A nucleic acid aptamer specifically binding to GBX2 protein and its application
By improving the SELEX screening conditions and microplate method, nucleic acid aptamers that stably and specifically bind to GBX2 protein were screened, which solved the difficulties in detecting and targeting GBX2 protein in existing technologies and achieved efficient detection and treatment effects.
Patent Information
- Application Number
- CN202411888153.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-20
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2044-12-20
AI Technical Summary
Existing technologies make it difficult to efficiently detect and target GBX2 protein, and nucleic acid aptamers lack stability and specificity in practical applications.
By improving the SELEX screening conditions and combining the microplate method with real-time fluorescence quantitative PCR, we screened out nucleic acid aptamers with small molecular weight, stable chemical properties, and easy labeling. They specifically bind to the GBX2 protein, and serum is gradually added during the screening process to improve affinity and stability.
Nucleic acid aptamers with high affinity and high specificity binding to GBX2 protein have been obtained, which can be used for high-sensitivity detection, imaging and treatment of GBX2-related diseases and have broad application prospects.
Smart Images

Figure CN119876161B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer specifically binding to GBX2 protein and applications thereof. Background Art
[0002] Gastrulation brain homeobox 2 (GBX2) is a member of the homeobox gene family. It encodes a helix-turn-helix structure and is part of chromatin. It is active in the cell nucleus and can serve as a transcription factor for cell pluripotency and differentiation in the embryo. It is composed of 348 amino acids.
[0003] GBX2, a transcription factor, possesses sequence-specific double-stranded DNA binding activity, thereby regulating gene transcription and participating in the regulation of nervous system development and RNA polymerase II transcription. During development, GBX2 protein expression exhibits a specific temporal pattern and functions upstream or within multiple processes. In the early stages of embryonic development, GBX2 plays an important role in the formation of the midbrain and hindbrain, regulating the differentiation of the neural plate and the formation of the neural tube. During nervous system development, GBX2 regulates the proliferation, differentiation, and migration of neural progenitor cells, making it crucial for the normal development of the brain and spinal cord.
[0004] Studies have found that GBX2 protein plays an important role in the occurrence and development of some cancers. For example, GBX2 is consistently overexpressed in prostate cancer cell lines (TSU-pr1, PC3, DU145, and LNCaP), and downregulating GBX2 expression inhibits the clonogenicity of prostate cancer cells. In addition, GBX2 promotes the proliferation of prostate cancer cells through the IL-6 / JAK / STAT3 signaling pathway by upregulating IL-6 expression. At the same time, GBX2 may promote the proliferation of lung cancer cells by regulating the AKT / ERK signaling pathway. AKT and ERK are important intracellular signal transduction molecules involved in regulating cell growth, survival, and proliferation. GBX2 expression may enhance the phosphorylation levels of AKT and ERK, thereby activating these signaling pathways and enabling lung cancer cells to acquire stronger proliferative capacity.
[0005] Aptamers are DNA or RNA molecules isolated and screened through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process. Aptamers can bind with high affinity and specificity to other targets, such as proteins, metal ions, small molecules, peptides, and even whole cells, and therefore offer broad application prospects. Compared to antibodies, aptamers offer advantages such as smaller molecular weight, greater stability, ease of modification, and lack of immunogenicity. Aptamers can be synthesized artificially, eliminating the need for animal immunization, protein extraction, and purification. Therefore, identifying aptamers with high affinity and specificity for GBX2 would facilitate the highly sensitive and specific detection of GBX2 and aid in the development of drugs targeting the protein. Summary of the Invention
[0006] The present invention aims to provide a nucleic acid aptamer that specifically binds to the GBX2 protein. By improving the screening conditions, a nucleic acid aptamer with a small molecular weight, stable chemical properties, easy storage and labeling is obtained, which can bind to the GBX2 protein with high affinity and high specificity. The aptamer can be used in detection, diagnosis, imaging and treatment, and has broad application prospects.
[0007] The present invention achieves the above-mentioned purpose through the following technical solutions:
[0008] The first object of the present invention is to provide a nucleic acid aptamer that specifically binds to GBX2 protein. The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1.
