LncRNA applied to antagonism of replicative aging of human mesenchymal stem cells and application of LncRNA

Abstract

The invention relates to the technical field of biological medicine, in particular to LncRNA applied to antagonism of replicative aging of human mesenchymal stem cells and application of the LncRNA. The LncRNA is ENST00000585537.1, and the LncRNA is located in a human chromosome Chr17q24, and the LncRNA is located in a human chromosome. Compared with the prior art, the LncRNA has the following advantages: the LncRNA disclosed by the invention has extremely high species conservative property and is only expressed in certain tissues and organs of human beings, and the expression quantity is gradually increased along with aging. After the LncRNA is knocked down, chronic inflammation secretion of the senescence mesenchymal stem cells can be remarkably reduced in vitro, the apoptosis state and differentiation capacity of the senescence mesenchymal stem cells are improved, it is prompted that the LncRNA possibly plays an important role in delaying senescence of the human mesenchymal stem cells, and the LncRNA has the high application potential and is worthy of popularization and application. A relatively high reference value is provided for an anti-aging individual in-vivo experiment.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to LncRNA for antagonizing replicative aging of human mesenchymal stem cells and applications thereof. Background Art

[0002] Stem cells refer to a type of cell that is not fully differentiated, has a high degree of self-renewal, and can regenerate various tissues and organs. Therefore, they have broad prospects for development in the research and application of tissue engineering and regenerative medicine. For mammals, stem cells can be divided into embryonic stem cells and adult stem cells. Embryonic stem cells are obtained from the inner cell mass of the blastocyst, while adult stem cells come from a variety of tissues. With the advancement of science and technology, the research on stem cells has become more and more popular, and they have an extremely important position in the field of biology.

[0003] Mesenchymal stem cells (MSCs) are an important type of adult stem cells that exist in the interstitium of various tissues and organs, especially bone marrow and subcutaneous fat. They have multidirectional differentiation potential and can differentiate into osteoblasts, adipocytes, chondrocytes, neurons, etc. In the research and application of tissue engineering and regenerative medicine, MSCs have become an important type of seed cells due to their wide sources, low immunogenicity, diverse differentiation potential, and no ethical controversy. When cultured in vitro, MSCs are a "fibroblast-like" stem cell that grows on the wall and expresses a variety of cell surface markers. However, like other normal somatic cells, MSCs have a limited number of generations of in vitro expansion. After a certain number of mitosis, they enter a state of replicative senescence, with specific characteristics such as: enlarged volume, reduced cell viability, reduced proliferation and differentiation ability, and disordered immune regulation ability, which brings difficulties to the scientific research of MSCs, tissue engineering, and regenerative medicine applications. Therefore, it is crucial to explore how to improve the replicative senescence of mesenchymal stem cells in vitro.

[0004] Long non-coding RNAs (LncRNAs) refer to non-coding RNAs in the transcriptome that are longer than 200nt and most of which have secondary structures. In the genome of mammals, 4% to 9% of the transcripts produced by the sequences are LncRNAs. The above characteristics enable LncRNAs to target chromatin, mRNA, proteins, etc. in a variety of mechanisms to regulate delicate biological processes, such as cell lineage differentiation, immune regulation, cancer occurrence and development, etc. Interestingly, most LncRNAs have low species conservation, low expression abundance, and highly specific spatiotemporal expression patterns. This means that the discovery of LncRNAs with regulatory functions for delaying aging and improving aging phenotypes and the elucidation of their regulatory mechanisms will not only have great potential to become potential targets for human-specific anti-aging, but also be expected to achieve clinical transformation through non-coding RNA therapy for delaying aging-related treatments. However, due to the poor conservation of LncRNAs among species, most of the LncRNAs discovered in recent years that are related to delaying aging and improving aging phenotypes are based on mice or cell lines, which significantly reduces the guiding value of these studies for human anti-aging research. Therefore, it is urgent to discover LncRNAs associated with the anti-aging of human MSCs and conduct in-depth studies on their functions and mechanisms. Summary of the invention

