness of GAD in the large-scale production of γ-aminobutyric acid (GABA) process. In addition, while the existing GAD mutants improve the enzyme activity, they are often accompanied by a lower molar conversion rate, which not only increases the consumption of raw materials, but also affects the yield and purity of the final product. Therefore, it is of great significance to develop a glutamate decarboxylase mutant that has high thermal stability, a wide pH adaptation range, high activity without a specific buffered salt solution, and high molar conversion rate for achieving efficient and low-cost industrial production of GABA. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention obtains a glutamate decarboxylase mutant through a genetic engineering method, which not only improves the activity and stability of the glutamate decarboxylase mutant, but also reduces the optimum pH of the enzyme from 5.0 to 3.5, but still retains the catalytic activity at pH 5.0, which is similar to the pH value of the existing reaction system, and can carry out the catalytic reaction under the reaction condition of naturally not controlling the pH, thereby providing an effective way for the industrial production of gamma-aminobutyric acid by enzymatic method.

[0006] In a first aspect, the present invention provides a glutamate decarboxylase mutant, wherein the amino acid sequence of the mutant has at least 99% homology with SEQ ID NO. 4; more preferably, has at least 99.5% homology.

[0007] For the technical solution described above, in a further preferred case, the mutant has the catalytic activity of glutamate decarboxylase, and the amino acid positions 38, 337, and 355 of the reference sequence SEQ ID NO.2 are replaced by asparagine (N), glutamate (E), and aspartic acid (D), respectively, i.e., Q38N, R337E, and L355D; in the core functional region, the amino acid sequence outside the mutation site has at least 99% homology with the corresponding core functional region in the reference sequence SEQ ID NO.4, and more preferably has at least 99.5% homology; and the amino acid sequence in the non-core functional region may be different, allowing certain sequence variations, and no strict homology requirements. Under the premise of not affecting the core enzyme activity, this part of the sequence may have a certain degree of change or variation. The glutamate decarboxylase mutant described above is modified based on the glutamate decarboxylase of Lactobacillus brevis. By replacing specific amino acids, it is possible not only to enhance the performance of the enzyme, but also to make the host strain taxonomically close to the closely related species of Lactobacillus brevis. Regardless of the specific taxonomy of the host strain, the present invention encompasses all mutant enzymes that may be assigned to species related to Lactobacillus brevis due to specific amino acid substitutions.

[0008] The above-mentioned "homology" refers to the degree of similarity between two or more protein sequences.

[0009] The core functional region of an enzyme is a region with a specific three-dimensional structure that can specifically bind to a substrate and catalyze the conversion of the substrate into a product. This region is called the active center or active site of the enzyme. The active center usually contains some essential groups that are crucial to the catalytic activity of the enzyme.

[0010] Essential groups within the active center: These groups are responsible for binding to the substrate, helping to form the enzyme-substrate complex, and catalytic groups that directly participate in the chemical conversion of the substrate and promote the reaction.

[0011] Essential groups outside the active center:

[0012] Although these groups are not directly involved in the catalytic reaction, they are necessary to maintain the spatial conformation of the enzyme active center and serve as binding sites for regulators.

[0013] The active center of an enzyme is highly specific and can recognize and bind to specific substrate molecules, catalyzing the chemical reaction of the substrate and converting it into a product. This specificity and high efficiency of the enzyme is achieved through the precise structure of its active center and the synergistic effect of essential groups.

[0014] For the technical solution described above, in a further preferred case, the amino acid sequence of the mutant is as shown in SEQ ID NO.4; that is, the glutamate decarboxylase mutant M17 obtained in the embodiment of the present invention.

[0015] For the technical solution described above, in a further preferred case, the mutant is derived from glutamate decarboxylase (gadB) of Lactobacillus brevis.