[0009] The second object of the present invention is to provide a conjugate of a nucleic acid aptamer that specifically binds to the GBX2 protein, wherein the conjugate of the nucleic acid aptamer is obtained by linking a labeling substance to the nucleotide sequence of the nucleic acid aptamer that specifically binds to the GBX2 protein as described above.
[0010] As a further optimization scheme of the present invention, the labeling substance includes at least one of a radioactive substance, a therapeutic substance, a biotin label, an enzyme label, a fluorescein label, a nucleic acid probe, a nanoluminescent material, a small peptide, or a siRNA, so that the modified nucleic acid aptamer sequence has desirable properties. For example, it can have an affinity for binding to the GBX2 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.
[0011] In other words, the aptamers mentioned above, whether partially substituted or modified, all have substantially the same or similar molecular structure, physicochemical properties, and functions as the original aptamers, and can be used to bind to the GBX2 protein.
[0012] The third object of the present invention is to provide a method for screening nucleic acid aptamers that specifically bind to GBX2 protein, comprising the following steps:
[0013] (1) synthesizing a random single-stranded DNA library and providing primers, wherein the sequence of the random single-stranded DNA library is "TTCAGCACTCCACGCATAGC-36N-CCTATGCGTGCTACCGTGAA", wherein "36N" represents a sequence formed by connecting 36 arbitrary nucleotide bases;
[0014] (2) Microplate screening: first, the target protein GBX2 and the anti-screening protein are coupled to the microplate and then blocked. Then, the random single-stranded DNA library is dissolved and renatured, and then added to the blocked microplate coupled with the anti-screening protein for anti-screening to obtain the anti-screening supernatant. Subsequently, the random single-stranded DNA library after anti-screening is added to the blocked microplate coupled with the target protein GBX2 for positive screening to obtain the positive screening supernatant. Subsequently, the nucleic acid molecule in the positive screening supernatant is used as a template, "FAM-TTCAGCACTCCACGCATAGC" is used as the forward primer, and "Biotin-TTCACGGTAGCACGCATAGG" is used as the reverse primer to perform PCR amplification to obtain the amplified product. The amplified product is purified and used to prepare the secondary library for the next round of screening.
[0015] (3) Repeat step (2) for at least 6 rounds of screening, and add additional serum from the 5th round of screening to the microplate coupled with the target protein GBX2 and the counter-screening protein for blocking, and obtain the enriched library product after the screening is completed;
[0016] (4) The enriched library products are subjected to high-throughput sequencing analysis and the affinity with the target protein GBX2 is detected to obtain the nucleic acid aptamer that specifically binds to the GBX2 protein.
[0017] As a further optimization scheme of the present invention, in step (2), the specific process of adding serum is as follows: in the fifth round of screening, an additional 2% volume ratio of serum is added for blocking; in the sixth round of screening, an additional 5% volume ratio of serum is added for blocking, and the serum is human serum.
[0018] The method provided herein for screening aptamers that specifically bind to the GBX2 protein is based on the SELEX screening method. During the microplate screening step, serum is added for blocking starting in the fifth round and the serum concentration is increased in each round to further enhance the specificity and stability of the aptamers. While conventional aptamer screening is performed in an ionic buffer, the gradual addition of serum at a certain concentration during screening allows for the elimination of sequences that have weak binding affinity or are merely adsorbed to the target GBX2 protein, as serum contains abundant proteins that can compete with proteins on the microplate surface. Furthermore, aptamer binding to the target protein in a serum environment can better meet the practical testing requirements of later applications based on aptamer development. Studies have demonstrated that using higher serum concentrations in the final rounds of screening can yield aptamers with higher affinity and improved specificity.
[0019] As a further optimization scheme of the present invention, the screening method also includes using real-time fluorescence quantitative PCR to monitor the screening process. The specific steps are: using the nucleic acid molecules in the reverse screening supernatant and the positive screening supernatant obtained in each round of screening as templates, using "TTCAGCACTCCACGCATAGC" as the forward primer and "TTCACGGTAGCACGCATAGG" as the reverse primer, performing real-time fluorescence quantitative PCR analysis to obtain q-PCR results, and calculating the retention rate of the nucleic acid molecules after each round of screening using the Cq value of the q-PCR results. If the retention rate exceeds 1%, it is determined that the screening process can be terminated.