[0005] In order to solve the above technical problems existing in the prior art, the present invention provides a LncRNA for antagonizing the replicative senescence of human mesenchymal stem cells and its application. Specifically, it is achieved through the following technical solutions:

[0006] A lncRNA for antagonizing replicative senescence of human mesenchymal stem cells, wherein the lncRNA for antagonizing replicative senescence of human mesenchymal stem cells is ENST00000585537.1 according to the UCSC genome browser, is highly conserved only in humans, and is located at human chromosome Chr17q24, as shown in the attached Figure 1 shown.

[0007] Use of the substance for knocking down the LncRNA used to antagonize the replicative aging of human mesenchymal stem cells in the preparation of a product for inhibiting cell apoptosis.

[0008] Use of the substance for knocking down the LncRNA used to antagonize the replicative aging of human mesenchymal stem cells in the preparation of a product for inhibiting the secretory phenotype of cell aging.

[0009] Use of the substance for knocking down the LncRNA used to antagonize the replicative aging of human mesenchymal stem cells in the preparation of a product for improving the osteogenic differentiation ability of aged mesenchymal stem cells.

[0010] Use of the substance overexpressing the LncRNA for antagonizing the replicative senescence of human mesenchymal stem cells in the preparation of a product for promoting cell apoptosis.

[0011] Use of the substance overexpressing the LncRNA for antagonizing the replicative senescence of human mesenchymal stem cells in the preparation of a product for promoting the secretory phenotype of cell senescence.

[0012] Use of a substance that overexpresses the LncRNA used to antagonize the replicative aging of human mesenchymal stem cells in the preparation of a product for weakening the osteogenic differentiation ability of aged mesenchymal stem cells.

[0013] Furthermore, the inhibition of cell apoptosis refers to the inhibition of apoptosis of aged human mesenchymal stem cells.

[0014] A drug for reducing chronic inflammatory secretion of aged mesenchymal stem cells and improving the apoptotic state and differentiation ability of aged cells, characterized in that it contains a substance for knocking down the LncRNA described in claim 1 for antagonizing the replicative senescence of human mesenchymal stem cells.

[0015] Furthermore, the inhibition of cell apoptosis refers to the inhibition of apoptosis of aged human mesenchymal stem cells.

[0016] Compared with the prior art, the technical effects created by the present invention are embodied in:

[0017] The present invention discloses a LncRNA for antagonizing the replicative aging of human mesenchymal stem cells, wherein the LncRNA is ENST00000585537.1, and is located at human chromosome Chr17q24. Compared with the prior art, the LncRNA has the following advantages: the LncRNA described in the present application has extremely high species conservation, is only expressed in certain human tissues and organs, and the expression amount gradually increases with aging. After knocking down the LncRNA, the chronic inflammatory secretion of aging mesenchymal stem cells can be significantly reduced in vitro, and the apoptotic state and differentiation ability of aging mesenchymal stem cells can be improved, indicating that it may play an important role in delaying the aging of human mesenchymal stem cells, has a high application potential, and provides a high reference value for anti-aging individual in vivo experiments.

[0018] This LncRNA plays an important role in improving the aging secretory phenotype, differentiation and apoptosis of human adipose-derived mesenchymal stem cells, and is expected to become an effective target for clinically delaying and improving the quality of life of aging. It can achieve clinical translational application through non-coding RNA therapy, overcoming the deficiencies and defects mentioned in the background technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1This is the location of LncRNA ENST00000585537.1 in the human genome and species conservation analysis.

[0020] Figure 2 This is a model for the in vitro replicative aging of human adipose-derived mesenchymal stem cells in Example 1 of the present invention.

[0021] Figure 3 This is the increasing expression trend of LncRNA ENST00000585537.1 in Example 2 of the present invention during the replicative aging of human adipose-derived mesenchymal stem cells in vitro.

