Promoter element and method for gene editing of plant

Abstract

The invention relates to a promoter element and a method for gene editing of a plant. In particular to a promoter element, an RNA (Ribonucleic Acid) coding element, an esgRNA, an sgRNA bidirectional enhanced expression sequence, a carrier capable of carrying out efficient gene editing in a plant and a method for carrying out gene editing on the plant. The starting element and the vector can improve the gene editing efficiency and the targeting specificity of the plant, and the sgRNA bidirectional enhanced expression sequence can further improve the gene editing efficiency and the targeting specificity of the plant.

Description

Technical Field

[0001] The present disclosure relates to the field of genetic engineering, and in particular, to a promoter element, an RNA coding element, an esgRNA, an sgRNA bidirectional enhanced expression sequence, a vector capable of performing efficient gene editing in plants, and a method for performing gene editing on plants. Background Art

[0002] CRISPR-Cas9 gene editing technology is a method that can accurately and efficiently perform gene editing domain modification, and has important application value in the genetic improvement and functional gene research of crops. Through artificially designed single guide RNA (sgRNA), this technology can identify the target gene and guide the Cas9 protease to cut the target gene, thereby achieving gene insertion or knockout, which plays a key role in plant germplasm innovation and the research and development of new high-yield varieties.

[0003] However, although traditional strong promoters such as 2X35S are often used for plant gene editing, their driving efficiency is relatively limited, resulting in insufficient editing efficiency, especially in complex genomes or higher plants. Exogenous gRNA sequences may trigger plant immune responses, leading to RNA degradation, which further reduces editing efficiency and stability. Therefore, the current CRISPR-Cas9 gene editing technology has the following two major problems: (1) The current promoters (such as the 35S strong promoter) have low transcriptional activity and correspondingly low gene editing efficiency; this means that during the gene editing process, a lot of screening work is required to find gene-edited positive plants, making the whole process very laborious. (2) Efforts to improve gene editing efficiency are limited by the lack of methods to simultaneously increase the expression of Cas9 genes and sgRNAs. Therefore, finding promoters with higher transcriptional activity and developing methods that can simultaneously increase the expression of Cas9 genes and sgRNAs are undoubtedly crucial to the improvement of gene editing technology.

[0004] In summary, the existing CRISPR-Cas9 gene editing technology still faces the problems of low purification or biallelic editing efficiency and difficulty in simultaneously increasing the expression levels of Cas9 gene and sgRNA in polyploid genetic improvement and functional gene research. Summary of the invention

[0005] The purpose of the present disclosure is to provide a promoter element, which can improve the gene editing efficiency and targeting specificity of plants. The present disclosure also provides a sgRNA bidirectional enhanced expression sequence, which further improves the gene editing efficiency and targeting specificity of plants.

[0006] In order to achieve the above-mentioned purpose, the first aspect of the present disclosure provides a promoter element, the nucleotide sequence of which is the full length of the nucleotide sequence shown in SEQ ID NO.1 or a fragment of the nucleotide sequence shown in SEQ ID NO.1; the fragment of the nucleotide sequence shown in SEQ ID NO.1 includes positions 987-1709 of the nucleotide sequence shown in SEQ ID NO.1; preferably, the fragment of the nucleotide sequence shown in SEQ ID NO.1 includes positions 653-1709 of the nucleotide sequence shown in SEQ ID NO.1.

[0007] A second aspect of the present disclosure provides an RNA coding element, wherein the nucleotide sequence of the RNA coding element is the nucleotide sequence shown in SEQ ID NO.2.

[0008] The third aspect of the present disclosure provides a sgRNA bidirectional enhanced expression sequence, wherein the sgRNA bidirectional enhanced expression sequence comprises the RNA coding element and esgRNA according to the second aspect; The sgRNA bidirectional enhanced expression sequence is the nucleotide sequence shown in SEQ ID NO.4.

[0009] Optionally, the esgRNA is a sequence obtained by adding, reducing or replacing some nucleotides on the original sgRNA; the nucleotide sequence of the esgRNA is shown in SEQ ID NO.3.

[0010] The fourth aspect of the present disclosure provides a vector capable of performing efficient gene editing in plants, wherein the vector is inserted with the promoter element described in the first aspect, and preferably, is also inserted with the RNA encoding element described in the second aspect.

[0011] Optionally, in the vector, a 2X35Sp promoter, an sgRNA insertion region, and an eu terminator are further inserted upstream of the promoter element described in the first aspect; and the sgRNA bidirectional enhanced expression sequence or esgRNA described in the third aspect is inserted into the sgRNA insertion region.

