Nucleic acid aptamer of cardiovascular disease diagnosis and prognosis biomarker Copeptin and application

Abstract

The invention relates to a nucleic acid aptamer Seq42 of a diagnosis and prognosis biomarker Copeptin (human) of cardiovascular diseases as well as a screening method and application of the nucleic acid aptamer. The sequence of the nucleic acid aptamer is as shown in SEQ ID NO. 1. The Copeptin is used as a diagnosis and prognosis biomarker of cardiovascular diseases, the aptamer specifically bound with the Copeptin is screened for the first time, a DcaCE-SELEX method is adopted, and the aptamer with good specificity can be obtained through screening in three rounds. The synthesis cost of the nucleic acid aptamer Seq42 is lower than that of antibody preparation, the period is short, and the reproducibility is good. The molecular weight is small; the permeability is good; the synthesis and marking are easy. The Copeptin polypeptide nucleic acid aptamer Seq42 can be combined with Copeptin with high affinity and high specificity, the KD value of the Copeptin polypeptide nucleic acid aptamer Seq42 is 57 nM, and the Copeptin polypeptide nucleic acid aptamer Seq42 has an application prospect in the aspects of CVD diagnosis and prognosis.

Description

Technical Field

[0001] The present invention relates to a nucleic acid aptamer Seq42 of Copeptin (human), a diagnostic and prognostic biomarker for cardiovascular diseases, and a screening method and application thereof. Background Art

[0002] Copeptin (human) is a diagnostic and prognostic biomarker for cardiovascular disease (CVD). Copeptin (human) is also the carboxyl terminus of the arginine vasopressin (AVP) precursor peptide. Copeptin (human) can be used in the study of cardiovascular disease. It is a glycosylated polypeptide composed of 39 amino acids, AVP (amino acids 126-164). It has a half-life of about 14 days, is stable and easy to detect, can better reflect the level of neurogenic stress, can be used as a surrogate for AVP, and is related to the severity of heart failure. As a new "biomarker" for predicting stroke, the higher the level of copeptin in the blood, the higher the patient's chance of severe stroke. The concentration detected in the blood is 8-18pmol / L.

[0003] Nucleic acid aptamers (aptamers or aptamers for short) are a type of single stranded DNA (ssDNA) or RNA with a special three-dimensional structure (hairpin, pseudoknot, convex loop, G-tetramer, etc.) that can bind to the target with high specificity and high affinity. Nucleic acid aptamers are obtained by screening through the systematic evolution of ligands by exponential enrichment (SELEX). Nucleic acid aptamers have the advantages of good stability, short production cycle, low cost, chemical synthesis and mass production, and various functional modifications. Therefore, nucleic acid aptamers have broad prospects in detection and diagnosis.

[0004] The CE-SELEX method for aptamer screening based on capillary electrophoresis (CE) has advantages in protein aptamer screening, and can achieve high-resolution separation of nucleic acid-target complexes and free nucleic acid libraries and accurate collection of complexes. When using capillary electrophoresis for aptamer screening, proteins and nucleic acids are in a dynamic binding and dissociation state in the solution. This is a significant advantage of CE-SELEX over other screening and separation methods, which does not require the intervention of a fixed medium and is conducive to maintaining the natural molecular form of the combination of proteins and nucleic acids. If the migration time of the protein (peptide), nucleic acid library and the complex formed by the two in the capillary zone electrophoresis (CE) mode is significantly different, the capillary electrophoresis separation of the incubation mixture of the protein (peptide) and nucleic acid library is performed. Since the charge-to-mass ratio and mobility of the complex formed by the polypeptide and the ssDNA library are not much different from those of the free ssDNA library, the separation efficiency of the complex and the free ssDNA library is not high. In order to increase the screening pressure and improve the screening efficiency, the dcaCE-SELEX peptide aptamer screening platform was established to screen aptamers for copeptin.

