Method for immobilizing 2-halogenated acid dehalogenase, product and application

Abstract

The invention discloses a method for immobilizing 2-halogenated acid dehalogenase, a product and application. A short peptide QH-tag with glutamine residues and zymoprotein are subjected to fusion expression, so that the zymoprotein with the QH-tag can be used for subsequent fixed-point covalent immobilization with amino functional resin, and mTG can catalyze immobilization of the amino functional resin on the zymoprotein under mild conditions. The method realizes direct fixed-point immobilization of target zymoprotein from the cell lysate, the economic cost is reduced, and the prepared immobilized resin is used for subsequent debrine hydrolysis reaction of S-(-)-2-chloropropionic acid.

Description

Technical Field

[0001] The invention belongs to the field of enzyme immobilization and biodegradation, and relates to a method for fixing 2-haloacid dehalogenase, a product and an application thereof, and specifically relates to a method for fixing 2-haloacid dehalogenase by using amino-functionalized resin, a product and an application thereof in dehalogenation and hydrolysis of S-(-)-2-chloropropionic acid. Background Art

[0002] 2-Haloacid dehalogenase (EC 3.8.1.X) catalyzes the dehalogenation of 2-haloacids to the corresponding 2-hydroxy acids. This type of enzyme can not only degrade halogenated pollutants in the environment, but also has a broad substrate spectrum and efficient chiral resolution characteristics, so it has broad application prospects in environmental protection and green synthesis of chiral intermediates. The existing hydrolysis of 2-haloacids is mostly catalyzed by free 2-haloacid dehalogenase, which usually has problems of poor stability and difficulty in reuse during use, and has high operating costs.

[0003] Enzyme immobilization is currently the simplest and most economical method to improve the stability and reusability of enzymes. The most commonly used enzyme immobilization strategies include adsorption, embedding and covalent crosslinking. Among them, although physical adsorption and embedding methods can keep the enzyme protein at a high catalytic activity, due to its unstable attachment, the enzyme protein is easy to fall off the carrier, resulting in low reusability. Therefore, the covalent coupling strategy is more attractive. Unfortunately, the traditional covalent crosslinking method will randomly connect the amino acid side chain functional groups (such as -NH2, -COOH, -SH) on the enzyme, burying the active center of the enzyme and destroying the three-dimensional structure, resulting in the catalytic activity of the enzyme being greatly inhibited. Among them, the most typical example is the use of glutaraldehyde as a crosslinking agent, based on the functional groups on the enzyme surface, mediating the disordered covalent crosslinking of the enzyme protein to form crosslinked enzyme crystals (CLEC) and crosslinked enzyme aggregates (CLEAs). Although it can overcome the shortcomings of poor stability of traditional immobilized enzymes, it cannot meet the actual industrial application requirements due to poor particle size control, low activity and high viscosity. Summary of the invention

[0004] In order to overcome the shortcomings of the prior art, the present invention provides a method for fixing 2-haloacid dehalogenase, a product and an application thereof, which is a method for fixing the enzyme on the surface of an amino-functionalized resin by utilizing the catalytic action of microbial transglutaminase (mTG). In order to achieve accurate capture and covalent cross-linking of the target enzyme by the amino-functionalized resin, the present invention fixes a short peptide Q with a glutamine residue H -tag(AWRHP Q FGG) and enzyme protein were fused and expressed, so that H-tag enzyme protein can be used for subsequent fixed-point covalent fixation with amino-functionalized resin, and mTG can catalyze the fixation of enzyme protein by amino-functionalized resin under mild conditions. The present invention realizes the direct fixed-point fixation of target enzyme protein from cell lysate without purification, thus reducing economic costs. At the same time, Q is added to the C-terminus of 2-haloacid dehalogenase by gene cloning. H -tag, realizes the fixed-point covalent coupling between the target enzyme and the carrier, not only ensures the natural conformation of the enzyme, but also avoids the enzyme protein from falling off during use. The immobilized enzyme prepared by the present invention is used for the dehalogenation degradation reaction of S-(-)-2-chloropropionic acid.

