Antisense oligonucleotide for resisting new coronavirus SARS-CoV-2s2m and application of antisense oligonucleotide

Abstract

The invention discloses an antisense oligonucleotide for resisting a new coronavirus SARS-CoV-2s2m and a preparation method of the antisense oligonucleotide. The antisense oligonucleotide is designed according to an s2m element of the SARS-CoV-2 virus and is optimized according to a secondary structure prediction result of the antisense oligonucleotide, and finally three candidate antisense oligonucleotide sequences capable of inhibiting virus activity are obtained. Cell transfection and virus infection experiments prove that the antisense oligonucleotide prepared by the invention can significantly reduce the virus titer in cells, can effectively inhibit the activity of viruses, and has an application prospect in development of novel anti-coronavirus drugs.

Description

Technical Field

[0001] The present invention relates to an antisense oligonucleotide, in particular to an anti-new coronavirus SARS-CoV-2 S2M and an application thereof. Background Art

[0002] The process of SARS-CoV-2 virus replication has been studied in detail, and many RNA elements of the genome have been discovered, but the biological significance of all these components has not yet been fully elucidated. A conserved stem-loop structure was found in the SARS-CoV-2 genome, named the stem-loop II (S2M) element, which was originally discovered in astroviruses. The S2M element is located in the 3'-UTR region of the SARS-CoV-2 genome and is 41 bp in length. The sequence of the S2M element differs by only two bases between SARS-CoV and SARS-CoV-2. It has been found in at least four different virus families, including several lineages of coronaviruses. Although the exact function of S2M has not yet been revealed, several hypotheses have been proposed, including interference with the translation machinery of infected cells, involvement in gene regulation through RNA silencing, and protection of the viral genome / transcriptome from ribonuclease degradation. Due to the high conservation of S2M, it has also been suggested as a potential drug target.

[0003] To perfect the methods needed to treat COVID-19 cases, antisense (ASO) therapy has emerged as a promising strategy. ASO binds to its target RNA inside the cell, which in turn activates RNase H to degrade its target RNA, preventing the translation process. Or it binds to the stop codon formed by mutation and repairs the open reading frame, thereby producing a functional protein. Small nucleic acid drugs treat at the post-transcriptional level and can achieve breakthroughs for special protein targets that are difficult to drug. Indications cover cardiovascular, metabolic, neurological, respiratory, ophthalmic, cancer, infectious diseases and other fields. Antisense therapy offers the potential for personalized and easy treatment. A major advantage of this therapy is its simplicity and accuracy, as it is based on complementary target mRNA sequences. This will make it easy to synthesize all known viral or bacterial mRNA sequences involved in pathogenesis. In addition, the production time and cost-effectiveness of antisense oligonucleotides are relatively conducive to large-scale production, while their chemical modification and delivery increase efficacy, reducing the need for frequent dosing. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide an antisense oligonucleotide against the new coronavirus SARS-CoV-2s2m.

[0005] Another object of the present invention is to provide applications of the antisense oligonucleotide.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] An antisense oligonucleotide against SARS-CoV-2 s2m, which is at least one of the following:

[0008] ASO-1, whose nucleotide sequence is ACCCTCGATCGTACTCCGCG;

[0009] ASO-2, whose nucleotide sequence is CTCCGCGTGGCCTCGGTGAA;

[0010] ASO-3, whose nucleotide sequence is TTCACTGTACCCTCGATCGT.

[0011] Or analogs of ASO-1, ASO-2, and ASO-3 obtained by base insertion, deletion, or substitution that still have the function of targeting the SARS-CoV-2 s2m element sequence.

[0012] The antisense oligonucleotide can target the s2m element of the SARS-CoV-2 virus, thereby inhibiting the replication of the SARS-CoV-2 virus.

[0013] The use of the antisense oligonucleotide in inhibiting the expression of SARS-CoV-2 virus.

[0014] The use of the antisense oligonucleotide in the preparation of SARS-CoV-2 virus inhibitors.

[0015] The target of the above-mentioned inhibitor is the s2m element.

[0016] The use of the antisense oligonucleotide in the preparation of a drug for treating infection caused by the SARS-CoV-2 virus.

[0017] A drug for treating infection caused by SARS-CoV-2 virus, comprising the above-mentioned antisense oligonucleotide.

[0018] The medicine also includes pharmaceutically acceptable excipients.

[0019] The above-mentioned SARS-CoV-2 virus is the original strain of SARS-CoV-2.