[0012] Optionally, a spCas9 protein expression element, a ubp terminator and a hygromycin selection marker are further inserted into the vector downstream of the promoter element described in the first aspect.

[0013] A fifth aspect of the present disclosure provides a method for gene editing in plants, the method comprising the following steps: S1. Inserting a gRNA coding sequence targeting the gene to be edited into the sgRNA insertion region of the vector described in the fourth aspect to obtain a gene editing vector; S2, transforming Agrobacterium with the gene editing vector to obtain a transformant; S3, infecting a plant culture with the transformant to obtain an infected plant culture; S4. Cultivating the infected plant culture in a culture medium containing hygromycin to obtain a gene-edited plant.

[0014] Optionally, the nucleotide sequence of the gRNA targeting the gene to be edited is SEQ ID NO.5.

[0015] Optionally, the plant is selected from tobacco, tomato, soybean, cotton, pepper, rape, eggplant, cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis, sesame, quinoa, sesbania, grape, apple, pear, kiwi, chrysanthemum, dandelion, phalaenopsis and wintergrass, and at least one of rice, wheat, corn, sorghum, wild rice and millet, sugarcane, bamboo, onion, leek, ginger, banana and lily; Tobacco is preferred.

[0016] Through the above technical scheme, the promoter element disclosed in the present invention can improve the gene editing efficiency of plants and increase the homozygous editing efficiency to 3 times. The editing vector prepared by the sgRNA bidirectional enhanced expression sequence and the promoter element disclosed in the present invention further improves the gene editing efficiency of plants and increases the homozygous editing efficiency to 5.3 times. The editing vector containing the promoter element disclosed in the present invention and / or the sgRNA bidirectional enhanced expression sequence can significantly improve the sgRNA expression level and the acquisition of gene editing homozygous strains, providing support for the realization of plant whole genome editing and gene function analysis.

[0017] Other features and advantages of the present disclosure will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings: Figure 1 This is the expression of tobacco NtHTB gene in different tissues.

[0019] Figure 2 is a schematic diagram of the carrier involved in the present disclosure.

[0020] Figure 3 is the homozygous or biallelic editing efficiency of the vectors of the present disclosure in the plant genome.

[0021] Figure 4 Schematic diagram of the structure of the RNA encoding element disclosed herein.

[0022] Figure 5is a schematic diagram of the pDC45-PDSg5 and pDC45-64bp-PDSg5 vectors of the present disclosure.

[0023] Figure 6 is the homo and / or bi-allelic editing efficiency of the pDC45-PDSg5 and pDC45-64bp-PDSg5 vectors disclosed herein.

[0024] Figure 7 This is a comparative analysis diagram of homozygous or biallelic materials produced by editing the plant genome using 35S::Cas9, HTBp1.7::Cas9, PDC55A and PDC55B disclosed in the present invention. DETAILED DESCRIPTION

[0025] The specific implementation of the present disclosure is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described herein is only used to illustrate and explain the present disclosure, and is not used to limit the present disclosure.

[0026] In a first aspect, the present disclosure provides a promoter element, the nucleotide sequence of which is the full length of the nucleotide sequence shown in SEQ ID NO.1 or a fragment of the nucleotide sequence shown in SEQ ID NO.1; the fragment of the nucleotide sequence shown in SEQ ID NO.1 includes positions 987-1709 of the nucleotide sequence shown in SEQ ID NO.1; preferably, the fragment of the nucleotide sequence shown in SEQ ID NO.1 includes positions 653-1709 of the nucleotide sequence shown in SEQ ID NO.1.

[0027] In the present disclosure, histone H2B is a core histone. In plants, post-translational modification of histone H2B affects the growth and development of stem cells, regulates the flowering time and yield of plants, and participates in the defense and non-host resistance of plants to pathogens. We then identified the tobacco homologous gene mRNA_149991 of Arabidopsis HTB2, such as Figure 1 As shown, the inventors of the present disclosure surprisingly found that the gene also showed an ultra-high transcription level in somatic embryonic tissue during tobacco regeneration. Since the gene was highly expressed in tobacco regenerated callus and flower buds, we speculated that in view of tobacco HTB The gene promoter can efficiently drive the gene to be highly expressed in callus tissue and may be applied to genome editing, thereby obtaining the present disclosure.

[0028] A second aspect of the present disclosure provides an RNA coding element, wherein the nucleotide sequence of the RNA coding element is the nucleotide sequence shown in SEQ ID NO.2.