[0005] The specific technical scheme of the present invention is: The first object of the present invention is to disclose a method for fixing 2-haloacid dehalogenase, specifically: Fusion of Q to 2-haloacid dehalogenase H -tag, to obtain fusion protein; Add fusion protein and microbial transglutaminase mTG to the amino-functionalized resin to make the Q H -tag is specifically covalently linked to the long-chain free amino groups on the surface of the amino-functionalized resin, thereby achieving specific site-specific covalent fixation; Preferably, the 2-haloacid dehalogenase is ST2570, which is derived from Sulfolobus tokodaiistr.7. More preferably, the coding gene sequence of the 2-haloacid dehalogenase is shown in SEQ ID NO.1; Preferably, the microbial transglutaminase mTG is derived from Streptomyces mobaraensis. More preferably, the encoding gene sequence of the microbial transglutaminase is shown in SEQ ID NO.2. The Q H -tag encoding gene sequence is shown in SEQ ID NO.3.

[0006] Preferably, the amino-functionalized resin is a porous polymer microsphere rich in long-chain amino groups on the surface, and its structural formula is R-NH2, wherein the R group represents a polystyrene group, preferably at least two selected from a styrene group, a chloromethylstyrene group, a chlorostyrene group, and a bromostyrene group; Preferably, the molar ratio of the fusion protein to the microbial transglutaminase mTG is 2-8:1, the specific covalent linking reaction temperature is 15-30°C, and the reaction time is 1-6 h.

[0007] Make ST2570-Q H Q on fusion enzyme protein HThe method of site-specific covalent fixation of -tag with amino-functionalized resin is as follows: under the catalysis of microbial transglutaminase mTG, the long-chain free amino groups (-NH2) rich in amino-functionalized resin react with Q H -The amide group of glutamine (Q) on the tag reacts, thereby achieving the fixation of the enzyme protein on the resin carrier; Preferably, the post-treatment of the specific covalent ligation reaction is to collect the product after the specific site-specific covalent fixation by centrifugation at a speed of 6000-10000 rpm for 5 min and to use 0.05 mol·L -1 The mixture was washed with Tris-acetate buffer at pH 7.5 for 3 to 5 times, and the supernatant was tested by Bradford method until no protein was detected. The product after specific site-specific covalent fixation is an amino-functionalized resin with the fusion protein fixed on the surface.

[0008] The second object of the present invention is to disclose an immobilized enzyme prepared by the above method.

[0009] The third object of the present invention is to disclose the application of the above-mentioned immobilized enzyme, wherein: the application is for dehalogenation and hydrolysis of S-(-)-2-chloropropionic acid.

[0010] The application described in the above technical scheme is specifically: the amino-functionalized resin with the fusion protein fixed on the surface is mixed with the substrate S-(-)-2-chloropropionic acid and suspended in a glycine-NaOH buffer, and reacted at 60~90°C for 1~5 hours to dehalogenate and hydrolyze the substrate.

[0011] Preferably, the concentration of the glycine-NaOH buffer is 50 mM and the pH is 8-10.5.

[0012] Preferably, the ratio of the amino-functionalized resin for the surface-fixed immobilization of the fusion protein to the substrate S-(-)-2-chloropropionic acid is 15 mg: 5-20 mmol.

[0013] The present invention has the following beneficial effects: 1. The present invention adopts Q H -tag / mTG-mediated bioorthogonal method can achieve specific covalent fixation on the resin carrier rich in amino groups on the surface. Compared with the traditional immobilization method, the immobilization method of the present invention is orderly and controllable, which can maximize the uniform and reasonable orientation of the active site of the enzyme protein, and the fixation process is gentle and simple, which can largely avoid the loss of enzyme activity.

[0014] 2. The present invention is based on carrier immobilization. Compared with carrier-free cross-linked enzyme aggregates, the carrier-immobilized enzyme of the present invention is more suitable for industrial production applications and has better rigidity, mechanical resistance and stability.

[0015] 3. The immobilization process of the present invention is carried out under mild conditions and only requires the catalysis of mTG to complete, causing minimal pollution to the environment, which is in line with the concept of "green chemistry".

[0016] 4. The immobilization method of the present invention combines the originally time-consuming enzyme purification process and the immobilization process into a one-step operation, thus saving the economic and time costs brought by the purification process to a great extent. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a SEM image of the porous polymer resin rich in amino groups on its surface used in the present invention.

[0018] Figure 2 2-Haloacid dehalogenase fusion protein ST2570-Q H SDS-PAGE gel image of ST2570-Q H Fusion protein, b is ST2570-Q with the introduction of molecular chaperone pGro7 (G7) for co-expression H Fusion protein.