[0005] The principle of dcaCE-SELEX is divided into the following steps: 1) co-incubate the polypeptide target with the ssDNA library to form a "binding-dissociation" equilibrium mixture; 2) inject the equilibrium mixture onto the capillary column; 3) inject the electrophoresis buffer onto the capillary column as a spacer; 4) inject the catcher protein that can capture ssDNA onto the capillary column; 5) run CE to allow the protein catcher to pass through the polypeptide equilibrium mixture to complete the on-column reaction. In this way, the charge-to-mass ratio of the free ssDNA library is changed to achieve accurate separation of the polypeptide complex. This is the first time that the present invention uses capillary electrophoresis technology to adopt the polypeptide aptamer screening strategy of dcaCE-SELEX to screen nucleic acid aptamers for Copeptin (human), a diagnostic and prognostic biomarker for cardiovascular disease. Summary of the invention

[0006] The purpose of the present invention is to provide a high-affinity and high-specificity cardiovascular disease diagnosis and prognosis biomarker Copeptin polypeptide nucleic acid aptamer Seq42 and a screening method and application thereof.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A nucleic acid aptamer for Copeptin polypeptide, a diagnostic and prognostic biomarker for cardiovascular disease, wherein the nucleic acid aptamer is Seq42, and the nucleotide sequence thereof is:

[0009] Seq42:

[0010] 5'-AGCAGCACAGAGGTCAGATGTCATGATCGACCGTGAATGATGTAAA TTATACCGTATGGCCCTATGCGTGCTACCGTGAA-3' (SEQ ID NO. 1).

[0011] At 25 °C, 0.1 M Na + , 0.001M Mg 2+ Under the condition of , the secondary structures of the nucleic acid aptamers Seq1, Seq2, and Seq42 are all stem-loop structures, and their molecular structures are as follows:

[0012]

[0013] The nucleic acid aptamer Seq42 screening method for the Copeptin polypeptide, a diagnostic and prognostic biomarker for cardiovascular disease, adopts the DcaCE-SELEX method for polypeptide aptamer screening and performs three rounds of screening, because the copeptin is a 39-mer peptide with a molecular weight of 4021.46, which is close to the nucleic acid library. Considering that a biosensor for detecting copeptin in blood will be developed based on aptamers in the future, a serum matrix background (1 / 20) is introduced in the third round of screening, so that the copeptin is incubated with the third round nucleic acid library in the serum background, the aptamer's anti-serum component interference performance is increased, and the development of aptamer sensors is provided.

[0014] Preferably, the 5' end or 3' end of the nucleic acid aptamer Seq42 is chemically modified with a fluorescent group, an amino group, biotin, digoxigenin or polyethylene glycol.

[0015] The nucleic acid aptamer is used in preparing a reagent, a kit or a sensor for detecting Copeptin polypeptide.

[0016] The application of the nucleic acid aptamer in the preparation of a molecular probe for detecting Copeptin polypeptide.

[0017] The application of the nucleic acid aptamer in the fluorescence detection of Copeptin polypeptide.

[0018] A kit for specifically recognizing Copeptin polypeptide comprises the nucleic acid aptamer.

[0019] A molecular probe comprises the nucleic acid aptamer.

[0020] Compared with the prior art, the advantages of the present invention are:

[0021] 1. Copeptin is a diagnostic and prognostic biomarker for cardiovascular disease, and its specific binding aptamers were screened for the first time.

[0022] 2. Copeptin polypeptide nucleic acid aptamer Seq42 screening uses the DcaCE-SELEX method, and aptamers with good specificity can be obtained in three rounds.

[0023] 3. The synthesis cost of the nucleic acid aptamer Seq42 is lower than that of antibody preparation, and the cycle is short and the reproducibility is good. It is non-toxic, has a small molecular weight, good permeability, and is easy to synthesize and label.

[0024] 4. Copeptin polypeptide nucleic acid aptamer Seq42 can bind to Copeptin with high affinity and specificity, among which K D The values ​​were 57nM, respectively, which has application prospects in the diagnosis and prognosis of CVD.

[0025] 5. The Copeptin polypeptide nucleic acid aptamer Seq42 can be used in the separation and purification of Copeptin polypeptide, the preparation of Copeptin polypeptide detection reagents, and the development of drugs for the treatment of Copeptin polypeptide-related diseases. It has broad application prospects and important scientific, social and economic values. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a simulation diagram of the secondary structure of the nucleic acid aptamer Seq42.