[0029] In the present disclosure, the inventors of the present disclosure surprisingly found that RNA coding elements can improve the homozygous or biallelic editing efficiency of editing vectors. Exogenous sgRNA sequences are prone to cause plant immune responses, thereby promoting endogenous 5'-3' exonucleases to further degrade exogenous RNA. In order to prevent RNA degradation during virus infection of plants and cause a decrease in editing efficiency, the RNA coding elements of the present disclosure were introduced, such as Figure 4 As shown, the RNA coding element is 64bp long and has 3 stable stem-loop structures. Using RNA structure prediction software, it was found that the first core stem-loop nucleic acid sequence of the sequence: the 8th to 13th sequence is TGTAGC, and the paired sequence is GTTGCA at the 24th to 29th positions; the second core stem-loop nucleic acid sequence: the 33rd to 36th sequence is GGGG, the paired sequence 46-49 is TCTC, and the loop structure between 37-45 is a nucleotide that does not form a pair; the third core stem-loop nucleic acid sequence: GCCGAC at positions 50-55; the paired sequence 59-64 is GTTGGC, and the loop sequence is CCT.

[0030] The third aspect of the present disclosure provides a sgRNA bidirectional enhanced expression sequence, wherein the sgRNA bidirectional enhanced expression sequence comprises the RNA coding element and esgRNA according to the second aspect; The sgRNA bidirectional enhanced expression sequence is the nucleotide sequence shown in SEQ ID NO.4.

[0031] In the present disclosure, the nucleotide sequence of the RNA coding element is the nucleotide sequence shown in SEQ ID NO.2. The RNA coding element and esgRNA are combined to form a bidirectional enhanced sequence, which can further improve the editing efficiency. Among them, esgRNA is a sequence obtained by adding, reducing or replacing some nucleotides on the original sgRNA; wherein, the original sgRNA is the sgRNA used in the pDC45 vector in ZL202110786304.5, and its sequence is as shown in SEQ ID NO.6, specifically: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0032] Specifically, in order to avoid the premature termination of sgRNA transcription of Pol-III type promoters such as U6 caused by the presence of four consecutive Ts in the target sequence, the present invention replaces the 5th T in the original sgRNA sequence with A, and the 26th A with T. In addition, in order to increase the stem-loop structure of the original sgRNA, the 6th to 15th positions are replaced with AGAGCTATGCTGGAAACAGC. The nucleotide sequence of the obtained esgRNA is shown in SEQ ID NO.3.

[0033] like Figure 2 As shown, the fourth aspect of the present disclosure provides a vector capable of performing efficient gene editing in plants, wherein the vector is inserted with the promoter element described in the first aspect, and preferably, is also inserted with the RNA coding element described in the second aspect.

[0034] like Figure 2 As shown, in a specific embodiment of the present disclosure, the vector further has a 2X35Sp promoter, an sgRNA insertion region, and an eu terminator inserted upstream of the promoter element described in the first aspect; the sgRNA insertion region has an sgRNA bidirectional enhanced expression sequence or esgRNA as described in the third aspect inserted therein. Preferably, the sgRNA insertion region has an sgRNA bidirectional enhanced expression sequence inserted therein.

[0035] like Figure 2 As shown, in a specific embodiment of the present disclosure, a spCas9 protein expression element, an ubp terminator and a hygromycin selection marker are further inserted downstream of the promoter element described in the first aspect in the vector.

[0036] A fifth aspect of the present disclosure provides a method for gene editing in plants, the method comprising the following steps: S1. Inserting a gRNA coding sequence targeting the gene to be edited into the sgRNA insertion region of the vector described in the fourth aspect to obtain a gene editing vector; S2, transforming Agrobacterium with the gene editing vector to obtain a transformant; S3, infecting a plant culture with the transformant to obtain an infected plant culture; S4. Cultivating the infected plant culture in a culture medium containing hygromycin to obtain a gene-edited plant.

[0037] According to the present disclosure, the nucleotide sequence of the gRNA targeting the gene to be edited is SEQ ID NO. 5. The gRNA targeting the gene to be edited is a gRNA that simultaneously targets the PDS gene in the subgenomes of forest tobacco and villous tobacco in cultivated tobacco.