[0016] For the technical solution described above, in a further preferred case, the mutant has the catalytic activity of glutamate decarboxylase; based on the reference sequence SEQ ID NO.1, the mutant is replaced by AAC, GAA, and GAT at nucleotide positions 114, 1011, and 1065, respectively, resulting in changes in Q38N, R337E, and L355D in the amino acid sequence. In its core functional region, except for the above-mentioned mutation sites, the remaining nucleotide sequences have at least 99.5% homology with the core functional region corresponding to the reference sequence SEQ ID NO.3; more preferably, at least 99% homology; and the nucleotide sequences in the non-core functional regions may differ, and sequence variations within a certain range are allowed, and no strict requirements are made on the homology of this part.

[0017] The above-mentioned "homology" refers to the degree of identity and similarity between two or more nucleotide sequences.

[0018] For the technical solution described above, in a further preferred case, the coding gene sequence of the mutant is as shown in SEQ ID NO.3.

[0019] A recombinant bacterium, characterized in that: the recombinant bacterium comprises a gene expression vector encoding the above-mentioned glutamate decarboxylase mutant, the gene expression vector is selected from one of pET28(a), pUC19, pACYC, pHT254, pHT254-WapA, pXMJ19 or pEC-XK99E; the expression host cell of the recombinant bacterium is selected from one of Escherichia coli (E. coli), Bacillus subtilis (B. subtilis) or Corynebacterium glutamicum (C. glutamicum).

[0020] For the technical solution described above, in a further preferred case, the use of the recombinant bacteria in the preparation of γ-aminobutyric acid (GABA) is characterized in that the recombinant bacteria performs a bioconversion process under pH 3.0-4.0 (preferably pH 3.0-3.5; more preferably pH 3.5) and 35-45°C (more preferably 40-45°C; more preferably 40°C). The catalytic efficiency is at least 1-1.5 times that of the wild-type glutamate decarboxylase, and the half-life is at least 1.5-2.5 times that of the wild-type glutamate decarboxylase.

[0021] For the technical solution described above, in a further preferred case, when the mutant is used to prepare γ-aminobutyric acid, the pH range during the bioconversion process is 3.0 to 4.0 (more preferably 3.0 to 3.5; most preferably 3.5). Therefore, after the reaction is completed, there is no need to adjust the pH value or introduce additional salts, and only the bacterial cells need to be removed by centrifugation. At this time, the reaction solution mainly contains γ-aminobutyric acid and water, and the obtained supernatant can be directly concentrated and dried to obtain a γ-aminobutyric acid product with higher purity without going through an additional desalting step. This greatly simplifies the subsequent purification process.

[0022] For the technical solution described above, in a further preferred case, the catalytic system of the recombinant bacteria in use comprises 4-6M glutamate substrate, 0.03-0.07mM pyridoxal 5-phosphate and 10-25g / L (wet weight) of recombinant bacterial cells for reaction.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The γ-glutamyl methylamine synthetase mutant obtained by the genetic engineering method of the present invention has significantly improved properties compared with the wild strain, which is reflected in the following aspects:

[0025] (1) The optimal pH of the mutant dropped from 5.0 to 3.5, and it still had high catalytic activity at pH 5.0; this means that M17 can maintain efficient catalytic activity in a wider pH range, avoiding the introduction of salt ions and reducing separation difficulty and cost.

[0026] (2) The production intensity of M17 under optimal conditions is 1.4 times that of the original bacteria; this significant improvement means that within the same production time, the production efficiency and economic benefits are greatly improved.

[0027] (3) The thermal stability of the enzyme was significantly improved. At pH 5.0, the half-life of the M17 mutant was 1.78 times that of the original bacteria. At pH 3.5, the half-life was increased to 2.22 times the original. This is of great significance for low pH tolerance and reducing the introduction of salt.

[0028] (4) The optimum pH of the enzyme is close to the pH of the initial reaction system. No salt ions are introduced into the reaction system, and no desalting and refining is required, which simplifies the subsequent purification process, thereby reducing product loss, shortening the production cycle, and reducing industrial costs.

[0029] (5) By comparative analysis, when the mutation sites (Q38N, R337E, L355D) unique to the M17 strain were added to other mutants, these mutants had a significant improvement in the production efficiency of γ-aminobutyric acid. Similar trends can be observed in all tested mutants, reflecting the non-obviousness of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The optimum pH of the original bacteria and mutants;

[0031] Figure 2 Optimum temperature of the original bacteria and mutants. DETAILED DESCRIPTION

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments.