[0027] Figure 2 This is the result diagram of the nucleic acid aptamer screening process, where: Figure 2-1 Screening of copeptin aptamers for dcaCE-LIF (first round); aH-Tf 10μM+ssDNAN400.5μM; bH-Tf 10μM+ssDNAN400.5μM+copeptin 5μM; cH-Tf10μM+ssDNAN400.5μM+copeptin 10μM; Figure 2-2 Screening of peptide aptamers for dcaCE-LIF (second round); aH-Tf10μM+ssDNA N40 0.5μM; bH-Tf 10μM+ssDNA N40 0.5μM + copeptin 5μM. Figure 2-3 Screening of peptide aptamers for dcaCE-LIF (round 3, serum background); aH-Tf 10 μM + ssDNA N40 0.5μM; bH-Tf 10μM+ssDNA N40 0.5μM + copeptin 3μM.

[0028] Figure 3 This is a graph showing the specificity analysis results of the nucleic acid aptamer Seq42.

[0029] Figure 4This is the affinity test result of nucleic acid aptamer Seq42, which shows that seq42 binds to copeptin to form a stable complex.

[0030] Figure 5 It is the optimization of H-TF injection amount, among which, a. ssDNA library (concentration: 0.5μM; injection pressure: 0.5psi; injection time: 5s); b. first inject ssDNA library, then inject pH 7.8 boric acid-borax buffer, and finally inject H-Tf with fast migration rate (concentration: 10μM; injection pressure: 0.5psi; injection time: 5s) cH-Tf injection time 6s; cH-Tf injection time 7s.

[0031] Figure 6 This is the SELEX screening strategy diagram of Copeptin nucleic acid aptamer Seq42 DETAILED DESCRIPTION

[0032] The present invention is described in detail below with reference to the accompanying drawings and embodiments:

[0033] Example 1 Screening of Seq42

[0034] A Copeptin polypeptide nucleic acid aptamer Seq42, whose sequence is as follows:

[0035] The nucleotide sequence of Seq42 is 5'-3':

[0036] AGCAGCACAGAGGTCAGATGTCATGATCGACCGTGAATGATGTAAATT ATACCGTATGGCCCTATGCGTGCTACCGTGAA

[0037] like Figure 1 As shown, Copeptin peptide nucleic acid aptamer Seq42 was heated at 25°C and 0.1 M Na + , 0.001M Mg 2+ Under these conditions, its secondary structure is a stem-loop structure;

[0038] The Copeptin polypeptide nucleic acid aptamer Seq42 is modified with FAM at the 5' end or the 3' end of the nucleic acid aptamer.

[0039] The screening method of the Copeptin polypeptide nucleic acid aptamer Seq42 adopts the DcaCE-SELEX method for polypeptide aptamer screening developed by the research group of Qu Feng of Beijing Institute of Technology. Since ferrotransferrin Human (H-TF) strongly binds to the ssDNA library, and the migration time of the H-TF-ssDNA complex is 2.50-3.80min, and the migration time of the small molecule polypeptide-ssDNA complex is usually close to that of the free ssDNA library, we choose ferrotransferrin Human (H-TF) as the competitive adsorption protein. In order to ensure that the small molecule polypeptide-ssDNA complex is completely separated from the free ssDNA library, the effect of the H-TF injection amount on the ssDNA adsorption efficiency is first studied by the dcaCE-SELEX mode.

[0040] The screening method of the Copeptin polypeptide nucleic acid aptamer Seq42 comprises the following steps (see the screening strategy diagram Figure 6 ):

[0041] (1) 80 nt FAM-labeled ssDNA library: 5'-FAM-AGCAGCACAGAG GTC AGATG-N-CCTATGCGT GCTACC GTGAA-3' (with 20 nt fixed primer sequence at both ends and N nt random sequence in the middle). Primer P1: 5'-AGCAGCACA GAG GTCAGATG-3', fluorescent labeled primer 5'-FAM-P1: FAM-5'-AGCAGCACA GAGGTCAGATG-3'), primer P2: 5'-TTC ACG GTA GCA CGCATA GG-3' (Shanghai Biotech Co., Ltd.).

[0042] (2) Solution preparation: Capillary electrophoresis separation buffer solution: 50mmol / L boric acid borax solution (pH7.8); target protein and nucleic acid incubation solution: PBS buffer (pH 7.4). All buffers were filtered through a 0.22μm filter membrane before use. Protein solution: Prepare a mother solution of the required molar concentration. Dilute with incubation buffer solution as required. Nucleic acid solution: Solid nucleic acid powder should be dissolved in pure water according to the instructions before use, shake and mix, and prepare a 100μmol / L mother solution. Denature at 94℃ for 5min, cool to room temperature and take out for use. Dilute with incubation buffer solution as required.