[0022] Figure 4 After knocking down LncRNA ENST00000585537.1 using siRNA in Example 3 of the present invention, the generation of the secretory phenotype of replicative senescence of human adipose-derived mesenchymal stem cells was inhibited.

[0023] Figure 5 In Example 4 of the present invention, after LncRNA ENST00000585537.1 was overexpressed using lentivirus, the generation of the senescent secretory phenotype of replicative senescence of human adipose-derived mesenchymal stem cells was promoted.

[0024] Figure 6 In Example 5 of the present invention, after knocking down LncRNA ENST00000585537.1 using shRNA, the apoptosis of replicative senescence of human adipose-derived mesenchymal stem cells was inhibited.

[0025] Figure 7 In Example 6 of the present invention, after LncRNA ENST00000585537.1 was overexpressed using lentivirus, apoptosis of replicative senescence of human adipose-derived mesenchymal stem cells was promoted.

[0026] Figure 8 In Example 7 of the present invention, after knocking down LncRNA ENST00000585537.1 using shRNA, the osteogenic differentiation ability of replicatively aged human adipose-derived mesenchymal stem cells was improved. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further defined below in conjunction with specific implementation methods, but the scope of protection required is not limited to the description.

[0028] Example 1

[0029] Culture and induction of human adipose-derived mesenchymal stem cells:

[0030] Primary human adipose-derived mesenchymal stem cells (the above cells were isolated from adipose tissue of liposuction surgery. Liposuction fat is medical waste under normal circumstances. They were obtained from the Department of Plastic Surgery, Chinese Academy of Medical Sciences. Because the sampling method does not cause additional damage to the patient and does not disclose the patient's privacy, the patient's informed consent was obtained, and the application was submitted to the Ethics Review Committee of the Institute of Basic Medicine, Chinese Academy of Medical Sciences and approved) were cultured in a 37°C, 5% CO2 incubator using complete medium (DMEM / F12+2% fetal bovine serum+penicillin 100IU / mL+streptomycin 100μg / mL). The medium was replaced every 2 days and the cells were passaged when the growth density reached 80%-90%. Human adipose-derived mesenchymal stem cells (hAMSCs) of the third passage (passage3, P3) and human adipose-derived mesenchymal stem cells of the 14th passage (passage14, P14) were taken for aging modeling verification, and viral knockdown or overexpression treatment was performed for various experiments.

[0031] The experimental results are as follows Figure 2 As shown, Figure 2 A is the SA-β-gal staining results of the 3rd and 14th generation hAMSCs. The SA-β-gal staining positive rate of cells in the P14 group was significantly higher than that in the P3 group. Figure 2 B is the expression results of senescence-related marker genes in the 3rd and 14th generations of hAMSCs. Western blot images show the protein expression of GAPDH (as an internal reference), P16, P21, and Lamb1. The expression levels of P14 group cells were significantly different from those of P3 group cells in mRNA and protein. The results showed that the proportion of SA-β-gal positive cells and the expression levels of p16, p21, and Lamb1 genes in P14 group cells were significantly higher than those in P4 group cells. Therefore, P14 group cells have obvious senescence phenotypes and can be used as senescence control group for subsequent experiments. (Scale bar is 100μm.)

[0032] Example 2

[0033] LncRNA ENST00000585537.1 expression trend analysis:

[0034] When the cell growth density reached about 90%, normal subculture was performed, and the third and fourteenth generation hAMSCs of normal culture were collected, and RNA was extracted according to conventional procedures for qRT-PCR experiments.

[0035] The experimental results are as follows Figure 3 As shown, Figure 3The expression trend of LncRNA ENST00000585537.1 mRNA during the replicative aging of hAMSCs. Figure 3 It can be seen that the expression level of LncRNA ENST00000585537.1 increased significantly during the replicative aging of hAMSCs.