[0033] In the present invention, unless otherwise specified, percentages and percentage contents are all by mass. Unless otherwise specified, the experimental methods used are all conventional methods, and the materials and reagents used can be purchased from commercial sources.

[0034] Example 1 Construction of mutants

[0035] The glutamate decarboxylase gene gadB from Lactobacillus brevis was fully synthesized by a gene synthesis company after codon optimization, and the base sequence was shown in SEQ ID NO.1. It was connected into the plasmid pET28(a) and transferred into E. coli BL21(DE3) to obtain the original bacteria E. coli BL21(DE3)-pET28(a)-gadB named WT.

[0036] The method for obtaining a glutamate decarboxylase mutant comprises the following steps:

[0037] 1. Follow QuickMutation TM Gene random mutation kit designs primers and random mutations. The primer sequences are:

[0038] random-F:gatatacatatgataaataacgtagatctag; SEQ ID NO.5;

[0039] random-R: ggtggtggtgctcgagactgcgcactgtgg; SEQ ID NO.6;

[0040] 2. Random Mutation PCR Reaction

[0041] Random mutation PCR reaction Refer to the following table to set up the random mutation PCR reaction system:

[0042] Table 1 Random mutation PCR reaction system

[0043]

[0044] Set up the PCR instrument according to the following parameters:

[0045] Table 2 PCR instrument parameter settings

[0046]

[0047] 3. Transformation of Competent Cells

[0048] Take 10 μL of PCR product and detect it with 1% agarose. After the target band is observed, add 1 μL of DpnI enzyme to the remaining PCR product and incubate at 37°C for 1 hour. Add 2-5 μL of digestion product to 50 μL of competent cells, mix well and place on ice for 30 minutes, then heat shock in a 42°C water bath for 45 seconds, and immediately place on ice for 2-5 minutes. Then add 250 μL of LB medium, culture at 200 rpm and 37°C for 1 hour, take 100-200 μL of bacterial solution and culture overnight on a kanamycin-resistant plate. Multiple mutants were obtained, among which the mutant with improved thermal stability and optimal temperature was named M17, and the amino acid sequence is shown in SEQ ID NO.2. M17 mutants are Q38N, R337E, and L355D;

[0049] 4. Expression of glutamate decarboxylase:

[0050] The original bacteria and mutants were cultured in LB medium (kanamycin 50 mg / L) at 37°C, 200 rpm overnight, and inoculated into the fermentation medium at 5% inoculum for expansion. 600 =0.4~1.0, add 0.3mM IPTG, induce at low temperature overnight, and collect wet cells of glutamate decarboxylase by centrifugation as catalyst.

[0051] The seed culture medium and fermentation culture medium are: 5g / L yeast extract, 10g / L peptone, 10g / L NaCl, sterilized at 121°C for 20min, and after cooling, kanamycin with a final concentration of 10-100mg / mL is added.

[0052] Example 2 Effect of pH on Enzyme Properties

[0053] Enzyme reactions have their optimal pH range. Too high or too low pH values ​​will affect the activity of enzyme catalytic reactions. This experiment will simultaneously determine the optimal reaction pH of the unmutated WT and mutant M17. Prepare several groups of 100mL reaction solutions, the reaction system contains 50mM glutamate, 0.05mM 5-pyridoxal phosphate, and 5g / L glutamate decarboxylase wet bacteria. Adjust the pH value to 3.0-6.0 respectively, place it at 40℃ for 30min, and measure the changes of γ-aminobutyric acid in the reaction solution by HPLC at regular intervals. The unmutated catalytic yield measured at pH = 5.0 is used as the control and recorded as 100%. The relative enzyme activity at other pH values ​​is calculated in this way.

[0054] Enzyme activity of glutamate decarboxylase (U): Unit enzyme activity is defined as the amount of enzyme required to catalyze glutamate to produce 1 μmol of γ-aminobutyric acid per minute at 40°C and pH 5.0.

[0055] Relative enzyme activity of glutamate decarboxylase (U / mg): the enzyme activity per milligram of glutamate decarboxylase.