[0019] Figure 3 The mechanism of the site-specific covalent immobilization process catalyzed by mTG of the present invention and the surface site-specific immobilization of ST2570-Q H Schematic diagram of the dehalogenation and hydrolysis of S-(-)-2-chloropropionic acid catalyzed by the amino-functionalized resin of the fusion protein.

[0020] Figure 4 ST2570-Q for mTG H CLSM analysis of the fusion protein immobilized on amino-functionalized resin.

[0021] Figure 5 This is the SDS-PAGE gel image of each protein in the fixed-point reaction system catalyzed by mTG before and after fixation; M is the protein marker, and lane 1 is ST2570-Q H The fusion protein cell disruption supernatant, lane 2 is the pure mTG enzyme, lane 3 is the mixed system before the immobilization reaction, lane 4 is the mixed system after the immobilization reaction, and lanes 5-7 are the residual liquids from the washing of the immobilized resin.

[0022] Figure 6 ST2570-Q for mTG H EDS characterization of fusion protein immobilized on amino-functionalized resin, where Q S -tag is in QH A cysteine ​​is added to the base of the -tag.

[0023] Figure 7 For fixing ST2570-Q H The curves of the activity of fusion protein and free ST2570 enzyme changing with pH value.

[0024] Figure 8 For fixing ST2570-Q H The curves of the activity of fusion protein and free ST2570 enzyme changing with temperature.

[0025] Fig. 9 For fixing ST2570-Q H Comparison of thermal stability of fusion protein and free ST2570.

[0026] Fig.10 Fixing ST2570-Q to a surface H Degradation reaction progress of S-(-)-2-chloropropionic acid at different concentrations by amino-functionalized resin fused with enzyme protein.

[0027] Fig.11 ST2570-Q for mTG H The fusion protein was immobilized on the amino-functionalized resin and ST2570-Q was immobilized by physical adsorption. H Comparative graph of the reusability of fusion proteins immobilized on amino-functionalized resins. DETAILED DESCRIPTION

[0028] As mentioned above, in view of the shortcomings of the prior art, the inventors of this case have conducted long-term research and extensive practice, and this embodiment provides a method for fixing 2-haloacid dehalogenase and its product, specifically: Fusion of Q to 2-haloacid dehalogenase H -tag, to obtain fusion protein; Add fusion protein and microbial transglutaminase mTG to the amino-functionalized resin to make the Q H -tag is specifically covalently linked to the long-chain free amino groups on the surface of the amino-functionalized resin, thereby achieving specific site-specific covalent fixation; As one example of this embodiment, the 2-haloacid dehalogenase is ST2570, which is derived from Sulfolobus tokodaii str.7. More preferably, the coding gene sequence of the 2-haloacid dehalogenase is shown in SEQ ID NO.1; The microbial transglutaminase mTG is derived from Streptomyces mobaraensis. More preferably, the coding gene sequence of the microbial transglutaminase is shown in SEQ ID NO.2. The Q H -tag encoding gene sequence is shown in SEQ ID NO.3.

[0029] The amino-functionalized resin is a porous polymer microsphere rich in long-chain amino groups on the surface, and its structural formula is R-NH2, wherein the R group represents a polystyrene group, preferably at least two selected from a styrene group, a chloromethylstyrene group, a chlorostyrene group, and a bromostyrene group; the preparation of the amino-functionalized resin used in the following examples is as follows: 1 g of epoxy resin LXTE-700S (Gaoling Lanxiao Technology New Materials Co., Ltd.) is added to 20 mL of toluene, 0.39 g of propylene diamine (5.26 mmol) is added, and the reaction is carried out at 80 ° C for 24 h. The obtained resin is repeatedly washed with dichloromethane, ethanol and water, and the resin is collected by suction filtration. The resin is in the form of white powder. Figure 1 It can be seen that the resin has a regular spherical structure with a particle size of 50-300 µm. At the same time, it can be observed that the resin surface is loose and porous.

[0030] The molar ratio of the fusion protein to the microbial transglutaminase mTG is 2-8:1, the specific covalent connection reaction temperature is 15-30°C, and the time is 1-6 hours.