[0036] Example 3

[0037] After knocking down LncRNA ENST00000585537.1, the expression of the senescent secretory phenotype of replicative senescent hAMSCs was inhibited:

[0038] The third generation of normal culture was used for meaningless control sequence knockdown (Young MSCs, Y-siRNA-NC), and the fourteenth generation hAMSCs (Replicative senescence MSCs, RS-) were taken, and two pairs of small interfering RNA (siRNA) were used to effectively knock down LncRNA ENST00000585537.1. SiRNAs were purchased from Suzhou Jima Biological Company, and siRNAs were transfected using the liposome transfection method commonly used in the laboratory. hAMSCs were collected 24 hours after transfection, and RNA was extracted according to conventional procedures for qRT-PCR experiments to detect the knockdown efficiency. When the cell growth density reached about 90%, RNA was extracted according to conventional procedures and the cell supernatant was collected for qRT-PCR experiments and Elisa experiments to detect the expression of aging-related secretory phenotypes IL-1β, IL-6, MCP1, and TNF-α. All experiments showed that after knocking down LncRNA ENST00000585537.1, the expression of the aging secretory phenotype of replicative senescence hAMSCs was inhibited.

[0039] The specific sequences of the two pairs of small interfering RNA (siRNA) are as follows:

[0040] si-MEK6-AS1-1

[0041] F:GCUGUGACCAAUGAACAAUTT

[0042] R:AUUGUUCAUUGGUCACAGCTT

[0043] si-MEK6-AS1-2

[0044] F:GUGGUUCCCAUCUCAAGAATT

[0045] R:UUCUUGAGAUGGGAACCACTT

[0046] The experimental results are as follows Figure 4 shown. Figure 6 A is the knockdown efficiency of siRNA on LncRNA ENST00000585537.1; Figure 4 B and C are the relative expressions of aging-related secretory phenotype markers in the aging control group, aging knockdown experimental group and young control group detected by qRT-PCR and WB. Figure 4 It can be seen that compared with the aging control group, after knocking down LncRNA, the mRNA and protein levels of cell aging-related secretory phenotype markers decreased. (Note: RS-siRNA-NC is a meaningless control sequence, RS-siRNA-1 and RS-siRNA-2 are specific sequences designed for ENST00000585537.1.)

[0047] Example 4

[0048] Overexpression of LncRNA ENST00000585537.1 promoted the expression of the senescent secretory phenotype of replicative senescent hAMSCs:

[0049] The third generation of normal culture (Young MSCs, Y-Lenti-NC) was taken for overexpression of meaningless control sequences, and the fourteenth generation hAMSCs (Replicative senescence MSCs, RS-) were taken, and LncRNAENST00000585537.1 was effectively overexpressed using a lentiviral vector. The overexpression plasmid and lentiviral vector were purchased from Suzhou Jima Biological Company and infected using the lentiviral infection method commonly used in the laboratory. Puromycin screening was performed 48 hours after infection, and hAMSCs were collected after screening. RNA was extracted according to conventional steps for qRT-PCR experiments to detect the overexpression efficiency. The experiment was carried out when the cell growth density reached about 90%, and the subsequent experimental treatment was exactly the same as Example 3. All experiments showed that after overexpression of LncRNAENST00000585537.1, the expression of the aging secretory phenotype of replicative aging hAMSCs was promoted.

[0050] The experimental results are as follows Figure 5 shown. Figure 5 A is the overexpression efficiency detection of LncRNA ENST00000585537.1; Figure 5 B and C are the relative expressions of aging-related secretory phenotype markers in the aging control group, aging overexpression experimental group and young control group detected by qRT-PCR and WB. Figure 5It can be seen that compared with the aging control group, after overexpression of LncRNA, the RNA and protein levels of cell aging secretion phenotype markers increased. (Note: RS-Lenti-NC is a meaningless control sequence, and RS-Lenti-LncRNA is an overexpression specific sequence designed for ENST00000585537.1.)