[0056] The results are as follows Figure 1 As shown, the optimal pH of mutant M17 is reduced, the optimal pH of WT is 5.0-5.5, and the optimal pH of mutant M17 is 3.0-3.5. This shows that mutant M17 has a wider pH adaptation range and can show higher enzyme activity under reaction conditions where pH is not naturally controlled. This feature makes mutant M17 more advantageous in actual production, especially in environments where reactions need to be carried out at lower pH values.

[0057] Example 3 Effect of temperature on enzyme properties

[0058] Temperature can change the speed of enzyme catalytic reaction and also lead to reduced or inactivated enzyme protein activity. The optimal reaction temperature of unmutated WT and mutant M17 was determined at the same time. Reacted at 35, 40, 45, 50, and 55°C for 30 minutes. In the respective optimal pH solutions, the reaction system contained 50mM glutamate, 0.05mM 5-pyridoxal phosphate, and 5g / L glutamate decarboxylase wet bacteria. HPLC was used to regularly measure the changes in γ-aminobutyric acid in the reaction solution, and the enzyme activity value of WT measured at 40°C was taken as 100%, and the relative enzyme activity at other temperatures was calculated.

[0059] The results are as follows Figure 2 As shown, the optimum temperature of WT is 40°C, and the optimum temperature of mutant M17 is consistent with that of the original bacteria WT, but the relative activity is significantly improved.

[0060] The unmutated WT and mutant M17 were incubated at 40°C, with pH 5.0 and 3.5, respectively. The enzyme activity without incubation was 100%, and the residual enzyme activity at different incubation times was measured to calculate the half-life. The results are shown in Table 3. It can be seen that at pH 5.0, the half-life of mutant M17 is 1.78 times that of WT; at pH 3.5, the half-life of mutant M17 is 2.22 times that of WT. This shows that M17 has the ability to tolerate low pH.

[0061] Table 3 Half-life at each optimal pH

[0062] Half-life / h pH 5.0 pH 3.5 WT 5.98 3.03 M17 10.67 6.73

[0063] Enzyme reactions have their optimal pH range. Too high or too low pH values ​​will affect the activity of enzyme catalytic reactions. This experiment will simultaneously determine the optimal reaction pH of the unmutated WT and mutant M17. Prepare several groups of 100mL reaction solutions, the reaction system contains 50mM glutamate, 0.05mM 5-pyridoxal phosphate, and 5g / L glutamate decarboxylase wet bacteria. Adjust the pH value to 3.0-6.0 respectively, place it at 40℃ for 30min, and measure the changes of γ-aminobutyric acid in the reaction solution by HPLC at regular intervals. The unmutated catalytic yield measured at pH = 5.0 is used as the control and recorded as 100%. The relative enzyme activity at other pH values ​​is calculated in this way.

[0064] Example 4 Effect of different carriers

[0065] The recombinant plasmids of WT and M17 were constructed on different vectors (pUC19 and pACYC vectors) using the In-Fusion cloning technique and transformed into competent Escherichia coli cells. The bacterial solution was spread on the corresponding resistance plates and cultured overnight to obtain engineered bacteria, and the effects of different vectors on the activity of glutamate decarboxylase were evaluated.

[0066] E.coliBL21(DE3) / pUC19-gadB-WT、

[0067] E.coliBL21(DE3) / pUC19-gadB-M17、

[0068] E.coliBL21(DE3) / pACYC-gadB-WT、

[0069] E.coliBL21(DE3) / pACYC-gadB-M17,

[0070] They were named WT-1, M17-1 and WT-2, M17-2 respectively.

[0071] Use LB medium to culture the engineered bacteria (pUC19 ampicillin 100 mg / L or pACYC chloramphenicol 50 mg / L) and wait until the cell OD 600 =0.4-1.0, add 0.3 mM IPTG, induce at low temperature overnight, and collect wet cells of glutamate decarboxylase by centrifugation as a catalyst.

[0072] The seed culture medium and fermentation culture medium are: 5g / L yeast extract, 10g / L peptone, 10g / L NaCl, sterilized at 121°C for 20min, and after cooling, kanamycin with a final concentration of 10-100mg / mL is added.