[0020] The fourth object of the present invention is to provide a product for detecting GBX2 protein, comprising the nucleic acid aptamer as described above or a conjugate of any of the nucleic acid aptamers as described above.
[0021] As a further optimized solution of the present invention, the product includes one or more of a kit, a detection chip or a chromatography detection device.
[0022] The fifth object of the present invention is to provide a use of the nucleic acid aptamer as described above or the conjugate of any of the nucleic acid aptamers as described above in any of the following:
[0023] (1) Quantitative or qualitative detection of GBX2 protein;
[0024] (2) Purification of GBX2 protein;
[0025] (3) Imaging of GBX2 protein;
[0026] (4) as an inhibitor of GBX2 protein;
[0027] (5) preparing drugs targeting GBX2 protein;
[0028] (6) Prepare drugs for diagnosing or treating abnormal GBX2 protein expression.
[0029] The present invention has the following beneficial effects:
[0030] Based on the SELEX technique, the present invention designed and synthesized a random single-stranded DNA library and corresponding primers. By improving the screening conditions, a small molecular weight, chemically stable, easy to store and label, and high-affinity aptamer, designated GBX2-08, was identified. This aptamer has broad potential for detection, diagnosis, imaging, and therapy, including purification or high-sensitivity detection of GBX2 protein, preparation of drugs targeting GBX2 protein, and preparation of reagents or drugs for diagnosing or treating abnormal GBX2 expression. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 The standard curve (A) drawn using real-time fluorescence quantitative PCR (q-PCR) in Example 1 with Cq value as the horizontal axis and Log initial concentration as the vertical axis, and the molecular retention rate after positive and negative screening in each round of screening calculated using the standard curve (B);
[0032] Figure 2 Schematic diagram of the affinity test results between nucleic acid aptamer GBX2-08 and GBX2 protein in Example 2;
[0033] Figure 3 Schematic diagram of the specificity study results of nucleic acid aptamer GBX2-08 in Example 3;
[0034] Figure 4 、 Figure 5 、 Figure 6 This is a schematic diagram of the results of the dot blot hybridization assay for detecting GBX2 protein using the nucleic acid aptamer GBX2-08 in Example 4. DETAILED DESCRIPTION
[0035] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.
[0036] Unless otherwise specified, all materials and reagents used in the following examples can be obtained from commercial sources.
[0037] Example 1 Screening of ssDNA Aptamers Specifically Binding to GBX2 Protein
[0038] The method of this embodiment for screening ssDNA nucleic acid aptamers that specifically bind to GBX2 protein includes the following steps:
[0039] 1. Synthesis of random single-stranded DNA library and primers
[0040] The sequence of the random single-stranded DNA library (Lib13) is: 5'-TTCAGCACTCCACGCATAGC-36N-CCTATGCGTGCTACCGTGAA-3' (SEQ ID NO. 2), where "36N" represents a sequence consisting of 36 random nucleotide bases. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0041] The primer information is shown in Table 1 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.
[0042] Table 1. Primers and their sequence information
[0043]
[0044] In the table, S in the primer name represents a forward primer, and A in the primer name represents a reverse primer.
[0045] 2. Microplate screening
[0046] The microplate method was used for screening, and a total of 6 rounds of screening were conducted. The screening process for each round is shown in Table 2:
[0047] Table 2. GBX2 protein aptamer screening process
[0048]
[0049] The specific screening process for each round is as follows:
[0050] 1) Coupling of target protein (GBX2) and anti-screening protein (His peptide)
[0051] A polystyrene 96-well ELISA microplate (Bellanbo Biotechnology (Hangzhou) Co., Ltd., Cat. No. PT06-96S) was used as a carrier to couple the target protein to its surface. The specific steps were: 5 μL of GBX2 protein (purchased from Suzhou Younuozhen Biotechnology Co., Ltd., P03034PA, concentration 1 mg / mL) was added to 95 μL of 100 mM sodium phosphate buffer (pH 8.5) and mixed thoroughly. The mixed GBX2 protein was then added dropwise to the 96-well ELISA microplate and incubated overnight at 4°C. This was designated GBX2-Plate.