[0038] According to the present disclosure, the plant is selected from tobacco, tomato, soybean, cotton, pepper, rape, eggplant, cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis, sesame, quinoa, sesbania, grape, apple, pear, kiwi, chrysanthemum, dandelion, phalaenopsis and wintergrass, and at least one of rice, wheat, corn, sorghum, wild rice and millet, sugarcane, bamboo, onion, leek, ginger, banana and lily; Tobacco is preferred.

[0039] The present invention is further described in detail below in conjunction with examples, but the scope of the present invention is not limited to the following examples.

[0040] Unless otherwise specified, the materials used in this example are all commercially available products.

[0041] Example 1 This example is used to illustrate how to obtain a promoter element.

[0042] The present disclosure utilizes molecular cloning techniques known to those skilled in the art and are performed as described in Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989.

[0043] The specific method includes the following steps: The genomic DNA of tetraploid tobacco was amplified using the forward primer sequence (5'-3'): TCGGCTTCCCCTAACTCAGA and the reverse primer sequence (5'-3'): GCCTTTGGTGCCATTTGAGG to obtain a fragment of tobacco HTB promoter (NtHTBpro) with a length of about 1.7 kb and partial coding region sequence. The above fragment was then amplified using primers (5'-3') AACACCTGCTATGACTGG and (5'-3') TTGAGGAGAGAAAAATGGAGATTTT to obtain a promoter element (HTB promoter) with a length of 1.7 kb, named NtHTBpro (SEQ ID NO.1).

[0044] Example 2 This example is used to illustrate the construction of a gene editing vector.

[0045] like Figure 2 As shown, the pDC45 vector (the sequence of the vector is the same as that in ZL202110786304.5) was used as the backbone vector, and the pDC45 vector was double-digested with SbfI and NcoI restriction endonucleases (NEB Beijing) to obtain a linearized pDC45 vector.

[0046] Design primers with adapters: TTCTACAGTTATGACCCTGCAGGAACACCTGCTATGACTGG; and CGTGGTCTTATAGTCCATGGTTGAGGAGAGAAAAATGGAGATTTT; The NtHTBpro fragment was amplified and recovered by gel digging. It was then ligated with the pDC45 linearized fragment using homologous recombination enzyme (ClonExpress II One Step Cloning Kit, Novozymes, C112-01). After transformation into Escherichia coli, the vector HTBp1.7::Cas9 vector was obtained ( Figure 2 B); Simultaneous use of primers with adapters: TTCTACAGTTATGACCCTGCAGGTACGGAGGTCAAACATGGTG; and CGTGGTCCTTATAGTCCATGGCGTCCTCTCCAAATGAAATGA; amplify the pDC45 vector to obtain the 2X35S promoter, and clone it into the pDC45 linear vector using the same method as above to obtain 35S::Cas9 ( Figure 2 A).

[0047] Example 3 This example is used to illustrate the application of the gene editing vector of the promoter element (HTB promoter) disclosed in the present invention in plants.

[0048] In order to test the editing activity of the above-constructed editing vectors (35S::Cas9, HTBp1.7::Cas9, PDC55, PDC55A, PDC55B) in plants, allotetraploid common tobacco was selected as the editing receptor, and the phytoene dehydrogenase gene (NtPDS) was selected as the target gene. The target gene gRNA is GCTGCATGGAAAGATGATGA, which can simultaneously target two PDS copies from forest tobacco and villous tobacco. Homozygous or biallelic edited tobacco plants appear pure white. In order to obtain the gRNA sequence of double-stranded PDS, 5 μL and 10 μmol / L of PDSsg forward primer TGCAGCTGCATGGAAAGATGATGA and reverse primer AAACTCATCATCTTTCCATGCAGC were taken respectively, TE buffer was added, mixed and placed in a PCR instrument, heated at 98°C for 4 minutes, and then directly taken out and cooled to room temperature to obtain double-stranded DNA of the target site with sticky ends.

[0049] 35S::Cas9 and HTBp1.7::Cas9 were digested with BsaI to obtain a linearized backbone vector, which was then ligated with the double-stranded PDS-gRNA by T4. The ligation product was transformed into DH5a, and the plasmid DNA was extracted and transformed into Agrobacterium EH105, which was stored at -80°C for later use. The pre-cultured leaf discs were placed in the Agrobacterium infection solution for infection for 5 minutes with intermittent gentle shaking. The infected tobacco leaves were subcultured in a culture medium containing hygromycin, and the number of albino buds obtained from the explants was counted after 30 days. The more albino buds there were, the higher the efficiency of homozygous or biallelic editing of the vector was.