[0031] Make ST2570-Q H Q on fusion enzyme protein H The method of site-specific covalent fixation of -tag with amino-functionalized resin is as follows: under the catalysis of microbial transglutaminase mTG, the long-chain free amino groups (-NH2) rich in amino-functionalized resin react with Q H -The amide group of glutamine (Q) on the tag reacts, thereby achieving the fixation of the enzyme protein on the resin carrier; The post-treatment of the specific covalent ligation reaction is to collect the product after specific site covalent fixation by centrifugation at a speed of 6000-10000 rpm for 5 min and use 0.05 mol·L -1 The mixture was washed with Tris-acetate buffer at pH 7.5 for 3 to 5 times, and the supernatant was tested by Bradford method until no protein was detected. The product after specific site-specific covalent fixation is an amino-functionalized resin with the fusion protein fixed on the surface.

[0032] This embodiment also provides the application of the above product in the dehalogenation and hydrolysis of S-(-)-2-chloropropionic acid.

[0033] As one of the examples of this embodiment, the amino-functionalized resin with the fusion protein fixed on the surface is mixed with the substrate S-(-)-2-chloropropionic acid and suspended in a glycine-NaOH buffer, and reacted at 60-90°C for 1-5 hours to dehalogenate and hydrolyze the substrate.

[0034] The concentration of the glycine-NaOH buffer is 50 mM and the pH is 8-10.5.

[0035] The dosage ratio of the amino-functionalized resin for fixedly fixing the fusion protein on the surface to the substrate S-(-)-2-chloropropionic acid is 15 mg: 5-20 mmol.

[0036] The present invention uses a porous polymer resin rich in long-chain free amino groups as a carrier, and under the mediation of microbial transglutaminase mTG as a catalyst, achieves rapid and specific site-specific fixed fusion expression of Q under relatively mild conditions. H -tag target enzyme protein, and evenly coat a layer of enzyme protein on the resin surface.

[0037] For the fixation method, the present invention selects Q H Compared with the traditional fixation method, the bioorthogonal method of -tag / mTG avoids the most time-consuming and complicated problem of enzyme purification. The introduction of microbial transglutaminase mTG binds the free amino groups on the surface of the carrier to Q H -tag for specific reaction, making the complex fixation conditions simple and mild, and fast and accurate fixation can be performed at 15~30 ℃. This method combines purification with immobilization, and simplifies the two-step operation into a one-step operation while ensuring the activity of the immobilized enzyme.

[0038] To make the technical scheme of the present invention easy to understand, the following is a further description of a method and application of fixing 2-haloacid dehalogenase of the present invention in conjunction with specific test examples. The content of the present invention is described in more detail in conjunction with the examples below. The plasmids, endonucleases, ligases, PCR enzymes, column DNA extraction kits, DNA gel recovery kits, etc. used in the following examples are all commercial products, and the specific operations are carried out according to the kit instructions. PCR, nucleic acid agarose gel electrophoresis, protein SDS-PAGE gel electrophoresis, heat shock conversion, preparation of competent cells, and extraction and preservation of bacterial genomes and other conventional operating methods are carried out according to Molecular Cloning: A Laboratory Manual (Fourth Edition). The sequencing of plasmids and DNA products and gene synthesis were all handed over to Beijing Qingke Biotechnology Co., Ltd.

[0039] Example 1: Fusion protein ST2570-Q H Construction of recombinant expression vector; (1) Fusion protein ST2570-Q H Gene fragment acquisition: ST2570 was used as template, ST2570-Q H F1 / R1, ST2570-Q H F2 / R2 were used as primers, and two PCRs were performed to obtain ST2570-Q with restriction sites Nde Ⅰ and BamH Ⅰ. H Gene fragments (primer sequences involved are shown in Table 1).

[0040] Table 1: ST2570-Q H Primers for constructing fusion protein gene fragments Primer name Primer sequence (5'→3') <![CDATA[ST2570-Q H F1]]> GGAATTCCATATGATCATCCTGGCGTT <![CDATA[ST2570-Q H R1]]> CCAAACTGCGGATGTCTCCACGCCCCTGAACCTTTGTAGCGCAGAATCCATTC <h2 style=";text-align:left;direction:ltr"><![CDATA[ST2570-Q <h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> F2]]><h2 style=";text-align:left;direction:ltr"> GGAATTCCATATGATCATCCTGGCGTT <![CDATA[ST2570-Q H R2]]> CGCGGATCCCTAGCCGCCAAACTGCGGATGTCTCC (2) ST2570-Q was cloned using Nde Ⅰ restriction endonuclease and BamH Ⅰ restriction endonuclease. H After single restriction digestion, the gene fragment was inserted into the plasmid pET22b treated with the same restriction digestion, and ligated overnight with T4 ligase to construct pET22b-ST2570-Q. H Recombinant expression vector.