[0020] Compared with the prior art, the present invention has the following advantages and effects:

[0021] The present invention provides an antisense oligonucleotide against the new coronavirus SARS-CoV-2 S2M, which is designed according to the S2M element of SARS-CoV-2 and optimized according to its secondary structure prediction results, and finally three antisense oligonucleotides with the activity of inhibiting viral expression are obtained. Cell transfection and virus infection experiments have proved that the antisense oligonucleotide prepared by the present invention can significantly reduce the virus titer in cells, can effectively inhibit the expression of viruses, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is the secondary structure diagram of s2m in SARS-CoV (A) and SARS-CoV-2 (B);

[0023] Figure 2 It is the secondary structure prediction map of s2m by RNA structure v6.3;

[0024] Figure 3 The s2m-ASOs sequences were designed by RNA structure v6.3;

[0025] Figure 4 This is a graph showing the inhibitory effect of ASO-2 on the viral load of SARS-CoV-2 in Example 2. DETAILED DESCRIPTION

[0026] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0027] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0028] Cells and reagents:

[0029] HEK293T-ACE2 cells and the original strain of SARS-CoV-2 were kindly donated by Li Chang, Institute of Military Veterinary, Academy of Military Medical Sciences, Academy of Military Sciences. The experiments related to real viruses were completed at the Institute of Military Veterinary, Academy of Military Medical Sciences, Academy of Military Sciences.

[0030] DMEM medium, fetal bovine serum, and Opiti-MEM medium were purchased from GIBCO (USA); Purchased from Mirus Bio (USA); viral RNA extraction kit purchased from TIANGEN (Germany); 2xSYBR Green qPCR Master Mix purchased from Nanjing Novozymes Biotech Co., Ltd. (China).

[0031] Example 1

[0032] 1.1 Prediction of secondary structure of s2m

[0033] Designing effective antisense oligonucleotides requires accurate mimicking of the secondary structure of the target sequence. The sequence of the s2m element differs by only two bases between SARS-CoV and SARS-CoV-2, but its secondary structure is significantly different ( Figure 1 ), in order to accurately simulate the structure of the corresponding sequence, this example selects the complete sequence of s2m, which is located in the 3' untranslated region of the SARS-CoV-2 genome. The sequence consists of 41 nucleotides, specifically: TTCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGTGAA. The secondary structure of the given sequence was predicted using RNA structure v6.3, and the prediction results are as follows Figure 2 shown.

[0034] 1.2 Design of ASOs

[0035] RNA structure v6.3 can be used to predict the secondary structure of the sequence and design ASOs. The software is based on the minimum Gibbs free energy principle, that is, when the predicted ASO sequence binds to the target sequence, the more stable it is, the lower the free energy of the system will be in the thermodynamic equilibrium state. Therefore, by arranging the predicted sequences in ascending order according to the size of the total Gibbs free energy, the top three ASO sequences are selected and regarded as potential candidate sequences, as follows:

[0036] ASO-1: 5′-ACCCTCGATCGTACTCCGCG-3′, total free energy = -21.6 kJ / mol;

[0037] ASO-2: 5′-CTCCGCGTGGCCTCGGTGAA-3′, total free energy = -21.5 kJ / mol;

[0038] ASO-3: 5'-TTCACTGTACCCTCGATCGT-3', total free energy = -17.6 kJ / mol.

[0039] Example 2

[0040] 2.1 Synthesis of ASOs sequences

[0041] According to the method of Example 1, three ASO sequences with potential targeting s2m domain were screened and a random sequence SCR was designed for comparison and commissioned to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The sequences are shown in Table 1.

[0042] Table 1s2m-ASOs sequences

[0043]

[0044] 2.2 Cell transfection

[0045] HEK293T-ACE2 cells in the logarithmic growth phase were prepared into 5×10 5 The cell suspension of 10 cells was then evenly spread on a 12-well plate. The culture plate was placed in an incubator at 37°C and 5% CO2, and the transfection process was started when the cells proliferated to a density of about 70% to 80%.

[0046] HEK293T-ACE2 cells were divided into groups, one group was ASOs (ASO-1, ASO-2 and ASO-3), and the other group was SCR, SCR was a random sequence. The final concentration of ASO and SCR groups was 0.5 μM. The steps for transfection are detailed as follows:

[0047] (1) Completely discard the original culture medium in the 12-well plate. Take 800 μL of DMEM culture medium without serum and double antibody to starve the cells;

[0048] (2) Preparation Mixed liquid;

[0049] (3) Before operation, ensure that the transfection reagent In a uniform state, take 3 μL of the reagent and add 100 μL of serum-free optimized medium (Opti-MEM), shake gently to mix thoroughly. Then, incubate the mixture at room temperature for 5 minutes;

[0050] (4) Take out 5 μL of ASO solution (concentration of 100 μM) and dilute it with 100 μL of serum-free optimized culture medium (Opti-MEM). During the operation, the solution needs to be gently mixed to ensure that the final ASO concentration reaches 0.5 μM. After incubation for 5 minutes, the transfection reagent dilution solution is gently mixed with the ASO solution and incubated at room temperature for another 20 minutes. Then slowly add the above-prepared mixture dropwise to the starved cells and shake gently to ensure sufficient mixing;

[0051] (5) After culturing the cells at 37°C for 4 to 6 hours, the medium containing the transfection reagent was removed from the wells and replaced with DMEM medium containing 2% fetal bovine serum, and the cells were cultured under this condition for another 36 hours.