[0050] like Figure 3 As shown in the figure, after statistical analysis, it was found that the homozygous editing efficiency of the tobacco genome driven by the 1.7kb long HTB promoter was about 3 times that of the traditional strong promoter 2X35S, indicating that the HTB promoter can significantly improve the genome editing efficiency of tetraploid tobacco.

[0051] Example 4 To test whether this RNA secondary structure can improve the editing efficiency of homozygous and biallelic genome editing in tobacco, Figure 5 As shown, a 64 bp nucleic acid sequence was introduced into the pDC45 vector (the sequence of the vector is the same as that in ZL202110786304.5) Figure 4), the specific operation is as follows: the original sgRNA is modified to esgRNA (SEQ ID NO.3), wherein the sequence of sgRNA is GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO.6), specifically, the T at position 5 in the original sgRNA sequence is replaced by A, the A at position 26 is replaced by T, and positions 6 to 15 are replaced by AGAGCTATGCTGGAAACAGC. The sequence of the 64bp RNA coding element was combined with esgRNA to form a bidirectionally enhanced sequence (i.e., the sgRNA bidirectionally enhanced expression sequence, the sequence is shown in SEQ ID NO.4), and the sgRNA bidirectionally enhanced expression sequence was amplified using the forward primer (5'-3'): TCATTTGGAGAGGACGTCGACGTGTAGCCTCCACCCG and the reverse primer (5'-3'): CTCAGCATTCTGCTTTTCTAGATGCACCAGCCGGGAATCGAA primer sequence pair. The PCR product was recovered using an agarose gel DNA recovery kit (CW2302M, Kangwei Century), and the gel-back product was connected to the SalI single-enzyme linearized pDC45 by homologous recombinase using the Novaeron Homologous Recombinase Kit (Novaeron, C112). The specific operation was performed according to the kit operation, and the connection product was transformed into Escherichia coli DH5a (Qingke Bio, TSC-C01). The plasmid with correct sequencing was named pDC45-64bp. The tobacco PDS gene target site PDSg5 was designed, the forward sequence (5'-3') was: TGCAGAGGCAAGAGATGTCCTAGG and the reverse sequence (5'-3') was: AAACCCTAGGACATCTCTTGCCTC, 5 μL of each forward and reverse primer were added to 40 μL of TE buffer, reacted at 98°C for 3 minutes and then cooled naturally, 1 μL was taken and inserted into BsaI linearized pDC45 and pDC45-64bp, respectively, to construct pDC45-PDSg5 and pDC45-64bp-PDSg5 vectors, and the corresponding vectors were transformed into Agrobacterium EH105 and then infected into cultivated tobacco. Figure 6 As shown in the figure, the percentage of albino seedlings was statistically analyzed, indicating that compared with the control, 32.3% of pure white regenerated seedlings were obtained from seedlings transformed with the pDC45-PDSg5 vector, and both copies of PDS in about 1 / 3 of the regenerated plants were knocked out, and 35.4% of the seedlings were partially knocked out. For the pDC45-64bp-PDSg5 vector, the percentage of pure white seedlings increased to 46.2%, and the total percentage of pure white and mixed white was also significantly higher than that of pDC45-PDSg5, indicating that the 64bp sequence can further enhance the knockout efficiency of the editing vector and the pure and / biallelic mutation efficiency.

[0052] In order to further verify that the sgRNA bidirectional enhanced expression sequence improves the efficiency of tobacco gene editing, the PCR product amplified above was inserted into the SalI endonuclease linearized HTBp1.7::Cas9 vector using the homologous recombination method and transformed into Escherichia coli. The editing vector with the correct positive clone sequencing was named pDC55 ( Figure 2 C). At the same time, in order to find the strongest core driving region of the HTB promoter, the truncation activity of the HTB promoter was analyzed; The following primers were used to amplify the 1KB long HTB promoter (nucleotide sequence 653-1709 shown in SEQ ID NO.1): TTCTACAGTTATGACCCTGCAGGCTAGACTGATTTCTCAAGTTTTTACCCA; and CGTGGTCCTTATAGTCCATGGTTGAGGAGAGAAAAATGGAGATTTT.

[0053] The following primers were used to amplify the 0.7 kb long HTB promoter (nucleotide sequence shown in SEQ ID NO.1, position 987-1709): TTCTACAGTTATGACCCTGCAGGACAATAGATAGCTTGGGCCGG; and CGTGGTCCTTATAGTCCATGGTTGAGGAGAGAAAAATGGAGATTTT.