[0052] Similarly, a His peptide was immobilized on a polystyrene 96-well ELISA microplate. The His peptide, synthesized by Nanjing GenScript Biotechnology Co., Ltd., consists of nine consecutive histidines. The His protein conjugation procedure was identical to that for GBX2 protein, with a His peptide concentration of 1 mg / mL. Specifically, 10 μL of His peptide was added to 90 μL of 100 mM sodium phosphate buffer (pH 8.5) and mixed thoroughly. The mixed His peptide was then added dropwise to the 96-well ELISA microplate and incubated overnight at 4°C. This was designated the His-Plate.
[0053] 2) Screening
[0054] ① Library dissolution and denaturation: Take 1 OD of random single-stranded nucleotide library and centrifuge at 14,000 rpm for 5 minutes. Pour the library to the bottom of the tube and dissolve it in DPBS buffer to 10 μM. Mix thoroughly and aliquot into PCR tubes for denaturation. The process is as follows: Set the PCR instrument to 95°C for 10 minutes to unwind the folded strands. Then, hold at 4°C for 5 minutes before equilibration to room temperature.
[0055] ② Microplate Blocking: Remove the supernatant from the His-Plate and wash the microplate twice with 120 μL of DPBS-T (containing 0.02% v / v Tween 20), tapping clean. Add 100 μL of BSA (final concentration of 1 mg / mL) and block the microplate for 1 hour at room temperature. After blocking, remove the supernatant and wash the microplate twice with 120 μL of DPBS-T, tapping clean. Block the GBX2-Plate in the same manner as above.
[0056] ③ Counter-screening: Add the processed library to the blocked His-Plate, mix thoroughly, and incubate on a horizontal shaker at room temperature for 1 hour. Collect the supernatant and label it Pool-. Wash the microplate four times with 200 μL of DPBS buffer. Finally, add 100 μL of ultrapure water to the washed microplate and boil it in a boiling water bath for 10 minutes. Collect the supernatant (this is the counter-screening supernatant) and label it Elution-His.
[0057] ④ Positive Screen: Add the library pool (Pool-) after the reverse screening to the blocked GBX2-Plate, mix thoroughly, and incubate on a horizontal shaker at room temperature for 1 hour. Discard the supernatant and wash the microplate four times with 200 μL of DPBS buffer. Finally, add 100 μL of ultrapure water to the washed microplate and incubate in a boiling water bath for 10 minutes. Collect the supernatant (this is the positive screen supernatant) and label it Elution-GBX2.
[0058] ⑤PCR: Amplify the nucleic acid molecules in Elution-GBX2 using standard PCR. The method is as follows: Add all the template Elution-GBX2 to 900 μL of PCR mix. Add 100 μL of the template and PCR mix to each PCR tube. Amplification conditions are as follows: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 30 seconds, 60°C annealing for 30 seconds, and 72°C extension for 30 seconds, for a total of 25 cycles, and store at 4°C. The PCR raw materials were prepared using dNTPs (P031-02) purchased from Novozymes and rTaq enzyme (R500Z) purchased from Takara Biotech. The formula is shown in Table 3.
[0059] Table 3. PCR mix premix formula
[0060]
[0061]
[0062] ⑦ Secondary library preparation: The amplified product was purified using commercially available Tiandirenhe streptavidin (SA) magnetic beads (SM017100) to prepare the secondary library for the next round of screening. The secondary library preparation process for the next round of screening was as follows: 1 mL of PCR product was added with 1 / 5 volume of 4M sodium chloride, followed by 80 μL of SA magnetic beads that had been washed with DPBS and the supernatant removed. After incubation on a shaker at room temperature for 30 minutes, the PCR product supernatant was removed. The beads were then washed three times with DPBS-T, the supernatant removed, and 100 μL of 40 mM sodium hydroxide solution was added. After incubation for 3 minutes, the beads were removed by magnetic aspiration. 4 μL of 1M hydrochloric acid was then added to the supernatant to neutralize the single strands. Subsequently, 104 μL of 2×DPBS was added to dilute and neutralize the salt concentration. Finally, 208 μL of the secondary library dissolved in 1×DPBS was obtained, which served as the library for the next round of screening.