[0051] Example 5

[0052] Knockdown of LncRNA ENST00000585537.1 significantly inhibited the apoptosis of replicative senescent hAMSCs:

[0053] The third generation of normal culture was used for knockdown of meaningless control sequence, and the fourteenth generation hAMSCs were used to effectively knockdown LncRNA ENST00000585537.1 using lentiviral vector. The knockdown plasmid and lentiviral vector were purchased from Suzhou Jima Biotechnology Co., Ltd., and the infection was carried out using the commonly used lentiviral infection method in the laboratory. The infection process was exactly the same as in Example 3. When the cell growth density reached about 90%, the experimental operation was carried out, the cell protein was collected, and the apoptosis experiment was performed by flow cytometry.

[0054] The cells were cultured at 1×10 5 The cells were inoculated in a 6-well plate at a density of 100 cells / well. After the cells adhered well, the old culture medium was discarded and replaced with new drug-containing / drug-free culture medium. After 72 hours, the detection was performed according to the steps provided in the instructions of the Annexin V-FITC / PI cell apoptosis detection kit. The principle is as follows: In normal living cells, phosphatidylserine (PS) is located on the inner side of the cell membrane, but in early apoptotic cells, PS flips from the inner side of the cell membrane to the surface of the cell membrane and is bound by Annexin-V with high affinity; propidium iodide (PI) is a nucleic acid dye that cannot penetrate the intact cell membrane of normal cells or early apoptotic cells, but can penetrate the cell membrane of late apoptotic and necrotic cells to stain the cell nucleus red, which is used to distinguish between surviving early cells and necrotic or late apoptotic cells. Therefore, when Annexin V is used in combination with PI and detected by flow cytometry, the majority of the late apoptotic cell populations exhibiting replicative senescence are located on the right side of the coordinate axis.

[0055] The experimental results are as follows Figure 6 shown. Figure 6 A is the experimental result of apoptotic cell flow cytometry detection; Figure 6 B is the detection of apoptosis-related markers of replicative senescent hAMSCs. Figure 6 It can be seen that compared with the control group, knockdown of LncRNA significantly inhibited the apoptosis of replicative senescent hAMSCs.

[0056] Example 6

[0057] Overexpression of LncRNA ENST00000585537.1 significantly promotes apoptosis of replicative senescent hAMSCs: The process of lentiviral infection to overexpress LncRNA ENST00000585537.1 is exactly the same as in Example 4. When the cell growth density reaches about 90%, the experimental operation is performed, the cell protein is collected, and the apoptosis experiment is performed by flow cytometry. The subsequent experimental treatment is exactly the same as in Example 5.

[0058] The experimental results are as follows Figure 7 shown. Figure 7 A is the experimental result of apoptotic cell flow cytometry detection; Figure 7 B is WB detection of apoptosis-related markers of replicative senescence hAMSCs. Figure 7 It can be seen that compared with the control group, overexpression of LncRNAENST00000585537.1 significantly promoted the apoptosis of replicative senescent hAMSCs.

[0059] Example 7

[0060] LncRNA ENST00000585537.1 significantly improves the osteogenic differentiation ability of replicatively aged hAMSCs: the third generation of normal culture was used for knockdown of meaningless control sequence, and the fourteenth generation hAMSCs were taken and LncRNAENST00000585537.1 was effectively knocked down using a lentiviral vector. The knockdown plasmid and lentiviral vector were purchased from Suzhou Jima Biological Company and infected using the commonly used lentiviral infection method in the laboratory. The infection process was exactly the same as in Example 4. When the cell growth density reached about 90%, the experimental operation was carried out, and osteogenic differentiation induction medium (DMEM + 10% fetal bovine serum + penicillin 100IU / mL + streptomycin 100μg / mL + dexamethasone 10-8M + sodium β-glycerate 10-3M + ascorbic acid 10-4M) was used for induction and used in various experiments. The experimental results are as follows Figure 8 shown. Figure 8 A is the ALP staining of cells in each group on the 6th day. After knockdown, the number of ALP-positive staining cells in replicative senescent hAMSCs increased significantly; Figure 8 B is the detection of mRNA expression of key osteogenesis-related genes RUNX2, ALP, COL1A1 and OPN. (Scale bar is 100 μm.) Figure 8 It can be seen that knockdown of LncRNAENST00000585537.1 can promote the osteogenic differentiation ability of replicatively aged hAMSCs.