[0073] The WT-1 and WT-2 engineered bacteria in Example 4 were used to convert the glutamate substrate with the original bacteria WT. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM 5-phosphate pyridoxal, and 5 g / L glutamate decarboxylase wet bacteria), the reaction was carried out at 40°C and pH 5.0-5.5 for 30 min. The change of γ-aminobutyric acid in the reaction solution was measured by HPLC at regular intervals. The production level of WT measured under these conditions was taken as 100%. The relative production levels of WT-1 and WT-2 were 98.6% and 99.3%, respectively.

[0074] The M17-1 and M17-2 engineering bacteria in Example 4 were subjected to glutamate substrate conversion with the original bacteria mutant M17. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM pyridoxal 5-phosphate, and 5 g / L of glutamate decarboxylase wet bacteria), the reaction was carried out at 40° C. and pH 3.0-3.5 for 30 min, and the HPLC was used to regularly measure the change of γ-aminobutyric acid in the reaction solution. The production level of M17 measured under this condition was taken as 100%, and the relative production levels of M17-1 and M17-2 were 99.4% and 99.2%, respectively.

[0075] This indicates that the M17 mutant has little effect on the expression and activity of glutamate decarboxylase in different vectors (pUC19 and pACYC), and the performance of WT and M17 on the two vectors is similar. Both have good versatility and application potential.

[0076] Example 5 Effects of different hosts

[0077] According to conventional molecular manipulation methods, pHT254 and pHT254-WapA were used to express WT and M17 in Bacillus subtilis. The engineered bacteria were obtained respectively:

[0078] B.subtilis168-pHT254-P grac100 -gadB-WT,

[0079] B.subtilis168-pHT254-P grac100 -gadB-M17,

[0080] B.subtilis168-pHT254-P grac100 -WapA-gadB-WT,

[0081] B. subtilis 168-pHT254-P grac100 -WapA-gadB-M17,

[0082] They were named WT-3, M17-3 and WT-4, M17-4 respectively.

[0083] According to conventional molecular manipulation methods, the glutamate decarboxylase gene (gadB) of WT and M17 was expressed in Corynebacterium glutamicum using pXMJ19 and pEC-XK99E. The following engineered bacteria were obtained respectively to evaluate the effect of different hosts on the activity of glutamate decarboxylase.

[0084] Corynebacterium glutamicumATCC 13002 / pXMJ19-gadB-WT,

[0085] Corynebacterium glutamicumATCC 13002 / pXMJ19-gadB-M17,

[0086] Corynebacterium glutamicumATCC 13002 / pEC-XK99E-gadB-WT,

[0087] Corynebacterium glutamicumATCC 13002 / pEC-XK99E-gadB-M17,

[0088] They were named WT-5, M17-5 and WT-6, M17-6 respectively.

[0089] Bacillus subtilis was cultured in 2×YT medium (chloramphenicol 10 mg / L) at 37°C, 200 rpm overnight, inoculated into the fermentation medium at 5% inoculum, and cultured until the cell OD 600 =0.5-0.8, 1 mM IPTG was added, low temperature induction was carried out overnight, WT-3 and M17-4 were centrifuged to collect the wet cells of glutamate decarboxylase as catalyst, WT-4 and M17-4 were centrifuged to collect the supernatant of glutamate decarboxylase as catalyst.

[0090] 2×YT seed culture medium and fermentation medium: yeast extract powder 10 g / L, peptone 16 g / L, NaCl 5 g / L, sterilize at 121°C for 20 min, add chloramphenicol with a final concentration of 10-50 mg / mL after cooling.

[0091] Corynebacterium glutamicum was cultured in LBB medium (pEC-XK99E kanamycin 50 mg / L or pXMJ19 chloramphenicol 20 mg / L) at 37°C, 200 rpm overnight, and inoculated into the fermentation medium at a 5% inoculum for expansion. 600 =0.4-0.6, 0.1 mM IPTG was added, induced at low temperature overnight, and the whole cells were harvested by centrifugation as catalyst.