[0063] 3. Real-time fluorescence quantitative PCR (q-PCR) monitoring of screening process
[0064] 1) q-PCR: Using the nucleic acid molecules in Elution-His and Elution-GBX2 as templates, q-PCR was used to monitor the screening progress. The method was as follows: 2 μL of each Elution-His and Elution-GBX2 were added to 18 μL of q-PCR mix and mixed thoroughly. Amplification conditions were as follows: 95°C denaturation for 2 min, 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 30 s, for a total of 30 cycles. Melting curve analysis conditions were as follows: 95°C for 10 s, 37°C for 10 s, 95°C for 10 s, and finally, cooling at 37°C for 30 s. The q-PCR mix recipe is shown in Table 4.
[0065] Table 4. q-PCR mix premix formula
[0066]
[0067] 2) Retention rate calculation: The Cq value in the q-PCR result can indirectly reflect the number of nucleic acid molecules in the sample. The smaller the Cq value, the more molecules in the sample. The Lib13 library is used as a standard and a 5-concentration gradient dilution (10000pM, 1000pM, 10pM, 10pM, 1pM) is used for q-PCR. The Cq value obtained at each concentration is used as the horizontal axis, and the logarithm of the initial concentration (pM) of the sample (Log initial concentration) is used as the vertical axis to obtain a standard curve, as shown below: Figure 1 As shown in A, the equation of the standard curve is:
[0068] Y=-0.2107X+5.0351,R 2 =0.9995;
[0069] The Cq value obtained by q-PCR for Elution-His and Elution-GBX2 in each round of screening was used as X. The logarithmic value of the eluted sample concentration was further substituted into the standard curve and recorded as Y. The elution volume was 100 μL each time, so the amount of substance in each round of eluate was calculated according to the following formula:
[0070] n 洗脱 =C 洗脱浓度 ×V 洗脱体积 =10 Y ×100;
[0071] The initial input concentration of each round of screening library is C 投入浓度 (nM), input volume is V 投入体积 (μL), so the amount of material input in each round is calculated according to the following formula:
[0072] n 投入 =C 投入浓度 ×V 投入体积 ×10 3 ;
[0073] Therefore, the retention rate after each round of screening is calculated according to the following formula:
[0074] Retention rate = n 洗脱 / n 投入 ×100%={10 Y / (C 投入浓度 ×V 投入体积 ×10)}×100%;
[0075] like Figure 1As shown in Figure B, by calculating the retention rate of molecules in each round, the retention rate of the positive screen gradually increases, and in the sixth round, the retention rate exceeds 1%, indicating that the library is effectively enriched. Therefore, the screening can be terminated and library construction and sequencing can be carried out.
[0076] 3) Analysis and identification of the nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, several sequences were selected and synthesized by Genewizi Biotechnology (Jiangsu) Co., Ltd., and the affinity was tested.
[0077] In subsequent tests, a nucleic acid aptamer with a strong binding ability was identified, which has a nucleotide sequence as shown in SEQ ID NO.1 and was named GBX2-08.