[0043] (3) Capillary electrophoresis conditions: 75 μm inner diameter fused silica capillary, total length 50.2 cm, effective length 40 cm. LIF detection excitation and emission wavelengths are 488 nm and 520 nm. Electrophoresis buffer: 50 mM pH 7.8 borate buffer. Injection: 0.5 psi, 5 s; separation voltage: 15 kV; separation temperature: 25 °C. Before each sample injection, the capillary was rinsed with 0.1 mol / L NaOH, H2O and electrophoresis buffer for 3 min respectively. Before using a new capillary, it was rinsed with 1 mol / L NaOH, 0.1 mol / L NaOH and distilled water for 30 min to activate it. Before the experiment, the capillary was rinsed with 0.1 mol / L NaOH, H2O and electrophoresis buffer for 5 min.

[0044] (4) Conditions for using dcaCE-SELEX mode

[0045] In dcaCE-SELEX mode, the slow-migrating ssDNA library (concentration: 0.5 μM; injection pressure: 0.5 psi; injection time: 5 s) was first injected, followed by pH 7.8 boric acid-borax buffer (concentration: 50 mM; injection pressure: 0.5 psi; injection time: 5 s) as a buffer, and finally H-TF (concentration: 10 μM; injection pressure: 0.5 psi; injection time: 5, 6, 7 s) with a fast migration rate was injected. Then capillary electrophoresis was run. The results are shown in Figure 2. Figure 5 As shown, the free ssDNA library peaks at 4.92 min.

[0046] Figure 5 As shown in the figure, when the H-Tf injection time is 5s, a group of H-Tf-ssDNAN40 complex peaks are detected at 2.50-3.80min, including four sharp signal peaks. This shows that H-Tf with a fast migration rate can pass through the ssDNA (N40) library with a slow migration rate during electrophoresis to form H-Tf-ssDNA (N40) complexes with four charge-to-mass ratios, and completely separate from the free ssDNA (N40) library. Increasing the H-Tf injection time significantly reduces the peak area of ​​the free ssDNA (N40) library, and is just 100% adsorbed at 7s ( Figure 5 d). Therefore, when the H-Tf injection time was 7 s, Copeptin peptide aptamer screening was performed.

[0047] (5) First round of screening

[0048] like Figure 2-1As shown, in the first round of screening, a 0.5 μM nucleic acid library (ssDNAN40) with a random sequence length of 40 nt was used, and Dca-SELEX was performed after incubation with 5 μM and 10 μM Copeptin at 37°C for 60 min. Copeptin-ssDNA complex has a similar migration rate to free ssDNA (N40), and the competitive adsorption protein HT-f has a fast migration rate. During the electrophoresis process, it passes through the sample segment of the ssDNA (N40) and the copeptin-ssDNA incubation mixture, and competes for the adsorption of all free and weakly bound ssDNA (N40), achieving the separation of the copeptin-ssDNA (N40) complex. When Copeptin is 5 μM, although complexes appear, the amount of complexes is small. Therefore, increasing the concentration of Copeptin to 10 μM, obvious complexes appear at 4.50-5.00 min, and the amount of complexes increases significantly. The time when the complex reaches the capillary outlet is calculated based on the peak time, and the electrophoresis program is set to collect the complex components at the section of 4.50-5.00, and the secondary library is prepared.

[0049] Figure 2-1 dcaCE-LIF screening of copeptin aptamers (first round). aH-Tf 10μM+ssDNAN400.5μM; bH-Tf 10μM+ssDNAN400.5μM+copeptin 5μM; cH-Tf 10μM+ssDNAN400.5μM+Copeptin 10μM.

[0050] (6) Second round of screening

[0051] like Figure 2-2 As shown in the figure, in order to increase the screening pressure, the target concentration was reduced in the second round of screening, and 5 μM Copeptin was used with the secondary library prepared in the first round. After incubation at 37°C for 60 min, Dca-SELEX was performed. Obvious complexes appeared at 4.50-5.00 min, and the amount of the complexes increased significantly compared with the previous round. The time when the complex arrived at the capillary outlet was calculated based on the peak time, and the electrophoresis program was set to collect the complex components at the section of 4.50-5.00, and the secondary library was prepared.