[0092] LBB seed medium and fermentation medium: yeast extract 5g / L, peptone 10g / L, NaCl 10g / L, brain heart extract 10g / L, sterilize at 121℃ for 20min, add chloramphenicol with a final concentration of 10-50mg / mL after cooling.

[0093] The WT-3, WT-4, WT-5, and WT-6 engineered bacteria in Example 5 were subjected to glutamate substrate conversion with the original bacteria WT. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM 5-pyridoxal phosphate, and 5 g / L glutamate decarboxylase cells), the reaction was carried out at 40° C. and pH 5.0-5.5 for 30 min, and the change of γ-aminobutyric acid in the reaction solution was determined by HPLC at regular intervals. The production level of WT determined under these conditions was taken as 100%, and the relative production levels of WT-3, WT-4, WT-5, and WT-6 were 99.2%, 99.1%, 99.4%, and 99.1%, respectively.

[0094] The engineering bacteria M17-3, M17-4, M17-5, and M17-6 in Example 5 were subjected to glutamate substrate conversion with the original bacteria mutant M17. In a 100 mL reaction system (comprising 50 mM glutamate, 0.05 mM 5-pyridoxal phosphate, and 5 g / L glutamate decarboxylase cells), the reaction was carried out for 30 min at 40° C. and pH 3.5, and the change of gamma-aminobutyric acid in the reaction solution was determined by HPLC at regular intervals. The production level of M17 determined under these conditions was taken as 100%, and the relative production levels of M17-3, M17-4, M17-5, and M17-6 were 99.3%, 99.5%, 99.1%, and 99.2%, respectively.

[0095] This indicates that the M17 mutant has little effect on the expression and activity of glutamate decarboxylase in different hosts (Bacillus subtilis and Corynebacterium glutamicum), and that WT and M17 perform similarly in the two hosts, demonstrating good versatility and application potential.

[0096] Example 6 Scale-up Production Evaluation

[0097] WT, WT-1, WT-2, WT-3, WT-5, and WT-6 wet bacteria were used as biocatalysts and glutamate was used as substrate to prepare γ-aminobutyric acid by biotransformation. The catalytic system was 10 L, and the catalytic system contained 5M glutamate, 0.05mM 5-phosphate pyridoxal, and 20g / L wet bacteria. The reaction system was reacted in an aqueous solution at 40°C and pH=5.0-5.5. After the reaction, the cells were centrifuged to remove the cells, and the sample was filtered with a 0.22μm membrane and then HPLC was used to detect the yield of γ-aminobutyric acid.

[0098] Using M17, M17-1, M17-2, M17-3, M17-5, and M17-6 wet bacteria as biocatalysts and glutamate as substrate, γ-aminobutyric acid was prepared by biotransformation. The catalytic system was 10 L, and the catalytic system contained 5M glutamate, 0.05mM 5-phosphate pyridoxal, and 20g / L wet bacteria. The reaction system was reacted in an aqueous solution at 40°C. After the reaction, the cells were removed by centrifugation, and the sample was filtered with a 0.22μm membrane and HPLC was used to detect the yield of γ-aminobutyric acid.

[0099] WT-4 extracellular supernatant was used as a biocatalyst and glutamate was used as a substrate for bioconversion to prepare γ-aminobutyric acid. The catalytic system was 10 L, and the catalytic system contained 5M glutamate, 0.05mM pyridoxal 5-phosphate, and 20g / L wet bacteria. The reaction system was carried out in an aqueous solution at 40°C and pH=5.0-5.5. After the reaction, the cells were removed by centrifugation, and the sample was filtered with a 0.22μm membrane and then HPLC was used to detect the yield of γ-aminobutyric acid.

[0100] Using M17-4 extracellular supernatant as biocatalyst and glutamate as substrate, γ-aminobutyric acid was prepared by biotransformation. The catalytic system was 10L, which contained 5M glutamate, 0.05mM pyridoxal 5-phosphate, and 20g / L wet bacteria. The reaction system was reacted in a 40℃ aqueous solution, centrifuged after the reaction, and the sample was filtered with a 0.22μm membrane and HPLC was used to detect the γ-aminobutyric acid yield.