[0041] Example 2: Transformation and expression of recombinant plasmid 1. Take 10 uL of the recombinant expression vector pET22b-ST2570-Q obtained in Example 1 H Add to 100 μL of E. coli BL21 competent cells and incubate on ice for 15-45 min.

[0042] 2. Place the BL21 competent cells after standing in step 1 in a 42°C water bath, heat shock for 30-60 seconds, place on ice for 2-5 minutes, add LB medium to make up to 1 mL, and culture in a shaker at 37°C and 160 rpm for 60-80 minutes.

[0043] The formula of LB medium is: 10 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, autoclaved at 120°C for 21 min, and cooled at room temperature for use.

[0044] 3. Spread the culture product of step 12 onto a plate containing the corresponding ampicillin resistance, pick a single colony and add it to 10 mL of LB medium for expansion culture; take out an appropriate amount of bacterial solution and inoculate it into 100 mL of TB medium, shake and culture the E. coli at 220 rpm in a 37°C constant temperature incubator until its OD 600= 0.6-0.8, add isopropyl-β-D-thiogalactoside (IPTG) to induce expression, and place the bacteria in a constant temperature shaker at 18°C ​​to induce expression for 16 h, with the final IPTG concentration of 0.1 mM.

[0045] Among them, the formula of TB medium is: Preparation of solution A: Dissolve 10 g of tryptone and 12 g of yeast extract in 500 mL of deionized water and dispense the solution. Autoclave at 120°C for 21 min and cool at room temperature for later use.

[0046] Preparation of solution B: Dissolve 2 g of glycerol, 6.27 g of anhydrous potassium dihydrogen phosphate, and 1.17 g of anhydrous potassium dihydrogen phosphate in 500 mL of deionized water and divide into portions. Autoclave at 120°C for 21 min and cool at room temperature for later use.

[0047] When using, mix solution A and solution B evenly in a volume ratio of 1:1.

[0048] 4. After the colonies were induced in step 3, they were resuspended in Tris-acetate buffer and then disrupted with an ultrasonic cell disruptor. The supernatant of the cell disruption solution, the insoluble sample and the purified enzyme protein were subjected to SDS-PAGE detection. The detection results were as follows: Figure 2 To facilitate ST2570-Q H In order to achieve soluble expression and avoid excessive accumulation of inclusion bodies, the molecular chaperone pGro7 (G7) was introduced for co-expression. Figure 2 is the SDS-PAGE gel image of the fusion protein, where a is ST2570-Q H Fusion protein; b is ST2570-Q with the introduction of molecular chaperone G7 for co-expression H Fusion protein. Figure 2 This indicates that the fusion protein was successfully constructed and expressed. The co-expression of the molecular chaperone G7 contributes to the expression of ST2570-Q H folding and soluble expression.

[0049] Example 3: Fixing ST2570-Q at a fixed point on the surface H Preparation and characterization of amino-functionalized resins for fusion proteins The mechanism of the fixed-point immobilization process of the present invention and the surface fixed-point immobilization ST2570-Q H Schematic diagram of the dehalogenation and hydrolysis of S-(-)-2-chloropropionic acid catalyzed by the amino-functionalized resin of the fusion protein is shown in Figure 3 As shown, the specific steps are as follows: 1. Take 200 mg of amino-functionalized resin and add 10 mg of ST2570-Q HThe supernatant of the cell lysis solution of the fusion protein was added with 3 mg of mTG as a catalyst, and then the reaction solution was shaken at 23 °C and 200 rpm for 4 h to fully fix the amino-functionalized resin to ST2570-Q H After the reaction, the resin was collected by centrifugation at 10,000 rpm for 5 min at 4 °C and washed three times with pH 7.5 Tris-acetate buffer to obtain the immobilized enzyme ST2570-Q H @R.