[0061] Finally, it should be pointed out that the above embodiments are only representative examples of the present invention. Obviously, the technical solution of the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. A LncRNA for antagonizing replicative senescence of human mesenchymal stem cells, characterized in that: The LncRNA used to antagonize the replicative senescence of human mesenchymal stem cells is ENST00000585537.1, and its nucleotide sequence is 584 nt in length, as follows: GTTTGACCACGCGTATCGATGTCGACTTGTAGATTTCTGCAGATCGCAACAAGCCTCGACTGCTTATTGGCACAGTCTGCAAAGGGCCTCCTCCGTTCCAAAGTTGCTCATCCTAAAACCTGAAAAAAAAAATGACTCAGAAGTGGTTCCCATCTCAA GAACTACCCACGAGTCTCAGTGGACACATGTGAGTATGAGATTCCCCGATGCAGCCTTCCAATCCAGCAGAGGTTCCAACCAACTTCCAAACAGGTGCAACTTGATGGCACCTCATTTTTGGCTGTACCAGATGCCTTCTATCTCTGGACTCCTGCCC TCAGACTTCTCCGACACCTGAAGAAAGCTTCTGGGACAGCTGACATGCACAACCTGGGAGCTAAAACATGTGGGACCAGCTGTGACCAATGAACAATGATGGACAGGAGACGATAACCCCATTAGTTCCTTACAGTGCTGAGATAAATTTCATGAGTC TCCTAGAAGATCTGATGGGATTGAACATCAGTTGTACCTAGCATGGCCGCTGTACTGGCTTTCCTTCCTTCCCTATTTCATCCCCCCTCGTCCCTCCTACTCCTTGGGATCACATTGACAAATAAGTCTCTTGCATGCAAAAAAAAAAAAAAAAAAAAA .

2. Use of the substance for knocking down the LncRNA for antagonizing the replicative senescence of human mesenchymal stem cells according to claim 1 in the preparation of a product for inhibiting cell apoptosis.

3. Use of the substance for knocking down the LncRNA for antagonizing the replicative senescence of human mesenchymal stem cells according to claim 1 in the preparation of a product for inhibiting the secretory phenotype of cell senescence.

4. Use of the substance for knocking down the LncRNA for antagonizing the replicative senescence of human mesenchymal stem cells according to claim 1 in the preparation of a product for improving the osteogenic differentiation ability of aged mesenchymal stem cells.

5. Use of a substance overexpressing the LncRNA for antagonizing replicative senescence of human mesenchymal stem cells according to claim 1 in the preparation of a product for promoting cell apoptosis.

6. Use of a substance overexpressing the LncRNA for antagonizing the replicative senescence of human mesenchymal stem cells according to claim 1 in the preparation of a product for promoting the secretory phenotype of cell senescence.

7. Use of a substance overexpressing the LncRNA for antagonizing the replicative senescence of human mesenchymal stem cells according to claim 1 in the preparation of a product for weakening the osteogenic differentiation ability of aged mesenchymal stem cells.

8. The use according to any one of claims 2 to 7, characterized in that: The inhibition of cell apoptosis refers to the inhibition of apoptosis of aged human mesenchymal stem cells.

9. A drug for reducing chronic inflammatory secretion of senescent mesenchymal stem cells and improving the apoptotic state and differentiation ability of senescent cells, characterized in that: A substance containing the LncRNA knocked down according to claim 1 for antagonizing the replicative senescence of human mesenchymal stem cells.

10. The drug according to claim 9, characterized in that The inhibition of cell apoptosis refers to the inhibition of apoptosis of aged human mesenchymal stem cells.

Images