[0101] The results are shown in Table 4. The maximum yield of γ-aminobutyric acid produced by mutant M17 was close to 5M, or 510.6 g / L. The reaction time was 15 h, and the production intensity was 34.04 g / L / h, which was 1.4 times that of the original bacteria.

[0102] The production intensity of the original bacteria WT and mutant M17 was 100%, the relative production intensities of WT-1, WT-2, WT-3, WT-4, WT-5, and WT-6 were 99.8%, 99.9%, 99.9%, 99.9%, 100%, and 99.8%, respectively; the relative production intensities of M17-1, M17-2, M17-3, M17-4, M17-5, and M17-6 were 99.9%, 99.9%, 99.9%, 99.8%, 99.8%, and 99.9%, respectively.

[0103] The catalytic abilities of WT expressed by the engineered bacteria with replaced vectors and hosts were similar to those of the original bacteria WT, and the catalytic abilities of M17 expressed by the engineered bacteria with replaced vectors and hosts were similar to those of the mutant M17, indicating that the M17 mutant had stable high catalytic efficiency under different conditions and had broad prospects for industrial application.

[0104] Table 4 Comparison of catalytic ability of engineered bacteria with replacement of vector and host

[0105]

[0106]

[0107] The mutant M17 catalyzes the substrate to produce γ-aminobutyric acid with a maximum yield of nearly 5M, or 510.6 g / L. The reaction time is 15 h, and the production intensity is 34.0 g / L / h, which is 1.4 times that of the original bacteria.

[0108] The catalytic abilities of other engineered bacteria with replaced vectors and hosts were similar to those of the original bacteria WT and mutant M17, indicating that the M17 mutant had stable high catalytic efficiency under different conditions.

[0109] This suggests that the M17 mutant has significant advantages in large-scale production and is suitable for industrial applications.

[0110] Example 7 Effect on Separation Process

[0111] (1) Removal of bacterial cells: The WT and M17 enzyme conversion solutions in Example 6 were centrifuged at 5000 rpm for 10 minutes to remove bacterial cells, and the supernatant was separated into a crude solution containing γ-aminobutyric acid;

[0112] (2) Membrane filtration: The crude γ-aminobutyric acid solution is filtered through a primary ceramic membrane (pore size of 50 nm), and the retentate is taken to obtain the γ-aminobutyric acid stock solution;

[0113] (3) Concentration and drying: Using a triple-effect evaporator at a pressure of 25 KPa and a temperature of 65° C., the eluate is concentrated to a dry matter concentration of 50%, and then the wet crystals are dried to obtain white γ-aminobutyric acid crystal particles.

[0114] (4) Purity detection: The γ-aminobutyric acid crystal particles obtained after concentration and drying were made into a liquid solution. The solution was filtered with a 0.22 μm membrane and then the purity of γ-aminobutyric acid was detected by HPLC. The results are shown in Table 5.

[0115] Table 5 γ-aminobutyric acid content

[0116] GABA content% Crystalline moisture % Isolation yield% WT 79.6 0.8 88.4 M17 99.2 0.5 90.7

[0117] The filtrate of M17 is uniform, clear and stable. No salt ions are introduced into the reaction system, and no desalting and refining is required through ion exchange or other processes, thereby reducing product loss and separation costs. However, the separation liquid of WT contains a large amount of salt ions, and high-purity γ-aminobutyric acid crystals cannot be obtained through simple recovery operations.

[0118] Comparative Example 1 Transformation Effects of Other Mutants:

[0119] The wet bacteria of other mutants obtained in Example 1 were used as biocatalysts to prepare γ-aminobutyric acid by bioconversion. The catalytic system was 100 mL, and the reaction system contained 50 mM glutamate, 0.05 mM 5-pyridoxal phosphate, and 5 g / L glutamate decarboxylase cells. The reaction system was reacted in an aqueous solution at 40°C and pH = 3.5. After 30 minutes of reaction, the cells were removed by centrifugation. The sample was filtered with a 0.22 μm membrane and then HPLC was used to detect the yield of γ-aminobutyric acid. The mutation sites of the mutants and the catalytic ability of γ-aminobutyric acid are shown in Table 5. The results show that the mutation effects of other mutants are not as good as M17, but on the basis of them, combined with the mutation sites of M17, their catalytic abilities have been greatly improved compared with before;