[0078] Example 2 Surface Plasmon Resonance (SPR) Detection of the Affinity of GBX2 Protein Aptamer GBX2-08 and GBX2 Protein
[0079] Suzhou Genewise Biotechnology Co., Ltd. was commissioned to synthesize the nucleic acid aptamer GBX2-08 (SEQ ID NO. 1), which was diluted with DPBS buffer to 15.63nM, 31.25nM, 62.5nM, 125nM, 250nM, and 500nM for later use. Surface plasmon resonance (SPR) was then used to detect the affinity of the GBX2 protein aptamer GBX2-08 to the GBX2 protein. The specific process is as follows:
[0080] 1. GBX2 protein was coupled to channel 2 of a CM5 chip (Cytiva, catalog number 29104988) as follows: A mixture of equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M in water) and NHS (N-hydroxysuccinimide; 0.1 M in water) was injected into the chip for activation at a flow rate of 5 μL / min. GBX2 protein was diluted with 10 mM sodium acetate, pH 5.5, to a final concentration of 50 μg / mL and injected into the chip at a flow rate of 5 μL / min. The amount of GBX2 protein coupled was 3900.3 Ru. Following injection, the chip was blocked with ethanolamine at a flow rate of 10 μL / min, and 100 μL of sample was injected. Channel 1 was treated as described above, with the His peptide coupling procedure, activation, and blocking procedures identical to those described above, and served as a control channel.
[0081] 2. Detection: Detection parameters were set using a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K). The diluted GBX2-08 aptamer sample was passed through channels 1 and 2 in sequence. The procedure for each aptamer was as follows: injection at 30 μL / min for 2 min, dissociation at 30 μL / min for 2 min, and regeneration with 1.5 M NaCl at 30 μL / min for 30 s. The affinity detection data of the nucleic acid aptamer GBX2-08 and GBX2 protein are shown in [ 1 ]. Figure 2 , KD values are shown in Table 5 below.
[0082] Table 5. Affinity of nucleic acid aptamers to GBX2 protein
[0083]
[0084] Example 3 Study on the specificity of nucleic acid aptamer GBX2-08
[0085] In this example, MSL3 protein (purchased from Suzhou Younuozhen Biotechnology Co., Ltd., catalog number: P03574PA), ZNF653 protein (purchased from Suzhou Younuozhen Biotechnology Co., Ltd., catalog number: P03733PA), and RFWD3 protein (purchased from Suzhou Younuozhen Biotechnology Co., Ltd., catalog number: P65831PC) were used instead of GBX2 protein. The method for immobilizing GBX2 protein on a CM5 chip for testing was the same as in Example 2. MSL3 protein, ZNF653 protein, and RFWD3 protein were coupled to the second channel of four channels on the surface of the CM5 chip, with coupling amounts of 2474.2 RU, 6325.8 RU, and 5487.3 RU, respectively. The diluted GBX2-08 nucleic acid aptamer was injected sequentially.
[0086] The affinity test data of nucleic acid aptamer GBX2-08 and MSL3 protein, ZNF653 protein and RFWD3 protein are shown in Figure 3 .Depend on Figure 3 It can be seen that the nucleic acid aptamer GBX2-08 cannot bind to the MSL3 protein, ZNF653 protein, and RFWD3 protein, which shows that the nucleic acid aptamer GBX2-08 has very good specificity.
[0087] Example 4 Detection of GBX2 protein by dot blot hybridization based on nucleic acid aptamer GBX2-08
[0088] The steps of the dot blot hybridization experiment performed in this example are as follows:
[0089] 1. Take two 8 cm × 2 cm nitrocellulose membranes (purchased from Millipore) and dilute GBX2 protein, control protein His peptide, BSA protein (purchased from Sangon Biotech (Shanghai) Co., Ltd., Catalog No.: A600332), and IL-6 protein (purchased from Aibosheng (Beijing) Science and Technology Co., Ltd., Catalog No.: PP-496) with DPBS to 0.5 mg / mL. Spot 2 μL of each sample on the nitrocellulose membrane and air-dry for 30 minutes. At the same time, dilute GBX2 protein with DPBS to 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, respectively. Spot 2 μL of each sample on the nitrocellulose membrane and air-dry for 30 minutes.
[0090] 2. After drying, block with 1% human serum (normal human serum, purchased from Beijing Solebow Technology Co., Ltd., catalog number: SL010) at room temperature for 1 hour. After blocking, wash with DPBS-T three times and aspirate clean.
[0091] 3. Suzhou Genewiz Biotechnology Co., Ltd. was commissioned to synthesize the biotin-modified GBX2-08 nucleic acid aptamer. The biotin-modified GBX2-08 nucleic acid aptamer was synthesized using a 5mM Mg 2+ The diluted aptamer was diluted to 200 nM with DPBS, and then the diluted aptamer was incubated with the protein on the nitrocellulose membrane on a shaker at room temperature for 30 min.