[0050] 2. To prove that mTG can convert ST2570-Q H The fusion protein was immobilized on amino-functionalized resin and genetically engineered in ST2570-Q H A short peptide tetracysteine ​​tag was added to the fusion protein (the primer sequences involved are shown in Table 2). The specific sequence was Cys-Cys-Pro-Gly-Cys-Cys. ST2570-Q on the amino-functionalized resin was quenched with FlAsh-EDT2. H The tetracycline tag on the fusion protein was specifically labeled. The other group did not add mTG under the same conditions. The resins of both groups were washed with 1 M NaCl solution to denature and precipitate the proteins physically adsorbed on the surface. FlAsh-EDT2 fluorescein can be used with ST2570-Q H The tetracycline tag on the surface of the molecule binds to the molecule and excites green fluorescence in the range of 577 nm-492 nm. Figure 4 As shown, Figure 4 ST2570-Q for mTG H CLSM analysis of the fusion protein immobilized on amino-functionalized resin. Figure 4 a is the immobilized amino-functionalized resin with mTG added, and it can be observed that the entire surface of the resin microsphere emits bright green fluorescence; Figure 4 b is the immobilized resin without adding mTG under the same conditions, Figure 4 c is the blank control amino-functionalized resin without any enzyme protein added, Figure 4 b and Figure 4 c The surface emits very weak green fluorescence, which can be considered as the residual dye after cleaning and is an operational error value. Figure 4 Description ST2570-Q H The fusion protein was successfully immobilized on the resin surface under the catalysis of mTG.

[0051] Table 2: In ST2570-Q H Add tetracycline tag primer to fusion protein Primer name Primer sequence (5'→3') <![CDATA[TT-ST2570-Q H F]]> GGAATTCCATATGTGTTGTCCGGGTTGTTGTGGCAGCAGCATCATCCTGGCGTTCGACA <![CDATA[TT-ST2570-Q H R]]> CGCGGATCCCTAGCCGCCAAACTGCG 3. In order to characterize the fixation of the fixed-point fixation method of the present invention, the supernatant before and after the fixation reaction system and the washing liquid after fixation were subjected to SDS-PAGE detection (see Figure 5 ). Figure 5 a is the ST2570-Q in the system mixture before the fixed reaction H Fusion proteins; Figure 5 b is the ST2570-Q in the mixed solution after the fixed reaction. H Fusion protein. Figure 5 It is shown that the fixed-point fixing method of the present invention has a higher fixing rate.

[0052] 4. To observe ST2570-Q H The distribution of fusion protein on the surface of amino-functionalized resin is shown in the original Q H -A cysteine ​​was inserted into the tag sequence to form a new Q S -tag (the primer sequences involved are shown in Table 3). Then ST2570-Q was prepared according to Example 1-2 S Fusion protein. Figure 6 ST2570-Q for mTG S EDS characterization of fusion protein immobilized on amino-functionalized resin. By observing the distribution of S element on the resin surface, it can be seen that the distribution of enzyme protein on the resin surface is uniform and dense (see Figure 6 ).

[0053] Table 3: In the original Q H -Tag sequence with a cysteine ​​primer inserted Primer name Primer sequence (5'→3') <![CDATA[ST2570-Q S F]]> GGAATTCCATATGATCATCCTGGCGTTCGACA <![CDATA[ST2570-Q S R]]> CGCGGATCCCTAGCCGCCAAACTGCGGATGTCTCCACGCACACCCTGAACCTTTGTAGCGC Example 4: Immobilization of ST2570-Q H Determination of enzymatic properties of fusion protein Definition of relative enzyme activity: Under certain conditions, the amount of enzyme required to produce 1 µmol of chloride ions per minute is defined as 1 unit of enzyme activity. The highest enzyme activity is defined as 100%, and the enzyme activity under other conditions is measured and calculated based on this standard.

[0054] 1. The concentration of chloride ions removed from the substrate in the reaction system was detected by the mercuric thiocyanate colorimetric method of Bergmann and Sanik. The immobilized enzyme ST2570-Q was prepared by adding an appropriate amount of Example 3 to 50 mM glycine-sodium hydroxide buffer (pH 9.5) and 1 mM S-(-)-2-chloropropionic acid. H@R formed a 5 mL reaction system and reacted for 5 minutes at 80°C and 200 rpm stirring conditions. Take 1 mL of the reaction solution, add 100 µL of 0.25 M ammonium ferric sulfate in HNO3 (9 M) solution and 100 µL of saturated ethanol solution of mercuric thiocyanate, mix thoroughly by inverting the centrifuge tube, and then let stand at room temperature for 5 minutes. Use UV-1900i (Shimadzu, Kyoto, Japan) to measure the absorbance value of each sample at 460 nm, and calculate the amount of chloride ions removed by the enzymatic reaction in combination with the standard curve.