[0052] Figure 2-2 dcaCE-LIF screening of copeptin aptamers (second round). aH-Tf 10 μM + ssDNAN40 0.5 μM; bH-Tf 10 μM + ssDNAN40 0.5 μM + copeptin 5 μM.

[0053] (7) Third round of screening

[0054] like Figure 2-3As shown, in order to increase the screening pressure, the target concentration was further reduced in the third round of screening, and 3 μM Copeptin was used for screening. Considering that the subsequent aptamers will be used in serum, the artificial serum matrix diluted 20 times was introduced into the incubation process as the background buffer for incubation of the target and the nucleic acid library. After incubating the copeptin with the secondary library prepared in the second round in 20-fold diluted serum at 37°C for 60 minutes, Dca-SELEX was performed. Obvious complexes appeared at 4.50-5.00 min. The time when the complex arrived at the outlet of the capillary was calculated according to the peak time, and the electrophoresis program was set to collect the complex components at the section of 4.50-5.00, and the secondary library was prepared. After completing the third round of screening, the third round amplification library was purified and prepared for high-throughput sequencing.

[0055] Figure 2-3 dcaCE-LIF screening of Copeptin aptamers (third round, serum background). aH-Tf 10μM+ssDNAN400.5μM; bH-Tf 10μM+ssDNAN400.5μM+Copeptin 3μM.

[0056] (8) PCR reaction system: 2 μL of DNA template (10 ng / μl); 1 μL of upstream primer (10 μM); 1 μL of downstream primer (10 μM); 15 μL of 2×PCR Ready Mix (total volume 25 μL) (Kapa HiFi Ready Mix), wherein the sequences of the upstream primer and the downstream primer are as shown in primer P1 and primer P2 described in step (1). After the reaction system is prepared, the following reaction program is performed on a PCR instrument (BIO-RAD, T100TM): pre-denaturation at 98 degrees for 3 minutes, followed by 8 cycles, with the conditions of denaturation at 98 degrees for 30 seconds, annealing at 60 degrees for 30 seconds, extension at 72 degrees for 30 seconds, and finally extension at 72 degrees for 5 minutes. After the reaction is completed, keep at 4 degrees. After the PCR reaction is completed, use 2% agarose gel electrophoresis to detect the PCR product, confirm that the product size is correct, and use AMPure XP magnetic beads to purify and recover the PCR product.

[0057] (9) The final sequencing was performed using a NovaSeq 6000 / MiSeq sequencer (Illumina, San Diego, CA) with a double-end 150 bp / 300 bp sequencing mode.

[0058] (10) Analysis of candidate aptamer sequences: Reading errors and primer polymers were eliminated from the sequencing results, and the 200 sequences with the highest common frequency in the two sequencing results were selected, and the sequence motifs were analyzed online using MEME.

[0059] (11) Candidate sequence

[0060] The results of the third round of screening were subjected to high-throughput sequencing, and the sequences in the sequencing results were compared and analyzed. In the two sequencing results, there were multiple common sequences, and the 200 sequences with the highest frequency were enriched to a greater extent in the third round of screening.

[0061] (12) Secondary structure analysis of candidate sequences

[0062] Since the nucleic acid library used in the screening has primer sequences, the primer sequences may participate in the formation of the higher-order structure of the aptamer and interact with the target. Therefore, the primer sequences are first considered to be retained in the subsequent analysis and characterization. After identification, truncation and optimization are performed according to the structure. The secondary structure of the sequence seq42 was simulated by M-fold and the thermodynamic parameters were predicted (Table 1). The results show that this sequence generally forms a stem-loop structure ( Figure 1 ).

[0063] Table 1 Aptamer sequences and thermodynamic parameters

[0064]

[0065] The affinity and specificity of the in vitro screening of the Copeptin polypeptide aptamer Seq42 and Copeptin of the present invention are described in detail below in conjunction with specific examples.

[0066] Example 2 Affinity of candidate sequences to Copeptin

[0067] (1) In order to evaluate the affinity of the candidate sequences of Copeptin aptamers to copeptin, we incubated 0.5 μM seq42 with 2 μM copeptin. Figure 4 The affinity of the aptamer was evaluated by the peak area of ​​the Copeptin-aptamer complex (Table 2).