[0092] 4. After incubation, use 5mM Mg 2+ Wash three times with DPBS-T on a shaker for 5 minutes each time.
[0093] 5. Add 5mM Mg 2+ HRP-Streptavidin (purchased from Beyotime, product number A0303) was diluted 1:2000 in DPBS-T and incubated on a shaker at room temperature for 30 minutes.
[0094] 6. Contains 5mM Mg 2+ Wash three times with DPBS-T on a shaker for 2 minutes each time.
[0095] 7. Add color developing solution (BeyoECL Star ultra-sensitive ECL chemiluminescence kit, purchased from Beyotime, product number P0018A, solution A and solution B are the solutions provided with the kit) at a ratio of solution A: solution B = 1:1 (v / v), and develop the color for 5 minutes at room temperature in the dark.
[0096] 8. Imaging system observation and photography: The instrument used is ImageQuant from GE Healthcare Life SciencesTM LAS 4000 digital imaging system.
[0097] The results are as follows Figure 4 As shown, 1 is GBX2 protein, 2 is His peptide, 3 is BSA protein, 4 is IL-6 protein, and 5 is DPBS; compared with the spots of the control proteins His peptide, BSA protein, IL-6 protein, and DPBS, the GBX2 protein is clearly colored, indicating that biotin-modified GBX2-08 can be used for the detection of membrane hybridization GBX2 protein and does not bind to the control proteins His peptide, BSA protein, IL-6 protein, and DPBS, showing high specificity.
[0098] The results are as follows Figure 5 As shown, after the GBX2 protein was diluted to 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, the GBX2 protein showed obvious color, which indicated that the biotin-modified GBX2-08 can be used for the detection of GBX2 protein by membrane hybridization.
[0099] The results are as follows Figure 6 As shown, the grayscale values of the blots obtained at different concentrations of GBX2 protein were quantified using ImageJ software. The results showed that the concentration of GBX2 protein was linearly related to the grayscale value. As the concentration of GBX2 protein increased, the grayscale value increased. The linear equation is:
[0100] Y=126170X-161761, R 2 =0.9559;
[0101] Limit of detection LOD:
[0102] LOD = 3σ / κ;
[0103] Where κ is the slope distance of the linear equation and σ is the standard deviation of the blank signal. The LOD was obtained to be 1.18 μg / mL.
[0104] In summary, the GBX2-08 aptamer can detect GBX2 protein at a concentration as low as 1.18 μg / mL.
[0105] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.
Claims
1. A nucleic acid aptamer that specifically binds to GBX2 protein, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.
1.
2. A conjugate of a nucleic acid aptamer that specifically binds to GBX2 protein, characterized in that: The nucleic acid aptamer conjugate is obtained by linking a labeling substance to the nucleotide sequence of the nucleic acid aptamer that specifically binds to the GBX2 protein according to claim 1.
3. The conjugate of a nucleic acid aptamer that specifically binds to GBX2 protein according to claim 2, characterized in that: The labeling substance includes at least one of a radioactive substance, a therapeutic substance, a biotin label, an enzyme label, a fluorescent label, a nucleic acid probe, a nanoluminescent material, a small peptide or siRNA.
4. A product for detecting GBX2 protein, characterized in that: The invention comprises the nucleic acid aptamer according to claim 1 or a conjugate of the nucleic acid aptamer according to any one of claims 2 to 3.
5. A product for detecting GBX2 protein according to claim 4, characterized in that: The product includes one or more of a test kit, a detection chip or a chromatography detection device. 6 . Use of the nucleic acid aptamer according to claim 1 or the nucleic acid aptamer conjugate according to any one of claims 2 to 3 in purifying GBX2 protein.
Citation Information
Patent Citations
Biomarkers and methods for identification of agents useful in the treatment of affective disorders
CN101360835A
Aptamer and derivative thereof specifically binding human connective tissue growth factor (CTGF) as well as application
CN112251442A