[0055] 2. Determination of optimum pH value The surface of the ST2570-Q H Amino-functionalized resin ST2570-Q for fusion proteins H @R performs the following reaction: The total reaction system was 5 mL, which was resuspended in buffer solutions of different pH values, and S-(-)-2-chloropropionic acid was added at a final concentration of 1 mM. After stirring with a magnetic stirrer at 80°C for 5 min, the reaction was terminated by centrifugation. The chloride ion content produced in the reaction system was determined by mercuric thiocyanate colorimetry in the reaction supernatant. The chloride ion content was used to calculate the immobilized ST2570-Q H Amino functionalized resin ST2570-Q H @R activity. The results are as follows Figure 7 As shown by Figure 7 It can be seen that the prepared ST2570-Q immobilized on the amino functionalized resin H The fusion protein has the highest activity at pH 9.5, which is consistent with the optimal pH of the free enzyme and retains the advantages of ST2570.

[0056] 3. Determination of optimum temperature Take the immobilized ST2570-Q obtained in Example 3 of the present invention H The amino-functionalized resin of the fusion protein was subjected to the following reaction: The total reaction system was 5 mL, which was resuspended in a pH 9.5 buffer, and S-(-)-2-chloropropionic acid was added at a final concentration of 1 mM. After stirring with a magnetic stirrer at 50-100°C for 5 min, the reaction was terminated by centrifugation. The reaction supernatant was determined by mercuric thiocyanate colorimetry to determine the chloride ion content produced in the reaction system. The chloride ion content was used to calculate the immobilized ST2570-Q H The results are as follows Figure 8 As shown by Figure 8 It can be seen that the prepared ST2570-Q immobilized on the amino functionalized resin HThe fusion protein had the highest activity at 90℃, which was slightly higher than the optimal reaction temperature of the free enzyme, 80℃. It may be that the immobilization treatment improved the heat resistance of ST2570.

[0057] Example 5: Immobilized ST2570-Q H Thermal stability determination of amino-functionalized resins of fusion proteins Definition: Initial immobilized ST2570-Q without heat incubation H The enzyme activity of the amino-functionalized resin was 100%, and the enzyme activities of other conditions were measured and calculated based on this standard.

[0058] Take the immobilized ST2570-Q obtained in Example 3 of the present invention H The amino-functionalized resin of the fusion protein was subjected to the following reaction: The surface is fixed with ST2570-Q H Amino-functionalized resin ST2570-Q for fusion proteins H @R and free enzyme ST2570 were transferred to Tris-acetate buffer and incubated at 70℃, 80℃ and 90℃, and the incubated samples were regularly added to the reaction system. The total reaction system was 5 mL, resuspended with pH 9.5 buffer, and S-(-)-2-chloropropionic acid was added with a final concentration of 1 mM. After stirring with a magnetic stirrer at 80℃ for 5 min, the reaction was terminated by centrifugation. The reaction supernatant was determined by mercuric thiocyanate colorimetry to determine the chloride ion content produced in the reaction system. The chloride ion content was used to calculate the immobilized ST2570-Q H The activity of the amino-functionalized resin of the fusion protein. Fig. 9 As shown by Fig. 9 It can be seen that when ST2570-Q H After incubation at 90°C for 90 min, @R still retained 50% of its initial activity, which is 2.5 times that of the free enzyme. Fig. 9 This indicates that the site-specific immobilization method of the present invention can significantly improve the H Thermal stability of fusion proteins.