[0052] 2.3 SARS-CoV-2 infection of cells

[0053] The original strain of SARS-CoV-2 was used to infect the cells transfected with ASO in 2.2. The virus solution was mixed with 2% FBSDMEM medium at an MOI of 0.01 to replace the medium in the cells of the 12-well plate, and the cells were incubated at 37°C for 12 h.

[0054] 2.4 qPCR detection of viral load

[0055] After virus infection and incubation for 12 h in 2.3, 100 μL of cell supernatant was collected and then viral RNA was extracted. The specific steps are as follows:

[0056] (1) Prepare 560 μL of lysis buffer containing carrier RNA per sample and use it immediately;

[0057] (2) Take 100 μL of the infected cell supernatant, add it to the lysis solution, vortex to mix, and then let it stand at room temperature for 10 minutes; then add 560 μL of anhydrous ethanol and mix again.

[0058] (3) The lysate was centrifuged twice (at 8000 rpm for 1 min) to remove the added anhydrous ethanol, and the filtrate was discarded.

[0059] (4) Take 500 μL of the prepared GD buffer, filter it once through a filter column, centrifuge it at 8000 rpm for 1 minute, and discard the filtrate.

[0060] (5) Take 500 μL of the prepared PW buffer, filter it twice through a filter column, centrifuge it at 8000 rpm for 1 minute, and discard the filtrate.

[0061] (6) Centrifuge the filter column at a speed of 12,000 rpm for 3 minutes. Then, add 50 μL of deionized water without RNase to the center of the filter column. Centrifuge again at a speed of 12,000 rpm for 2 minutes. The filtrate collected is the extract of the target viral RNA.

[0062] The SARS-CoV-2 N gene fluorescence quantitative PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequences are shown in Table 2, and the standard product was the pEASY Blunt plasmid containing the N gene.

[0063] Table 2 SARS-CoV-2N fluorescence quantitative detection sequence

[0064]

[0065] The SARS-CoV-2N gene in the extracted viral RNA was absolutely quantitatively analyzed using the Novagen qRT-PCR kit, and the reaction system used is shown in Table 3.

[0066] Table 3 qRT-PCR reaction system

[0067]

[0068] After the prepared reaction system was quickly centrifuged, the detection was performed using a BioRad CFX96 real-time fluorescence quantitative PCR instrument (Table 4).

[0069] Table 4 qPCR program

[0070]

[0071] 2.5 Data processing and analysis

[0072] Data are presented as mean ± SD of at least three biological replicates, and data analysis was performed using GraphPad Prism 8.0 software (Systat Software, Inc., San Jose, CA, USA). The Student's unpaired two-sample t test was used to analyze the significant differences between the data of different groups, and p values ​​< 0.05 were considered statistically significant.

[0073] 2.6 Results and Discussion

[0074] In order to test whether the ASOs we designed have an inhibitory effect on the SARS-CoV-2 virus, an evaluation was conducted. SCR, ASO-1, ASO-2, and ASO-3 were transfected at a final concentration of 0.5 μM, respectively, and the experimental subjects were HEK293T-ACE2 cells. 36 hours after transfection, 0.01 MOI of SARS-CoV-2 was used for infection. At 12 hours after infection, the viral load in the cell supernatant was detected. Experimental data showed that ASO-2 can significantly reduce the viral load within 12 hours after virus invasion ( Figure 4 ).

[0075] The present invention designs ASOs sequences (ASO-1, ASO-2 and ASO-3) targeting the s2m element of the new coronavirus SARS-CoV-2. Through real virus experimental verification, it is proved that the designed sequence has a significant inhibitory effect, among which ASO-2 has the greatest impact on the viral load, which can provide an experimental basis for the research and development of new anti-coronavirus drugs.

[0076] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An antisense oligonucleotide against the new coronavirus SARS-CoV-2s2m, characterized in that At least one of the following: ASO-1, whose nucleotide sequence is ACCCTCGATCGTACTCCGCG; ASO-2, whose nucleotide sequence is CTCCGCGTGGCCTCGGTGAA; ASO-3, whose nucleotide sequence is TTCACTGTACCCTCGATCGT; Or analogs of ASO-1, ASO-2, and ASO-3 obtained by base insertion, deletion, or substitution that still have the function of targeting the SARS-CoV-2s2m element sequence.

2. Use of the antisense oligonucleotide described in claim 1 in inhibiting SARS-CoV-2 virus expression.

3. Use of the antisense oligonucleotide according to claim 1 in the preparation of SARS-CoV-2 virus inhibitors.

4. The use of the antisense oligonucleotide according to claim 3 in the preparation of a SARS-CoV-2 virus inhibitor, characterized in that: The inhibitor targets the s2m element.

5. Use of the antisense oligonucleotide according to claim 1 in the preparation of a drug for treating infections caused by SARS-CoV-2 virus.

6. A drug for treating infection caused by SARS-CoV-2 virus, characterized in that: The invention comprises the antisense oligonucleotide according to claim 1.

7. The drug according to claim 6, characterized in that: The medicine also includes pharmaceutically acceptable excipients.

Images