[0120] Table 5 Comparison of catalytic ability of other mutants

[0121]

[0122] Note: The underlined ones are the mutation sites of the M17 strain screened in this patent

[0123] In summary, through the comparative analysis of the comparative examples and embodiment data of the present application in Table 5, it can be seen that when the mutation sites (Q38N, R337E, L355D) unique to the M17 strain are added to other mutants, these mutants have a significant improvement in the production efficiency of γ-aminobutyric acid. For example, when the mutants Q65N&D106C&K155I&G287A&F338C are used alone, the γ-aminobutyric acid production is 289.6 g / L, and the reaction time is 20 hours; after combining with the mutation sites of M17, the production is increased to 449.6 g / L, and the reaction time is shortened to 15 hours. Similar trends can be observed in all mutants tested. These mutants all contain the key mutation sites of Q38N, R337E, and L355D, and maintain high homology in the core functional region. The mutants obtained can significantly improve their production intensity when applied to the synthesis of γ-aminobutyric acid, and not any similar mutations can achieve the ideal effect. The combination of these specific mutation sites plays an important role in improving the activity of glutamate decarboxylase.

[0124] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed in the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A glutamate decarboxylase mutant, characterized in that: The amino acid sequence of the mutant has at least 99.5% homology with SEQ ID NO.

4.

2. The glutamate decarboxylase mutant according to claim 1, characterized in that: The mutant has the catalytic activity of glutamate decarboxylase, and the amino acid positions 38, 337, and 355 of the reference sequence SEQ ID NO.2 are replaced by asparagine (N), glutamic acid (E), and aspartic acid (D), respectively; in its core functional region, the amino acid sequence except the above mutation sites has at least 99.5% homology with the corresponding core functional region in the reference sequence SEQ ID NO.

4.

3. The glutamate decarboxylase mutant according to claim 2, characterized in that: The amino acid sequence of the mutant is shown in SEQ ID NO.

4.

4. The glutamate decarboxylase mutant according to claim 1, characterized in that: The mutant is derived from glutamate decarboxylase gadB of Lactobacillus brevis.

5. The glutamate decarboxylase mutant according to claim 1, characterized in that: The mutant has the catalytic activity of glutamate decarboxylase, and the amino acid positions 38, 337, and 355 of the reference sequence SEQ ID NO.2 are replaced by asparagine (N), glutamic acid (E), and aspartic acid (D), respectively; in its core functional region, the nucleotide sequence except the above mutation sites has at least 99.5% homology with the corresponding core functional region in the reference sequence SEQ ID NO.

3.

6. The glutamate decarboxylase mutant according to claim 5, characterized in that: The coding gene sequence of the mutant is shown in SEQ ID NO.

3.

7. A recombinant bacterial cell, characterized in that: The recombinant bacterium comprises a gene expression vector encoding the glutamate decarboxylase mutant according to claim 1, wherein the gene expression vector is selected from one of pET28(a), pUC19, pACYC, pHT254, pHT254-WapA, pXMJ19 or pEC-XK99E; the expression host cell of the recombinant bacterium is selected from one of Escherichia coli, Bacillus subtilis or Corynebacterium glutamicum.

8. Use of the recombinant bacterial cell according to claim 7 in the preparation of γ-aminobutyric acid, characterized in that: The recombinant bacteria undergo a biotransformation process under the conditions of pH 3.0-4.0 and 35-45° C. After the biotransformation is completed, the bacterial cells are removed by centrifugation, and the obtained supernatant is directly concentrated and dried to obtain a high-purity γ-aminobutyric acid product.

9. The use according to claim 8, characterized in that: The catalytic system of the recombinant bacteria in the biological transformation process includes: 4-6M glutamate substrate, 0.03-0.07mM 5-phosphate pyridoxal and 10-25g / L recombinant bacteria cells for reaction.

Images