[0068] Figure 4 The aptamer candidate sequences and binding kinetic parameters are shown in Table 2.

[0069] Table 2 Aptamer candidate sequences and binding kinetic parameters

[0070] Name <![CDATA[K D (μM)]]> <![CDATA[Koff(s -1 )]]> <![CDATA[Kon(μM -1 ·s -1 )]]> Binding degree (%) Seq42 0.057±0.0153 0.200±0.000 3.607±0.856 71.660±2.839

[0071] from Figure 4 As shown in Table 2, the Copeptin polypeptide aptamer Seq42 can bind to Copeptin with high affinity, with K D The value is 57nM, which has application prospects in CVD diagnosis and prognosis.

[0072] Example 3 Specificity of aptamer Seq42

[0073] Principle: Fe3O4@Uio-66-NH2 material can bind to aptamers modified with phosphate groups. When there is a target protein in the reaction system, the target protein will compete for binding to the FAM-modified aptamer. The target and FAM-modified aptamer are released into the supernatant. A magnet is used to separate the material and the supernatant, and a fluorescence detector is used to detect the fluorescence value of the supernatant.

[0074] Preparation of detection probe: The aptamer (Seq42-FAM) solution with the 5'-end modified with a phosphate group and the 3'-end modified with FAM was obtained by diluting it to a concentration of 10 μM with PBS buffer, and then renaturing it; the Fe3O4@Zr-MOFs (0.5 mg / mL) nanomaterial was rinsed twice with double distilled water, and then 10 μM (30 μL) was added to the nanomaterial and placed at 26°C for 20 min to prepare the detection probe for use.

[0075] Specific protein preparation: Myeloperoxidase (MPO), B-type natriuretic peptide (BNP), creatine kinase isoenzyme MB (CKMB), cardiac troponin I (cTnI) and Copeptin. Each protein was diluted to 20 μg / mL. The aptamer probe was divided into 5 portions, each with a volume of 100 μL. 100 μL of protein was added to each aptamer probe and made up to 600 μL with double distilled water. The protein detection solution was incubated on a shaker at room temperature for 60 minutes. After the reaction was completed, the magnetic beads were suspended by a magnet, and the supernatant was retained and detected using a fluorescence detector (excitation wavelength was 492 nm and emission wavelength was 521 nm). The results are as follows: Figure 3 shown.

[0076] from Figure 3 The results show that the nucleic acid aptamer Seq42 of the present invention has a strong specific binding ability with copeptin.

[0077] The embodiments of the present invention are described above, but the present invention is not limited to the above-mentioned specific implementation modes. The above-mentioned specific implementation modes are merely illustrative and not restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms, which are all within the protection of the present invention.

Claims

1. A nucleic acid aptamer for Copeptin polypeptide, a diagnostic and prognostic biomarker for cardiovascular disease, characterized in that: The nucleic acid aptamer is Seq42, and its nucleotide sequence is: Seq42: 5'-AGCAGCACAGAGGTCAGATGTCATGATCGACCGTGAATGATGTAAA TTATACCGTATGGCCCTATGCGTGCTACCGTGAA-3'.

2. The nucleic acid aptamer according to claim 1, characterized in that: At 25 °C, 0.1 M Na + , 0.001M Mg 2+ Under the conditions, the secondary structure of the nucleic acid aptamer Seq42 is a stem-loop structure, and its molecular structure is as follows:

3. The nucleic acid aptamer according to claim 1, characterized in that: The 5' end or 3' end of the nucleic acid aptamer Seq42 is chemically modified with a fluorescent group, an amino group, biotin, digoxigenin or polyethylene glycol.

4. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in the preparation of a reagent, a kit or a sensor for detecting Copeptin polypeptide.

5. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in the preparation of a molecular probe for detecting Copeptin polypeptide.

6. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in detecting Copeptin polypeptide by fluorescence method.

7. A kit for specifically recognizing Copeptin polypeptide, characterized in that: It comprises the nucleic acid aptamer according to any one of claims 1 to 3.

8. A molecular probe, characterized in that: It comprises the nucleic acid aptamer according to any one of claims 1 to 3.

Images