[0054] The corresponding fragments were inserted into the linearized HTBp1.7::Cas9 vector by homologous recombination to obtain the pDC55A vector ( Figure 2 D, sequence as shown in SEQ ID NO.7) and pDC55B vector ( Figure 2E). The tobacco NtPDS target site GCTGCATGGAAAGATGATGA was directionally cloned into pDC55 and pDC55B vectors to obtain the corresponding editing vector containing the PDS target site, which was introduced into Agrobacterium EH105 and then introduced into tetraploid tobacco using the leaf disc method. The statistical method for homozygous or biallelic editing seedlings, i.e., white regenerated buds, was as above. The results showed that the editing efficiency of pDC55, i.e., the 1.7kb HTB promoter, could be increased to 3.8 times compared with the homozygous and biallelic efficiency of the 2X35S promoter. pDC55A and pDC55B increased the editing efficiency to 5.3 times and 4.2 times, respectively, indicating that the 1kb HTB promoter is the most core element region of HTB. The combination of this sequence and RNA secondary structure, i.e., pDC55A, has the strongest adaptability and exhibits the strongest homozygous or biallelic editing efficiency of the plant genome. Tobacco explants can produce the most white regenerated buds ( Figure 7 ).

[0055] The preferred embodiments of the present disclosure are described in detail above in conjunction with the accompanying drawings; however, the present disclosure is not limited to the specific details in the above embodiments. Within the technical concept of the present disclosure, a variety of simple modifications can be made to the technical solution of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0056] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0057] In addition, various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure.

Claims

1. A promoter element, characterized in that The nucleotide sequence of the promoter element is the full length of the nucleotide sequence shown in SEQ ID NO.1 or a fragment of the nucleotide sequence shown in SEQ ID NO.1; the fragment of the nucleotide sequence shown in SEQ ID NO.1 includes positions 987-1709 of the nucleotide sequence shown in SEQ ID NO.1; preferably, the fragment of the nucleotide sequence shown in SEQ ID NO.1 includes positions 653-1709 of the nucleotide sequence shown in SEQ ID NO.

1.

2. An RNA coding element, characterized in that The nucleotide sequence of the RNA coding element is the nucleotide sequence shown in SEQ ID NO.

2.

3. A sgRNA bidirectional enhanced expression sequence, characterized in that: The sgRNA bidirectional enhanced expression sequence comprises the RNA coding element and esgRNA according to claim 2; The sgRNA bidirectional enhanced expression sequence is the nucleotide sequence shown in SEQ ID NO.

4.

4. The sgRNA bidirectional enhanced expression sequence according to claim 3, wherein The esgRNA is a sequence obtained by adding, reducing or replacing some nucleotides on the original sgRNA; The nucleotide sequence of the esgRNA is shown in SEQ ID NO.

3.

5. A vector capable of efficient gene editing in plants, characterized in that: The vector is inserted with the promoter element of claim 1, and preferably, is also inserted with the RNA encoding element of claim 2.

6. The carrier according to claim 5, wherein In the vector, a 2X35Sp promoter, an sgRNA insertion region, and an eu terminator are also inserted upstream of the promoter element of claim 1; The sgRNA insertion region is inserted with the sgRNA bidirectional enhanced expression sequence or esgRNA according to any one of claims 3-4.

7. The carrier according to claim 5, wherein In the vector, a spCas9 protein expression element, a ubp terminator and a hygromycin selection marker are also inserted downstream of the promoter element described in claim 1.

8. A method for gene editing of plants, characterized in that: The method comprises the following steps: S1. Inserting a gRNA coding sequence targeting the gene to be edited into the sgRNA insertion region of the vector according to any one of claims 5 to 7 to obtain a gene editing vector; S2, transforming Agrobacterium with the gene editing vector to obtain a transformant; S3, infecting a plant culture with the transformant to obtain an infected plant culture; S4. Cultivating the infected plant culture in a culture medium containing hygromycin to obtain a gene-edited plant.

9. The method according to claim 8, wherein: The nucleotide sequence of the gRNA targeting the gene to be edited is SEQID NO.

5.

10. The method according to claim 8, wherein: The plant is selected from tobacco, tomato, soybean, cotton, pepper, rape, eggplant, cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis, sesame, quinoa, sesbania, grape, apple, pear, kiwi, chrysanthemum, dandelion, phalaenopsis and wintergrass, and at least one of rice, wheat, corn, sorghum, wild rice and millet, sugarcane, bamboo, onion, leek, ginger, banana and lily; Tobacco is preferred.

Images