[0059] Example 6: Fixing ST2570-Q on a surface H Application of amino-functionalized resins for fusion proteins The calculation formula of substrate degradation rate is as follows: Degradation rate (%) = the amount of chloride ion substance removed by the reaction / the amount of the starting substrate substance × 100% 1. Using S-(-)-2-chloropropionic acid as the substrate, ST2570-Q was immobilized on the surface. H The amino-functionalized resin of the fusion protein was enzymatically degraded. 15 mg of immobilized resin ST2570-QH @R was suspended in 10 mL Tris-acetic acid (pH 9.5) reaction system, the final concentration of S-(-)-2-chloropropionic acid was 5-20 mM, the reaction system was stirred at 80°C, and the resin was separated from the reaction mixture after 3 h of reaction, and the reaction was terminated. When the substrate concentration was 5-15 mM, the immobilized resin could completely dehalogenate and degrade it within 3 h; when the substrate concentration was 20 mM, 88.03±0.93% of its initial amount could be degraded within 3 h (see Fig.10 ).

[0060] 2. To explore the surface fixed point ST2570-Q H To investigate the reusability of the amino-functionalized resin for fusion proteins, 15 mg of immobilized resin was suspended in 10 mL of Tris-acetic acid (pH 9.5) reaction system, and the final concentration of S-(-)-2-chloropropionic acid was 10 mM. The reaction system was stirred at 80 °C. After 1 h of reaction, the resin was separated from the reaction mixture and washed three times with buffer for the next cycle. The resin used in the other group was prepared under the same conditions without the addition of mTG. The results are shown in Fig.11 As shown, Fig.11 Is mTG ST2570-Q H The fusion protein was immobilized on the amino-functionalized resin and ST2570-Q was immobilized by physical adsorption. H Comparison of the reusability of fusion proteins immobilized on amino-functionalized resins. H @R is mTG ST2570-Q H Fusion protein immobilized on amino-functionalized resin; ST2570-Q H @R is the physical adsorption of ST2570-Q H The fusion protein was immobilized on an amino-functionalized resin. After six cycles of degradation with 10 mM S-(-)-2-chloropropionic acid at 80°C, ST2570-Q H @R degradation rate of substrate was maintained at 81.50±0.73% of the initial degradation rate (see Fig.11 ). Fig.11 DescriptionSurface fixed point fixationST2570-Q H The amino-functionalized resin of the fusion protein has good reusability and is significantly better than the resin immobilized by physical adsorption.

[0061] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the present invention.

Claims

1. A method for fixing 2-haloacid dehalogenase, characterized in that Specifically: Fusion of Q to 2-haloacid dehalogenase H -tag, to obtain fusion protein; Add fusion protein and microbial transglutaminase mTG to the amino-functionalized resin to make the Q H The -tag is specifically covalently linked to the long-chain free amino groups on the surface of the amino-functionalized resin, thereby achieving specific site-specific covalent fixation.

2. The method according to claim 1, characterized in that: The 2-haloacid dehalogenase is ST2570, and the encoding gene sequence is shown in SEQ ID NO.1; The coding gene sequence of the microbial transglutaminase mTG is shown in SEQ ID NO.2; The Q H -tag encoding gene sequence is shown in SEQ ID NO.

3.

3. The method according to claim 1, characterized in that: The amino functionalized resin is a porous polymer microsphere with rich long-chain amino groups on the surface.

4. The method according to claim 1, characterized in that: The molar ratio of the fusion protein to the microbial transglutaminase mTG is 2-8:1; the mass ratio of the amino-functionalized resin to the fusion protein is 20-40:

1.

5. The method according to claim 1, characterized in that: The specific covalent linking reaction temperature is 15~30 ℃ and the reaction time is 1~6 h.

6. The method according to claim 1, characterized in that: The post-treatment of the specific covalent linking reaction is to collect the product after the specific site-specific covalent fixation by centrifugation at a speed of 6000-10000 rpm, wash repeatedly 3-5 times with Tris-acetate buffer, and detect by Bradford method until no protein is detected in the supernatant.

7. An immobilized enzyme prepared by the method according to any one of claims 1 to 6.

8. Use of the immobilized enzyme according to claim 7 in the dehalogenation and hydrolysis of S-(-)-2-chloropropionic acid.

9. The use according to claim 8, characterized in that The amino-functionalized resin with the fusion protein fixed on the surface was mixed with the substrate S-(-)-2-chloropropionic acid and suspended in a glycine-NaOH buffer, and reacted at 60-90°C for 1-5 h to dehalogenate and hydrolyze the substrate.

10. The use according to claim 9, characterized in that The dosage ratio of the amino-functionalized resin for fixing the fusion protein on the surface to the substrate S-(-)-2-chloropropionic acid is 15 mg: 5-20 mmol / L.

Images